ID: 992613755

View in Genome Browser
Species Human (GRCh38)
Location 5:78530722-78530744
Sequence CTGGCAGGTACAGGTGTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992613755_992613760 28 Left 992613755 5:78530722-78530744 CCAACAACACCTGTACCTGCCAG 0: 1
1: 0
2: 1
3: 19
4: 158
Right 992613760 5:78530773-78530795 GACTGCCCATTTATTCTAGAAGG 0: 1
1: 0
2: 1
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992613755 Original CRISPR CTGGCAGGTACAGGTGTTGT TGG (reversed) Intronic
902886263 1:19407149-19407171 CTGGCATATAAAGGTGTGGTAGG + Intronic
902976107 1:20089776-20089798 CTTGCACGGACAGGTGCTGTTGG + Exonic
904694050 1:32317689-32317711 CTGGCAGCTCCTGGAGTTGTCGG - Intronic
904942109 1:34171141-34171163 CTGGCAGGGACAGATGATGGGGG - Intronic
906960758 1:50418457-50418479 CAGACAGGTGCAGGTGTTCTCGG - Exonic
907110930 1:51925693-51925715 CTGAGTGGTAGAGGTGTTGTGGG - Intronic
911163075 1:94700977-94700999 TTGGCAGATACAGGTTATGTGGG + Intergenic
912218338 1:107642603-107642625 TTGGCAGGTACTGTTGTTGCAGG - Exonic
914331731 1:146677809-146677831 CTCTGAGGTCCAGGTGTTGTGGG - Intergenic
914998508 1:152565712-152565734 TTGGCAGGTACAGGGGTAGGGGG + Exonic
917735426 1:177915749-177915771 ATGGTAGGGACAGGTCTTGTTGG - Intergenic
919288866 1:195602297-195602319 CTGGCAGGGAGAGGTGTAGATGG - Intergenic
920434017 1:205936634-205936656 CTGGGAGGTAGAGGGGTGGTGGG - Intronic
922998404 1:229985132-229985154 CTGCCAAGCACAGGTGCTGTGGG - Intergenic
924775726 1:247113436-247113458 CTGGCAGGAGCAGGTGCTGTGGG + Intergenic
1062960522 10:1570380-1570402 CTCGCAGGTGCAGGTGCTGGGGG - Intronic
1066046623 10:31600938-31600960 GTGGCAGCTAAAGGTGTTTTTGG - Intergenic
1066180086 10:32953461-32953483 CTGACAGGGACAGATGTTGCTGG + Intronic
1070420856 10:76235718-76235740 CTGGCAGGGACATGAGTTTTGGG + Intronic
1073458810 10:103653802-103653824 GTGGCAGGCACAGGTGTGGCAGG - Intronic
1075709322 10:124522251-124522273 CTGGCAGGTAAAGGCCTTCTGGG + Intronic
1077864923 11:6214377-6214399 AGGGCAGGTACGGGTGTGGTGGG + Intronic
1079089404 11:17470185-17470207 CTGGCATGTACAGGTGCAGATGG + Exonic
1079773578 11:24496269-24496291 CTGGAAGGTAGAGGTTTTGTAGG - Intergenic
1082283645 11:50298147-50298169 CTGGCTGGGGGAGGTGTTGTGGG + Intergenic
1083598228 11:63930134-63930156 GCGGCAGGCACAGGTGCTGTAGG - Intergenic
1087396570 11:97608841-97608863 CAGGCAGGTACAGAGGTCGTGGG + Intergenic
1091606104 12:1952807-1952829 CTGGCAGGTGCTGGTGTACTAGG + Exonic
1093935490 12:24995957-24995979 GGGGCAGGTACAGGAGTTGCAGG + Exonic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1095938182 12:47707547-47707569 ATTGCAGGCACAGGTTTTGTGGG - Intergenic
1098958662 12:76715014-76715036 CTGGGAGGTGCAGGTGTGGATGG + Intergenic
1103658220 12:122491751-122491773 CTGGCAGGTGGAGGTTGTGTTGG + Intronic
1104459188 12:128940693-128940715 CTGGAAGGAACAGGTGCTTTGGG - Intronic
1104736149 12:131137033-131137055 CTGGCAGGTGCAGGTGCAGCTGG + Intronic
1111176822 13:84606299-84606321 CTGGCAGCCACTGCTGTTGTTGG - Intergenic
1113702067 13:112395437-112395459 CTGGCTGCTGCAGGTGTGGTTGG + Intronic
1113913424 13:113855602-113855624 CTGGCAGGGACAGCTGTGCTTGG + Intronic
1114550047 14:23527502-23527524 CAGGCAGGTGCATGTGTTGGGGG - Intronic
1114645777 14:24255309-24255331 TTGGCAGGAACACTTGTTGTGGG + Intronic
1119204556 14:72784379-72784401 CTGGCATGTAGAGGTGTTGAGGG - Intronic
1121082037 14:91115945-91115967 CAGGCAGGTACAGAAGTTTTGGG - Intronic
1123955112 15:25327186-25327208 CAGTCAGGTACAGGTGTTGGAGG - Intergenic
1127529597 15:59830509-59830531 GTGGCAGATCCAGGTTTTGTGGG - Intergenic
1129602760 15:77009865-77009887 CTGGCAGGCGTAGGTGGTGTGGG + Intronic
1129851884 15:78798212-78798234 CGGGCAGTCACAGGTGGTGTGGG - Intronic
1132650386 16:1018920-1018942 TGGGCAGGCACAGGTGTGGTGGG + Intergenic
1132826699 16:1908798-1908820 CTGGCAGGTGCCAGTGTGGTGGG + Intergenic
1132928629 16:2446825-2446847 GTGGCAGGTACAGGTGTCACAGG - Intronic
1134233924 16:12450834-12450856 CTGGCAAGTACAGCTGATGAAGG + Intronic
1135868583 16:26127818-26127840 CAGGCAGGTACATATGTTTTAGG - Intronic
1137472880 16:48777290-48777312 CTGGCAGGGAGAGGTGATGTGGG + Intergenic
1140001821 16:71033094-71033116 CTCTGAGGTCCAGGTGTTGTGGG + Intronic
1140017951 16:71206215-71206237 CTGGCAAGGACATGTCTTGTTGG + Intronic
1140491065 16:75336296-75336318 CTGGCAGGCACAGGAGTTAAGGG + Intronic
1144811222 17:18000665-18000687 GTGGAAGGTACAGGTTCTGTAGG - Intronic
1146385248 17:32365422-32365444 GGGGCAGGTACAGTTGCTGTTGG - Exonic
1149894198 17:60416444-60416466 CTGGCAGGTGAGGGGGTTGTGGG - Intronic
1152278275 17:79370933-79370955 CTGGGAGCTCCAGGTGTTCTTGG - Intronic
1153816706 18:8796832-8796854 CTGGCAGAGGCAGGTGCTGTTGG + Intronic
1154044264 18:10889668-10889690 CTGGAAGGTACAGGTGAAGCAGG + Intronic
1154066125 18:11109034-11109056 CTGGCAGCTGCAGTTGTTGGTGG - Intronic
1156341430 18:36213525-36213547 CAGGCAGCAACAGGTGTTGCTGG - Intronic
1156584586 18:38417808-38417830 CAGGAAGGTACACGAGTTGTAGG - Intergenic
1158040060 18:53082166-53082188 ATGCCATGTACAGGTTTTGTGGG + Intronic
1158869236 18:61668273-61668295 CTGGGAGGTAGAGGGGTAGTGGG + Intergenic
1159959049 18:74541411-74541433 CTGGCAGGTTCAGGAGCTGATGG + Intronic
1165977909 19:39693434-39693456 CTGGCATGTACAGGGCTTGTTGG - Intergenic
1166994736 19:46714663-46714685 CTGCCAGGTCCAGGTGTGTTAGG - Intronic
925001761 2:408788-408810 CTGACATGCCCAGGTGTTGTTGG - Intergenic
927196717 2:20552833-20552855 GTGGCAGGTGCATGTGTGGTGGG + Intergenic
928592118 2:32827734-32827756 GTGTCAGATACAGGAGTTGTTGG + Intergenic
931080638 2:58765976-58765998 CTTGCAGGTACAGGTGTGCTGGG + Intergenic
932473351 2:71979918-71979940 CTGTTAGGTACATTTGTTGTAGG - Intergenic
933589328 2:84214571-84214593 ATGGCTGGCACAGGTGTTGGCGG - Intergenic
934052943 2:88225439-88225461 GTGGCATGCACAGGTGATGTGGG + Intergenic
934525346 2:95048395-95048417 CTGGCGGGTACAGGTGGTGTGGG - Intronic
935268930 2:101416977-101416999 TTGGCAGGTCAAGGTGTTCTAGG - Intronic
937338651 2:121077117-121077139 CTGGCAGGTGCAGGTTGTGCAGG - Intergenic
937594285 2:123654848-123654870 CTGGCATGAATAGGTGTTTTTGG + Intergenic
938926365 2:136046597-136046619 CTGGCACAAACAGGTGTTGATGG - Intergenic
939449018 2:142348743-142348765 CTGGCAAGTTCATTTGTTGTAGG - Intergenic
940442522 2:153734993-153735015 CAGGAAGCTACAGGTGTTGAAGG - Intergenic
941639292 2:167970028-167970050 ATGGCAGGTACAGAGGTTCTGGG - Intronic
942269925 2:174264219-174264241 CTGTCAGGAACAGATGATGTCGG - Intergenic
942579403 2:177401178-177401200 CTGGCCAGTACAGGTGTAGGTGG + Intronic
943564871 2:189505545-189505567 CTGGAAGGTGAATGTGTTGTTGG + Intergenic
945203414 2:207307660-207307682 GGGGCAGGTACAGGTGTTATGGG + Intergenic
946422972 2:219575322-219575344 CTGGAAGGGACAGGTTTGGTGGG - Exonic
947825951 2:233106125-233106147 CTGACAGATACAAGTGTGGTGGG - Intronic
949032195 2:241802478-241802500 TGGGCAGGCACAGGTGTTTTAGG + Intronic
1172754928 20:37276912-37276934 ATGGCAGGTAAAGGGGTTGACGG + Intergenic
1173250597 20:41362411-41362433 CTGGCAGGGGCAGCTGCTGTGGG - Exonic
1175409435 20:58756406-58756428 CTGGCAGTTTCAGACGTTGTCGG + Intergenic
1176189218 20:63799926-63799948 CGGGTAGGTACCGGAGTTGTTGG - Intronic
1179843572 21:44093887-44093909 AGGGCAGGGACAGGTGCTGTGGG + Intronic
1180061922 21:45390097-45390119 CAGGCAGGGACAGGGGTTGGGGG - Intergenic
1181112310 22:20609360-20609382 CTGGAAGGACCAGGTGATGTTGG - Intergenic
1181713285 22:24705305-24705327 CTGGCGTGCACAGGTGTGGTAGG + Intergenic
1182680527 22:32075869-32075891 CTAGCAGGTACAGTTGATATCGG - Intronic
1182709045 22:32309087-32309109 CTGGAGGGTACAGGTGAGGTGGG + Intergenic
1183977767 22:41523198-41523220 CTGGCAGGCACAGATCTTGAGGG + Exonic
1184275705 22:43408521-43408543 CTGGCAGGTAGAGACCTTGTTGG + Intergenic
950142976 3:10627996-10628018 GGAGCAGGTACAGGTGTTGGGGG + Intronic
950365120 3:12477693-12477715 CTGGCAGGGACAGCAGTTGCAGG + Intergenic
950967127 3:17154316-17154338 AGGGCAGGGAGAGGTGTTGTGGG + Intergenic
952990377 3:38826426-38826448 CTGACAGTGACAGGGGTTGTGGG - Intergenic
958193758 3:90216641-90216663 CAAGCAGGGTCAGGTGTTGTAGG - Intergenic
960598307 3:119428734-119428756 CTGGCCGTTACAGGTGTTCTTGG + Intergenic
964097164 3:152945750-152945772 CTGTCAGACACAGCTGTTGTTGG - Intergenic
968618112 4:1591401-1591423 CTGGCAAGTACAGGGGTGGCTGG - Intergenic
968660534 4:1797008-1797030 CCGGCAGGAGCACGTGTTGTGGG + Intronic
968908927 4:3466853-3466875 CTGCCCGGCACAGGTGTTGGAGG - Intronic
969638599 4:8383523-8383545 CTGGCAGCTCCAGGAGTTCTTGG - Intronic
971294620 4:25377338-25377360 CTTGCAGGTACAGGCGCGGTCGG + Exonic
971498115 4:27289295-27289317 CTGGAAGATACAAGTGTTGGGGG - Intergenic
976838678 4:89406088-89406110 CAGGCAGATCCAGGTTTTGTGGG - Intergenic
977638710 4:99330858-99330880 ATGGGAGGTACAGTTGTTGTAGG - Intergenic
984313149 4:178090574-178090596 GTGGCAGGTATAGGTGGTATTGG - Intergenic
985579463 5:689324-689346 CTGGCAGGTGCGGCTGTTGGTGG + Intronic
985594309 5:781383-781405 CTGGCAGGTGCGGCTGTTGGTGG + Intergenic
986770159 5:10965681-10965703 GTGGCAGGTACTGGTGGTGTCGG + Intergenic
987061255 5:14246327-14246349 CTGGGAGGTACATGTGTTTGTGG + Intronic
992077454 5:73204288-73204310 CTGGGAGGTACATGTGTTAAAGG + Intergenic
992408623 5:76483555-76483577 CTGGCTCTTACAGGTGATGTGGG + Intronic
992613755 5:78530722-78530744 CTGGCAGGTACAGGTGTTGTTGG - Intronic
993861661 5:93143936-93143958 CTAGTAGGTGCAGGTGTTATAGG - Intergenic
997408166 5:133669163-133669185 CTGGCATGTCCAGCTGTAGTGGG - Intergenic
1000684536 5:164230747-164230769 CTGGTTGATACATGTGTTGTAGG + Intergenic
1003516797 6:6824830-6824852 CAGGCTGGTACAGGTGCTGAGGG - Intergenic
1004871139 6:19905431-19905453 CTGGCAGGGACAGCTTCTGTGGG - Intergenic
1005852859 6:29835204-29835226 CTGGCAGGTACTGATGTTGATGG - Intergenic
1005876465 6:30013714-30013736 CTGGCAGGTGCCGATGTTGATGG - Intergenic
1006190552 6:32205206-32205228 CTGGAAGGAACAGGTGATGGGGG + Intronic
1006826131 6:36937674-36937696 CTGGCAGGCACAGAGGGTGTGGG - Intergenic
1007229824 6:40340349-40340371 CTGACAGGTACAGATGTCGGAGG + Intergenic
1013432515 6:110067432-110067454 CTGACAGGCACAAGTGTTCTGGG - Intergenic
1018027466 6:159817345-159817367 CAGGCAGGCACAGGGGTGGTAGG - Intronic
1018374897 6:163201604-163201626 CTGGCAGCTACAGGTGTCTGGGG + Intronic
1018807252 6:167270960-167270982 CAGGAAGATACAGGTGTTGCAGG + Intergenic
1020279771 7:6644256-6644278 CTTGCAGGTGAAGGTGTTGGGGG + Intronic
1021240323 7:18192532-18192554 AGGGAAGGTAAAGGTGTTGTAGG + Intronic
1021425647 7:20496302-20496324 CTGGCAGGGACAGGATTGGTGGG - Intergenic
1022636956 7:32145064-32145086 CTGTCAAGCACAGATGTTGTCGG + Intronic
1023019349 7:35996734-35996756 CTGGCTGGTACAGCTATTGCTGG - Intergenic
1023135096 7:37043423-37043445 CTGCCAGGGCCAGGTGTTGGGGG + Intronic
1023793337 7:43770988-43771010 CTGGAAGGCACAGGTGGTGAAGG + Intronic
1024068784 7:45768627-45768649 CTGGCTGGTGGAGGTGTTGTGGG + Intergenic
1024167061 7:46745896-46745918 CTGGCAGCCAGAGGTGCTGTAGG - Intronic
1028007894 7:85600719-85600741 CTGGCTGCTACTGGTTTTGTGGG - Intergenic
1029510786 7:100993648-100993670 CTGGCAGGGAAGTGTGTTGTTGG - Exonic
1029511280 7:100996897-100996919 CTGGCAGGGAAGTGTGTTGTTGG - Exonic
1029511506 7:100998319-100998341 CTGGCAGGGAAGTGTGTTGTTGG - Exonic
1029512004 7:101001568-101001590 CTGGCAGGGAAGTGTGTTGTTGG - Exonic
1033599136 7:142876528-142876550 CTGGCAGGCAAAGGTTTTGTTGG + Exonic
1033605965 7:142928811-142928833 CTGGCAGGCAAAGGTTTTGTTGG + Exonic
1035390377 7:158500489-158500511 CTGGAGGGCACAGGTGCTGTGGG + Intronic
1035665527 8:1377147-1377169 CAGGTAGGGACAGGTGCTGTGGG - Intergenic
1036162523 8:6402958-6402980 CTGGAAGATGCAGGTGTTCTGGG - Intergenic
1037360434 8:18068503-18068525 TTGGCAGGTACAAGTGTCATAGG + Intronic
1038488564 8:27953348-27953370 CTGGCAAGTGCAGGAGATGTAGG - Intronic
1040842598 8:51800544-51800566 CTGGCAGGAAGAACTGTTGTGGG + Intronic
1041769270 8:61455727-61455749 GTGTCAGGAAAAGGTGTTGTAGG - Intronic
1047039547 8:120977761-120977783 CTGGCATATACAGCTGTTGTGGG - Intergenic
1048489951 8:134883486-134883508 CGGGTAGGTACAGGTGTTAAAGG + Intergenic
1048831934 8:138486103-138486125 CTGGAAGGTACTGGTGTAGCTGG + Intronic
1048898719 8:139017735-139017757 CTGGTTGCTACAGGAGTTGTGGG + Intergenic
1050388649 9:5114097-5114119 CTGGCAGGTGTAGGTGTGGTCGG - Intronic
1050587318 9:7125955-7125977 CTAGTAGGTACAGGCTTTGTAGG + Intergenic
1050904533 9:10987090-10987112 TTGGCAGCTCCATGTGTTGTTGG - Intergenic
1060548456 9:124474345-124474367 CAGGCAGGTGCTGGTGTTCTTGG + Intronic
1062542686 9:137048566-137048588 GTGGGAGGTACAGGGGTTGTGGG + Exonic
1203785074 EBV:123059-123081 CTGGCCGGGTCAGATGTTGTGGG - Intergenic
1186897077 X:14014317-14014339 CTGGCATGTACCTGTGTTCTGGG - Intronic
1187044688 X:15635113-15635135 CTGGCTGGTACAGGTTTTCAAGG + Intronic
1187075187 X:15927809-15927831 GTGGCAGGGACAGGTGTAGGCGG + Intergenic
1192838561 X:74828932-74828954 CCAGCATGTGCAGGTGTTGTCGG - Intronic
1194826992 X:98576530-98576552 CTGGCAGGTATACGAGTTGTTGG + Intergenic
1194917462 X:99723095-99723117 CAGGAAGGCACAGGTGTTGCTGG - Intergenic