ID: 992614969

View in Genome Browser
Species Human (GRCh38)
Location 5:78538939-78538961
Sequence CAGAGCTAGGAATTTGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992614969_992614973 6 Left 992614969 5:78538939-78538961 CCTACTTCAAATTCCTAGCTCTG 0: 1
1: 0
2: 0
3: 22
4: 246
Right 992614973 5:78538968-78538990 AATGGCGACATAATGACCCTAGG 0: 1
1: 0
2: 0
3: 3
4: 66
992614969_992614974 11 Left 992614969 5:78538939-78538961 CCTACTTCAAATTCCTAGCTCTG 0: 1
1: 0
2: 0
3: 22
4: 246
Right 992614974 5:78538973-78538995 CGACATAATGACCCTAGGCAAGG 0: 1
1: 0
2: 0
3: 3
4: 53
992614969_992614977 30 Left 992614969 5:78538939-78538961 CCTACTTCAAATTCCTAGCTCTG 0: 1
1: 0
2: 0
3: 22
4: 246
Right 992614977 5:78538992-78539014 AAGGCACTTGACACCTGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992614969 Original CRISPR CAGAGCTAGGAATTTGAAGT AGG (reversed) Intronic
903554717 1:24185241-24185263 AAGAGCTCGGACTTTGGAGTTGG - Intronic
904610762 1:31725092-31725114 CAGAGGAAGGAATGTGGAGTAGG + Intergenic
904765026 1:32839087-32839109 TAGAGCTATGGATTTGTAGTGGG - Intronic
907711527 1:56887098-56887120 TAAAGCTGGGAATTTGAACTTGG - Intronic
908163369 1:61433981-61434003 CAGGGTTAGGATTTTGCAGTGGG - Intronic
908301290 1:62762869-62762891 CAGAGTTAGAAATTTGAGCTGGG + Intergenic
910045505 1:82908992-82909014 CTGTGCTAGGAATTTGGAATAGG + Intergenic
910572344 1:88719988-88720010 TAGAGCTGGGATTTTGAACTAGG + Intronic
911634435 1:100218294-100218316 ATGAGATAGGAATTTGAAGGAGG - Intronic
913060249 1:115197847-115197869 CAGAGCACAGAATTTGAAGCAGG - Intergenic
915108364 1:153547974-153547996 CAGAGCAGGGAGGTTGAAGTCGG - Intronic
916984458 1:170175915-170175937 CAGAACTAGTAATTTGGTGTCGG + Intergenic
918586895 1:186198502-186198524 CAAAGGTAGCAATTTGAAATTGG + Intergenic
919256058 1:195126869-195126891 CAAAGATAGGAATTTGTGGTAGG - Intergenic
923492962 1:234500500-234500522 GAGAACTAGGAATTGGAACTAGG + Intergenic
924407592 1:243767092-243767114 AAGAGCTAAGAATTTGCAGAGGG + Intronic
1063562857 10:7146287-7146309 AAGAACTAGGACTTTGAAGAAGG - Intergenic
1064881756 10:20063436-20063458 AAGAGCTAAGAATCTGGAGTGGG - Intronic
1065756761 10:28937750-28937772 CAGAGCTGGGAATGGGAGGTGGG - Intergenic
1067170317 10:43900530-43900552 CAGAGCAAGCAATTTGACTTGGG + Intergenic
1068329888 10:55549497-55549519 CTTAGGTAGGAAGTTGAAGTTGG + Intronic
1068694088 10:59947281-59947303 CAGAGCTAGAGATATGAATTTGG + Intergenic
1071210162 10:83332199-83332221 CAGAGCATGGGAGTTGAAGTGGG + Intergenic
1071434267 10:85632440-85632462 CAGATCTAAGAATTAGAAGCTGG - Intronic
1072081989 10:92041873-92041895 GGGAGCAAGGAAATTGAAGTTGG + Intergenic
1073021298 10:100446529-100446551 CAGAGCTGGCAAATTGATGTTGG + Intergenic
1073053125 10:100682199-100682221 CAGAGCTAGGAATTAGACTCAGG + Intergenic
1074925967 10:118071209-118071231 TAGTGCTAGGTATTTGAGGTGGG - Intergenic
1075941976 10:126397537-126397559 CAGAGCTAGCAATCTGTACTGGG + Intergenic
1077599623 11:3565235-3565257 CAGATCTGGGAATGTCAAGTTGG - Intergenic
1077939651 11:6827175-6827197 CAGAGCAAGGATTTTAATGTAGG + Intergenic
1078476146 11:11632232-11632254 AAGATCTAGGAAGCTGAAGTAGG - Intergenic
1079834568 11:25317102-25317124 CAGAGATAAGAATTTGACTTTGG - Intergenic
1080046468 11:27813726-27813748 CAGAGCTGGGAATCTGCAGTAGG + Intergenic
1082898418 11:58218580-58218602 TAGAGCTATGCATTTGAAATGGG + Intergenic
1084292848 11:68186482-68186504 CAGAGCTGGGCAGTAGAAGTGGG + Intronic
1084541722 11:69791131-69791153 CAGAGCTAGGAATTACCTGTAGG + Intergenic
1086397507 11:86431957-86431979 CAGAGCTTTGAATATGAAGTTGG - Intergenic
1086942542 11:92813399-92813421 CAGAGCTAGGAAATTGATCTTGG + Intronic
1087339957 11:96891834-96891856 CAGATCCAGGAATTTAAAGAGGG + Intergenic
1089034257 11:115369381-115369403 CAGAGCAAGTAATATGAACTGGG + Intronic
1095973016 12:47917601-47917623 CAGAGCTAGGAATTGGACTCAGG + Intronic
1097724648 12:63061253-63061275 CAGAGCTAGGATTTTAATCTGGG - Intergenic
1100336642 12:93637357-93637379 CAGACCTAGGAGTTTGGAATTGG + Intergenic
1100825979 12:98474605-98474627 CATTTCCAGGAATTTGAAGTGGG + Intergenic
1101329923 12:103749396-103749418 CAGAGCTAAGAAATTAATGTTGG - Intronic
1102162170 12:110778363-110778385 AAGAGCTAGGAGTTTGGGGTTGG + Intergenic
1102546147 12:113657238-113657260 AAGAGCTAGGACTTTGGAGTTGG - Intergenic
1104600646 12:130151108-130151130 CAGAACTAGGATTTTGGAGGAGG - Intergenic
1109376795 13:61505751-61505773 AAGAGCTAGGGACTTGTAGTTGG - Intergenic
1110578079 13:77083668-77083690 CACAGCTAGGAAAGAGAAGTAGG + Intronic
1110827613 13:79990895-79990917 CGGGGTTAGGAGTTTGAAGTGGG - Intergenic
1111568102 13:90043036-90043058 GAGAACTAGGAATTTGAAGACGG + Intergenic
1111994726 13:95154039-95154061 AACAGCTAAGAGTTTGAAGTAGG - Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1113180945 13:107625371-107625393 CACAGCTAATAATTTGTAGTAGG - Intronic
1114569992 14:23660185-23660207 CACAGCCAGGAATCTGGAGTTGG + Intergenic
1115679249 14:35717962-35717984 CAGAGCTAGGAATATGCTCTAGG - Intronic
1118875551 14:69781906-69781928 CAGAGCTAGTTATTGAAAGTTGG + Intronic
1119300459 14:73567231-73567253 CACAGCTAGAAAGTGGAAGTTGG - Intergenic
1119696262 14:76715516-76715538 AAGAGATAGGAAACTGAAGTGGG + Intergenic
1121795991 14:96735760-96735782 CAGAGAGGGGAATTTTAAGTAGG - Intergenic
1121990833 14:98555580-98555602 CAGAGCCAGGAATTTGACAATGG - Intergenic
1122009519 14:98734561-98734583 CAGAGGTCGCAATTTGAAGAAGG + Intergenic
1123913675 15:24998469-24998491 CAGAGGATGGAATTTGAGGTAGG + Intergenic
1123971786 15:25514533-25514555 CAAAGGTGGGAATTTGAAGGTGG - Intergenic
1124878440 15:33618873-33618895 CAAATCTGGGAATTTGTAGTAGG + Intronic
1125357365 15:38830659-38830681 TAGAGATAGGAGTTTGAAATAGG - Intergenic
1126725971 15:51632814-51632836 CTGAGCTCGGAATGTGAATTTGG + Intergenic
1126924180 15:53564365-53564387 CACAGCTAGGAATTTTAGATAGG - Intronic
1127059775 15:55170399-55170421 CAGAGATAAGAATGTGGAGTCGG + Intergenic
1127790569 15:62394866-62394888 CAGAGCTATGAATTAGGACTGGG + Intronic
1128203369 15:65829108-65829130 CAGGACTAGGAAGATGAAGTAGG - Intronic
1129868585 15:78926712-78926734 CAGAGCTAGGAAATAGATGCTGG - Intronic
1129956363 15:79640376-79640398 CTAAGATAGGAATTGGAAGTAGG + Intergenic
1132507916 16:321621-321643 CACAGCTGGGAATATGAGGTAGG + Intronic
1133925807 16:10191287-10191309 CAGAGCCAGGAATTTTAATTGGG - Intergenic
1134872407 16:17663832-17663854 CAGAGCTAGCAGATTGAGGTGGG + Intergenic
1137569375 16:49555226-49555248 AAGGGCTAGGATTTTGGAGTGGG - Intronic
1137688707 16:50404884-50404906 CAGAGCTTGGGTTTTGAACTGGG - Intergenic
1138716323 16:59027363-59027385 CAGAGGTAGGAAAGTGAAATTGG - Intergenic
1138817288 16:60217196-60217218 CAAAGCTAGGAATTTTATGAGGG + Intergenic
1140168017 16:72574660-72574682 AAGAGGTAGGGATTTGAAATAGG + Intergenic
1140671175 16:77280633-77280655 CAGAGCTGGGAATTTCATATGGG - Intronic
1141106083 16:81234914-81234936 CAGAGTAAGTACTTTGAAGTCGG + Intergenic
1141171381 16:81693831-81693853 CAGAGCAAGGAATCTGAGCTGGG + Intronic
1144063282 17:11602078-11602100 CAGAGCTAGGAAAAATAAGTTGG - Intronic
1146953001 17:36919598-36919620 CACAGCTAGGAATTTGAGCCGGG - Intergenic
1146998215 17:37339370-37339392 CTTAGCTAGGAACTTGAAGTTGG - Intronic
1147467516 17:40621802-40621824 CAGAGCTAGTATTTACAAGTTGG + Intergenic
1148047724 17:44754112-44754134 CATAGCTATGAAGTTGAGGTGGG + Intergenic
1148449611 17:47767747-47767769 CGGAGTTGGGAATTTGATGTAGG + Intergenic
1149449617 17:56739425-56739447 CAGAGCTAGGAATTGGACCCAGG + Intergenic
1149681663 17:58511923-58511945 CAGAGCTAGGAAAATGAGGCAGG + Intronic
1150187788 17:63203747-63203769 AAGAGCAGGGAATTGGAAGTGGG + Intronic
1150202575 17:63372681-63372703 CAGAACTAGGATTTAAAAGTAGG + Intronic
1150214708 17:63460300-63460322 GAGGGCTAGGAAAATGAAGTTGG + Intergenic
1153400284 18:4677599-4677621 TAGAGCTAGGAGTCTGAATTTGG - Intergenic
1154928326 18:20963456-20963478 CAAATCTAGTGATTTGAAGTTGG - Intronic
1155284902 18:24277576-24277598 CAGAGCTAGGAATTAGAGCCAGG + Intronic
1156321277 18:36025992-36026014 GAGAGCTGGGAATTTGAGGTGGG + Intronic
1156391077 18:36651235-36651257 CAGAGCTCTGAATTTGAGGCGGG + Intronic
1156626265 18:38913214-38913236 CAAAGGGAGGAAGTTGAAGTTGG - Intergenic
1157063187 18:44317611-44317633 TAGACCTAGGAATTTAAAGTTGG - Intergenic
1157245673 18:46052190-46052212 AGGAGCTAGGAACTTGAACTAGG + Intronic
1157419005 18:47529845-47529867 CAGAGCTGGGTATCTGGAGTTGG + Intergenic
1157784346 18:50468747-50468769 CAGTGCTGGGAGTTTGGAGTTGG - Intergenic
1157882036 18:51329754-51329776 CAGAGCTAGTAAATTGGTGTGGG - Intergenic
1162179630 19:8859215-8859237 CTGAGCTAGGATTTTAAAGGTGG + Intronic
1166280981 19:41793056-41793078 CAGAGCTAGGATTTGGATCTAGG - Intergenic
1166986410 19:46662235-46662257 TAGAGCTAGGTCTTGGAAGTTGG - Intergenic
1168567351 19:57435934-57435956 CAGAGTTAGAAGTTTAAAGTTGG + Intronic
1168651544 19:58095575-58095597 CAGAGCTGGGAAGTTGGAGCAGG - Intronic
925554168 2:5110964-5110986 CAGAGCTAGGAAGTAGAGGGAGG + Intergenic
927029093 2:19102070-19102092 CTGAGATAGGAATTGGAGGTGGG + Intergenic
927736299 2:25525703-25525725 GAGAGCTAAGAATTAGAACTTGG - Intronic
929427920 2:41862952-41862974 CAGCACCAAGAATTTGAAGTTGG + Intergenic
930897339 2:56461713-56461735 CAGAGCTAGGATTTGGAACTAGG + Intergenic
931266040 2:60661167-60661189 CAGTGCTGGGAATTGGAAGCTGG - Intergenic
932752088 2:74377707-74377729 CAGATCCAGGTATTTGAAGATGG - Exonic
935110596 2:100091108-100091130 CAGAGCTGGGAATTTAATGCAGG - Intronic
936124376 2:109774054-109774076 CAGAGCTGGGAATTTAATGCAGG + Intergenic
936220313 2:110597410-110597432 CAGAGCTGGGAATTTAATGCAGG - Intergenic
937036280 2:118785313-118785335 CAGAGCAAGCAATTTGGAGGTGG - Intergenic
937098654 2:119251839-119251861 CAGAGGTAGGGTTTTGAAGGAGG - Intronic
938155912 2:128939822-128939844 GAGAGTTAGGAATTTGAGATTGG - Intergenic
938877136 2:135543964-135543986 CAGAGCTGTGAATTTCAATTAGG - Intronic
943024532 2:182611186-182611208 CAGTGCATGGAATTGGAAGTGGG - Intergenic
943108346 2:183574595-183574617 TATAGCTAGAAAATTGAAGTAGG + Intergenic
945317243 2:208382913-208382935 CAGAGCAAGGAACTTGGAGTGGG - Intronic
945523610 2:210860723-210860745 CGGACCTTGCAATTTGAAGTGGG + Intergenic
945911227 2:215651719-215651741 CAGAGAAAGAAATTTGAGGTTGG - Intergenic
946704628 2:222445970-222445992 CAGAGCAAAGAACTAGAAGTGGG + Intronic
1169402611 20:5295763-5295785 CAGAGCTGGGAATCCGAGGTTGG + Intergenic
1170946553 20:20896086-20896108 CAGAACTTGAAAATTGAAGTTGG + Intergenic
1173648029 20:44645862-44645884 AACAGCAAGGAATTTGAACTTGG - Intronic
1173966068 20:47113834-47113856 CCCATCTAGGAATTTGATGTGGG - Intronic
1175215617 20:57390496-57390518 AAAAGCTAGGAATTTCAAGTTGG - Intergenic
1176971245 21:15268485-15268507 CAGAGCTAGGATTCAAAAGTAGG + Intergenic
1177114008 21:17063753-17063775 CTGAACTAGGAATTTGAACAAGG - Intergenic
1177115157 21:17076190-17076212 AAGAGCCATGAATTTGAGGTGGG - Intergenic
1178173133 21:30064637-30064659 CTGACTTAGAAATTTGAAGTAGG - Intergenic
1179398764 21:41064924-41064946 TGGAGCTAGGAAAATGAAGTGGG - Intergenic
1180913214 22:19467911-19467933 CTGAGGTTGGAATTTGGAGTAGG + Exonic
1184917956 22:47586049-47586071 AAGACCAAGGAATTAGAAGTGGG - Intergenic
950324250 3:12090466-12090488 CAGAGCCAGAAATTTAAACTTGG - Intronic
951769092 3:26234990-26235012 TATTTCTAGGAATTTGAAGTGGG - Intergenic
953355104 3:42249295-42249317 CAGAGCTAGAAACTGGAAGTGGG + Intergenic
953546031 3:43864133-43864155 AAGAGCTGGGATTTTGGAGTTGG + Intergenic
953884044 3:46705579-46705601 CAGAGCCAGGTACTTGAAGTGGG - Intronic
956329426 3:68089179-68089201 CAGGGCTAGCAATTTAAATTTGG + Intronic
956499604 3:69868345-69868367 CAGGGCTAGGAATTTGACCCAGG + Intronic
957070440 3:75563866-75563888 CAGATCTGGGAATGTCAAGTTGG - Intergenic
957327560 3:78716163-78716185 CAGAGGGGGGAATTTGAATTTGG - Intronic
959516096 3:107268895-107268917 CTTACCTAGGAATTTGAAGGTGG + Intergenic
959856765 3:111168258-111168280 GAGAGAGAGTAATTTGAAGTAGG + Intronic
959872612 3:111345874-111345896 CAGAGAAGGGATTTTGAAGTTGG - Intronic
961283645 3:125782669-125782691 CAGATCTGGGAATGTCAAGTTGG + Intergenic
963536903 3:146540821-146540843 GAAAGGTAGGAATTTCAAGTAGG + Intronic
964635382 3:158852587-158852609 CAGAGCTATGGATATGAATTAGG - Intergenic
966461340 3:180180240-180180262 CAGAGACTGGAATTTGAATTTGG + Intergenic
967492119 3:190104676-190104698 CCGTGCTAGGAATTGAAAGTAGG - Intronic
969623474 4:8290564-8290586 CAGAACCAGGAAGTTGATGTGGG + Intronic
969739924 4:9016885-9016907 CAGATCTGGGAATGTCAAGTTGG + Intergenic
970095325 4:12457492-12457514 TAGAGCTATTAAGTTGAAGTAGG + Intergenic
970716923 4:18937170-18937192 TAGAGCTAGGACTTAAAAGTTGG - Intergenic
970842864 4:20496234-20496256 CAGAAGTATGAATTTGTAGTTGG - Intronic
973009096 4:45049468-45049490 CAAAGCCAGGAATTTGACATTGG + Intergenic
978415284 4:108468411-108468433 CAGAGCTAGCAGTTAGAAGGTGG + Intergenic
980793679 4:137653221-137653243 CAGAGTTTGGAATTTGGATTTGG - Intergenic
980899479 4:138890832-138890854 CAGAGCTAGGCATTTGCTGCGGG - Intergenic
981477067 4:145197691-145197713 CAGTGCTAGGTATTTGAACAGGG - Intergenic
981765596 4:148245403-148245425 CAGAGCTAGGAATTGCACGCAGG - Intronic
983743749 4:171168492-171168514 CAGTGGAAGGAATTTGAAGATGG + Intergenic
986931610 5:12831078-12831100 GAAAGCTAGGTATTTGAAGGTGG - Intergenic
987052587 5:14160338-14160360 CTGAGCTAGGCATTTGAAACTGG - Intronic
987432907 5:17858392-17858414 GAGAGCTGGGAATTTGTTGTTGG - Intergenic
988417996 5:30970335-30970357 CAATGTTTGGAATTTGAAGTGGG - Intergenic
990597934 5:57329936-57329958 CAGAGCTGGGAATGGGAAGGAGG - Intergenic
990881937 5:60548188-60548210 GAGAGATAGTAATTTGAAGAGGG - Intergenic
991145306 5:63296005-63296027 CAGAAATATGAATATGAAGTAGG - Intergenic
991246303 5:64511885-64511907 CTGAGCTAGGTATGTGAAGCAGG + Intronic
991673969 5:69074622-69074644 CAGAGGCAGGAATTGGAATTGGG + Intergenic
991932132 5:71763884-71763906 CAGTGGTAGGAAATTGTAGTAGG + Intergenic
992614969 5:78538939-78538961 CAGAGCTAGGAATTTGAAGTAGG - Intronic
994319895 5:98382013-98382035 CAGAGGCAGGAAATGGAAGTGGG - Intergenic
995050343 5:107696343-107696365 CAGAGTTAGGAATTAGAGTTTGG + Intergenic
996573612 5:124959547-124959569 CAGAGATAGGAGTTTTAAGGAGG + Intergenic
1000508037 5:162146256-162146278 CAGAGCACAGCATTTGAAGTCGG + Intronic
1001018248 5:168161023-168161045 CAGTGGTGGGAATTTGAGGTAGG - Intronic
1004085105 6:12439736-12439758 CGGACCTAAGAATTTGAGGTTGG + Intergenic
1004538065 6:16522096-16522118 CAGAGCTAGGATTTTGATACTGG - Intronic
1006483240 6:34316012-34316034 AAGAGCCAGGCTTTTGAAGTGGG - Intronic
1007451413 6:41942286-41942308 CAGAGCTAGGATTGGGAAGCTGG + Intronic
1007700880 6:43765945-43765967 CAGAGCCAGGAATGTGACTTGGG + Intergenic
1008976210 6:57430031-57430053 CAAGGCTAGGAAGTTGAAATTGG + Intronic
1010021247 6:71162360-71162382 AAGTGCTAAAAATTTGAAGTGGG - Intergenic
1012269010 6:97184400-97184422 CCAAGCTAGAGATTTGAAGTTGG - Intronic
1014138797 6:117917780-117917802 CAGAGCTTGGAATTTGGATTTGG + Intronic
1014533671 6:122591172-122591194 GAGAGATAGGAATTAGATGTGGG - Intronic
1015861134 6:137681398-137681420 CAGAGCTAAGAAATTCAAGGTGG - Intergenic
1015979078 6:138820810-138820832 CAGTGCTTTGAATTTGATGTCGG + Intronic
1016629385 6:146210579-146210601 CAGGGATAGGAGTTTGAGGTAGG + Intronic
1017386809 6:153895149-153895171 CAGAGCTAGGTATAGGAAGTTGG - Intergenic
1019496454 7:1342652-1342674 CAGAGCATGGAATTTGTTGTAGG - Intergenic
1020774376 7:12434896-12434918 CAGAAATAGGAATTTTCAGTAGG - Intergenic
1023042044 7:36180700-36180722 CAGAGGAAGGGATTTTAAGTTGG - Intronic
1027531259 7:79336316-79336338 AAGAGCTTGGGCTTTGAAGTTGG - Intronic
1028319103 7:89438078-89438100 CACAGCTTGGAATGTGAATTAGG + Intergenic
1028394756 7:90356062-90356084 TAGAACTAGGAATTTGGAGTAGG - Intronic
1030211194 7:106997282-106997304 CAGAGCTGGGACTCTGAAATAGG + Intergenic
1032631861 7:133661915-133661937 TGGAGCTAGGAATTTGTATTTGG + Intronic
1032971839 7:137173603-137173625 CACAGTTGGGAACTTGAAGTTGG - Intergenic
1036403650 8:8433329-8433351 TAGAGCTAGAAATTGGAAATTGG + Intergenic
1038085765 8:24194678-24194700 AACAGCTAGGAATTTGAACTAGG + Intergenic
1038127137 8:24687211-24687233 AAGAACTAAGAATTTAAAGTGGG - Intergenic
1038507530 8:28097933-28097955 CAGAGCTGGGATTTGGAATTAGG + Intronic
1041237941 8:55823636-55823658 CAGAGCTAGGATTATGTAGCAGG + Intronic
1044139023 8:88625218-88625240 CAAAGCTAAGAAATTGAAATTGG + Intergenic
1044498267 8:92917881-92917903 CAGAGCCAGGGATGGGAAGTGGG - Intronic
1044938904 8:97320431-97320453 GAGAGCTAGGAAATAGAAGTAGG - Intergenic
1046106893 8:109677076-109677098 AAGAGCTAGAAATCTGTAGTTGG + Intronic
1047636647 8:126770750-126770772 TTGATCTAGGAAGTTGAAGTAGG + Intergenic
1047643354 8:126844285-126844307 CAGAGCTAGGATTTGGACCTAGG - Intergenic
1047756406 8:127922343-127922365 TAGAGCTAGGAATCCGAAGTAGG + Intergenic
1048692064 8:136977671-136977693 CAGAGATAAGAATTGAAAGTGGG + Intergenic
1048965001 8:139608880-139608902 CAGAGCTGGGCTTTTGAACTGGG + Intronic
1050418544 9:5438735-5438757 CAGAGCTAGAAATTGAAGGTAGG - Intergenic
1051053613 9:12957967-12957989 CAAAGGTTGGAATTTGAACTAGG - Intergenic
1051854568 9:21549074-21549096 CAGAGCCAGGATTTTAAACTAGG + Intergenic
1051985401 9:23079510-23079532 GAGAGCAAGAAAATTGAAGTTGG - Intergenic
1052616061 9:30843362-30843384 CACAGCTATGAACTTGAAGATGG + Intergenic
1052810278 9:33052198-33052220 CAGAACTAGGAAATTGACATTGG - Intronic
1052866297 9:33466477-33466499 CAGAGTCAGGAGTTGGAAGTGGG + Intronic
1055130234 9:72766554-72766576 CAGAGCAAGAAAGTGGAAGTGGG + Intronic
1057112500 9:92486658-92486680 CAGAACTAGAAACTTCAAGTAGG - Intronic
1058361994 9:104158666-104158688 CAGAGCCAGGTAGTTCAAGTAGG - Intergenic
1058512861 9:105738525-105738547 CAGTGCTAGGAACTTGTAGTTGG + Intronic
1059480203 9:114583412-114583434 CAGGGCTAGGGATTTGAACTCGG + Intergenic
1185611585 X:1396524-1396546 CACACCCAGGAATTGGAAGTGGG + Intergenic
1186545317 X:10443042-10443064 CAGACCTAGAGATTTGAATTTGG + Intergenic
1188557711 X:31430740-31430762 CAGACCTAAGAATTGGAATTGGG + Intronic
1189745015 X:44160059-44160081 TAGAGCTAAGGATTTGAACTAGG + Intronic
1190473331 X:50804548-50804570 AAGAGCATGGGATTTGAAGTTGG + Intronic
1191983798 X:66956529-66956551 CAGATCTAAGATTTTGAGGTGGG + Intergenic
1193603579 X:83538800-83538822 CAGAGCTAGGATTTTGACCCAGG - Intergenic
1193895024 X:87102750-87102772 AAGAACAAGGAACTTGAAGTTGG - Intergenic
1194431583 X:93813807-93813829 CAGAGTTAAACATTTGAAGTTGG + Intergenic
1195130551 X:101846712-101846734 CACAGCTTGGGCTTTGAAGTGGG + Intronic
1195286011 X:103384932-103384954 CAGAGCTTAGAATAAGAAGTTGG - Intergenic
1195723749 X:107892045-107892067 CAGAGCAAGGAATTTCTACTGGG - Intronic
1196746531 X:119075563-119075585 AAAAGCTAAGAATTTCAAGTAGG + Intergenic
1196950656 X:120873384-120873406 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196951350 X:120878288-120878310 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196951491 X:120929777-120929799 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196952175 X:120934638-120934660 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196952860 X:120939499-120939521 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196953545 X:120944359-120944381 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196954230 X:120949220-120949242 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196954913 X:120954080-120954102 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196955603 X:120958963-120958985 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196956283 X:120963824-120963846 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196956965 X:120968684-120968706 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196957647 X:120973544-120973566 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196958329 X:120978404-120978426 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1196959011 X:120983264-120983286 AAAAGCTAAGAATTTCAAGTAGG - Intronic
1197296652 X:124727427-124727449 CTGAATTAGGAATTTGAATTGGG + Intronic
1198768838 X:140106801-140106823 TAGAGCTAGGATTTTGACTTAGG + Intergenic
1199688698 X:150289721-150289743 CAAAACTAGGAATTTGATATTGG - Intergenic