ID: 992615630

View in Genome Browser
Species Human (GRCh38)
Location 5:78543587-78543609
Sequence CAGCCAGAAGGCCAGGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 1, 1: 0, 2: 7, 3: 59, 4: 515}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992615630_992615640 11 Left 992615630 5:78543587-78543609 CCCCAGGCCTGGCCTTCTGGCTG 0: 1
1: 0
2: 7
3: 59
4: 515
Right 992615640 5:78543621-78543643 TCAGGAGCCAGCAAAGCCCAGGG No data
992615630_992615638 -7 Left 992615630 5:78543587-78543609 CCCCAGGCCTGGCCTTCTGGCTG 0: 1
1: 0
2: 7
3: 59
4: 515
Right 992615638 5:78543603-78543625 CTGGCTGCAGGGATGAGGTCAGG 0: 1
1: 0
2: 3
3: 40
4: 425
992615630_992615642 24 Left 992615630 5:78543587-78543609 CCCCAGGCCTGGCCTTCTGGCTG 0: 1
1: 0
2: 7
3: 59
4: 515
Right 992615642 5:78543634-78543656 AAGCCCAGGGCAGCCCCACTAGG 0: 1
1: 0
2: 1
3: 20
4: 254
992615630_992615643 25 Left 992615630 5:78543587-78543609 CCCCAGGCCTGGCCTTCTGGCTG 0: 1
1: 0
2: 7
3: 59
4: 515
Right 992615643 5:78543635-78543657 AGCCCAGGGCAGCCCCACTAGGG No data
992615630_992615639 10 Left 992615630 5:78543587-78543609 CCCCAGGCCTGGCCTTCTGGCTG 0: 1
1: 0
2: 7
3: 59
4: 515
Right 992615639 5:78543620-78543642 GTCAGGAGCCAGCAAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992615630 Original CRISPR CAGCCAGAAGGCCAGGCCTG GGG (reversed) Intronic
900124578 1:1063826-1063848 CAGCCAGGAGGGCAGGGATGGGG - Intergenic
900158821 1:1213893-1213915 CAGCCAGGAGGCTGGTCCTGGGG - Intronic
900168461 1:1254486-1254508 CGCCCAGGAGGCCCGGCCTGCGG + Intronic
900618909 1:3578056-3578078 TGGGCAGAAGGCCAGCCCTGAGG + Intronic
901077894 1:6566880-6566902 CAGCTAAAAGGCCAGGCGCGTGG - Intronic
901199485 1:7458491-7458513 CAGCCAGAATGCCAAGCCAAGGG + Intronic
901320272 1:8335716-8335738 CAGCACCAAGGGCAGGCCTGGGG + Intronic
901331240 1:8410358-8410380 TAGCCAGAAGCCCAGGCAGGGGG + Intronic
901446262 1:9309996-9310018 CAGCCAGAAGCCCAGGACCTCGG - Intronic
902235403 1:15054132-15054154 CAGGAAGAACTCCAGGCCTGGGG + Intronic
902612062 1:17603239-17603261 TAGCCAGATGGGCAGGCCTGCGG + Intronic
902717230 1:18281075-18281097 CCTCCTGCAGGCCAGGCCTGTGG - Intronic
902824626 1:18964583-18964605 CAGCCAGAAGTCCTGCCCTGAGG + Intergenic
903267474 1:22166564-22166586 CAGCCAGGAGCCCAGGTCAGAGG + Intergenic
903335159 1:22619736-22619758 CAGCCAGAGGACCAGGGCTGGGG + Intergenic
904087047 1:27916582-27916604 CACACACAAAGCCAGGCCTGTGG - Intergenic
904263787 1:29306206-29306228 CAGCCAGGAGGCCTGGGCTTGGG + Intronic
904493458 1:30874124-30874146 GAGCCAGAAGGCAGGTCCTGGGG + Intronic
904562872 1:31410492-31410514 CAGGCAGGAGGCCAGGACAGTGG + Intronic
904709556 1:32419109-32419131 CATCCAGAAAGCCAGGCATCAGG - Intergenic
904899508 1:33845824-33845846 CAGCCAGAAAGCCTGGCCCTAGG + Intronic
905691019 1:39942859-39942881 CAGTCACAAGCCCAGGCCTCTGG + Intergenic
905692088 1:39950941-39950963 CAGTCACAACGCCAGGCCTCTGG + Intergenic
905745458 1:40413367-40413389 AAGCCAGAATGCCAAGGCTGAGG + Intronic
905878886 1:41450777-41450799 GAGGCAGAAGGACTGGCCTGAGG + Intergenic
906009109 1:42506694-42506716 CATCCAGAAAGCCAGGCATCAGG + Intronic
906064278 1:42969019-42969041 CAGCCACAAGACCAGGCCTCCGG - Intergenic
906715826 1:47968387-47968409 CTGCCAGAAGGCCAGGACCTTGG + Intronic
912438919 1:109683361-109683383 CAGGAAGAAGGCCAGGCCCCAGG - Intronic
912441441 1:109701806-109701828 CAGGAAGAAGGCCAGGCCCCAGG - Intronic
912723740 1:112041409-112041431 CAGACCAAAGGCCAGGCCTGAGG - Intergenic
912913684 1:113789576-113789598 CAGTCACAAGTCCAGGCCTCTGG - Intronic
913361894 1:117989862-117989884 GAGCCACCAGGCCGGGCCTGGGG + Intronic
913583507 1:120250236-120250258 AAGCCATAAGGACAGGCATGGGG - Intergenic
913624669 1:120648083-120648105 AAGCCATAAGGACAGGCATGGGG + Intergenic
914565494 1:148862073-148862095 AAGCCATAAGGACAGGCATGGGG - Intronic
914607331 1:149268176-149268198 AAGCCATAAGGACAGGCATGGGG + Intergenic
915021568 1:152784870-152784892 TTGGCGGAAGGCCAGGCCTGAGG - Intronic
915259612 1:154667341-154667363 GAGCCACCATGCCAGGCCTGTGG - Intergenic
915536968 1:156542472-156542494 GAGCCACCAGGCCCGGCCTGGGG + Intronic
915731611 1:158058146-158058168 CTCCCAGAGGGCCAGGCCTCGGG + Intronic
916186485 1:162138598-162138620 CAGACAGGAGCCCAGGCCTCTGG - Intronic
916254574 1:162773582-162773604 CAACAAGAATGCCAGGTCTGTGG + Exonic
916787339 1:168096190-168096212 AGGCCAGAGGGCCAGGGCTGGGG + Intronic
918046029 1:180941493-180941515 CCGCCAGCCGCCCAGGCCTGGGG + Intronic
918144314 1:181742256-181742278 CAGAGAGAGGGCCTGGCCTGGGG + Intronic
918146565 1:181761418-181761440 CAGACACTAGGCCAGGCCTTTGG - Intronic
919715259 1:200769525-200769547 CAGTCACAAGTCCAGGCCTCCGG + Intronic
919864476 1:201770038-201770060 CAGCCAGAGGGCCAAGGGTGTGG - Intronic
920046559 1:203136500-203136522 CAGGCACTTGGCCAGGCCTGGGG + Intronic
922464046 1:225834480-225834502 ATGCAAGCAGGCCAGGCCTGTGG + Intronic
922568476 1:226617470-226617492 CAGCCAGCAGGCAAACCCTGAGG + Intergenic
922722172 1:227904724-227904746 CAGCCAGAGGCCCAGGAGTGGGG + Intergenic
922805268 1:228383410-228383432 CAGTCAAAAGTCCAGGCCTCTGG + Intergenic
923050361 1:230387487-230387509 CATCCAGGAGGCCAGGCTGGGGG + Intronic
923517384 1:234709171-234709193 GAGCCAGTAGGGCAGGCATGTGG + Intergenic
1062976672 10:1688598-1688620 CAGTCAGAAGGCCAGGCGGGGGG - Intronic
1063044480 10:2377622-2377644 CAGGCAGAAGTCCAGACATGGGG + Intergenic
1063313339 10:4977765-4977787 CTGCCAGAAGGCCCTGCGTGTGG + Exonic
1063314614 10:4989951-4989973 CTGCCAGAAGGCCCTGCGTGTGG - Exonic
1063959174 10:11292742-11292764 CAGCGGGAAGGGCAGGTCTGTGG - Intronic
1064526254 10:16259911-16259933 CTGACAGATGGCCAGGACTGAGG - Intergenic
1064746420 10:18482794-18482816 GAGCCACCACGCCAGGCCTGGGG + Intronic
1065783950 10:29195656-29195678 CAGCCAGAAGTCGAAACCTGAGG - Intergenic
1065938234 10:30540659-30540681 CGCCCAGAAGGCCAGGCCTCTGG + Intergenic
1066210544 10:33233144-33233166 CACCCAGAAGGAAAGGCTTGGGG - Intronic
1067002141 10:42625755-42625777 GAGCCACCAGGCCTGGCCTGAGG + Intronic
1067061551 10:43080512-43080534 AAGCCAGAGGGCCAGGGCTGGGG - Intronic
1067214948 10:44293691-44293713 CTGCCTGGAGGCCAGGGCTGAGG - Intronic
1067338973 10:45385728-45385750 CAGCCAGGAGGGGAGGCTTGAGG - Intronic
1067826213 10:49575244-49575266 CCTCCAGAAGGCCCTGCCTGAGG + Intergenic
1068362992 10:56004274-56004296 CTGCCTGAAGGCCATGTCTGAGG + Intergenic
1068726118 10:60305289-60305311 GGGCCAGGAGTCCAGGCCTGGGG + Intronic
1068885351 10:62091929-62091951 CAGCCAGGAAGCTAGGCATGTGG - Exonic
1069120828 10:64567362-64567384 CAGCGAGAATGCCAAGCCAGTGG + Intergenic
1069454121 10:68540318-68540340 CAGCCTGAAGACCAGGGATGGGG - Intergenic
1070575310 10:77672930-77672952 CAGCTAGAATTCCAGCCCTGGGG - Intergenic
1070791802 10:79194028-79194050 CAGCCAGAAGGGAAAGCCTAGGG - Intronic
1071598459 10:86944320-86944342 CAGACAGCCTGCCAGGCCTGTGG - Exonic
1071600825 10:86958034-86958056 CAGCCAGAGGCCAAGGCATGAGG + Intronic
1072765688 10:98093558-98093580 CACCCAGGAGGTCAGGCCGGAGG + Intergenic
1072805637 10:98422564-98422586 CAGCTAGAAGCCCAGGACAGAGG - Intronic
1073124429 10:101140772-101140794 CAACCAGAGGGCCAGATCTGAGG - Intergenic
1074864591 10:117537396-117537418 CAGCCACAATTCCATGCCTGAGG - Intergenic
1074865032 10:117539949-117539971 CAGCCAGATGTCCCTGCCTGGGG + Intergenic
1075457070 10:122591798-122591820 TGGCCAGAAGGCCAGGAATGAGG - Intronic
1075689465 10:124385816-124385838 CAGCCAGGAGGCCTGGGCTGGGG + Intergenic
1075917498 10:126181799-126181821 CAGTCAGAAGATCAGGCCTTTGG + Intronic
1076143326 10:128096870-128096892 CAGCCTGGAGGACAGGCATGGGG + Exonic
1076606716 10:131694330-131694352 CAGCCCCACGCCCAGGCCTGGGG + Intergenic
1077039823 11:515120-515142 GACCCACAAGGCCTGGCCTGTGG + Intergenic
1077065846 11:640627-640649 CGGCCTGATGGCCAGGCCTCAGG + Exonic
1077350407 11:2090571-2090593 TAGCCAGATGAGCAGGCCTGTGG - Intergenic
1077485106 11:2834968-2834990 CAGGTTGGAGGCCAGGCCTGGGG - Intronic
1077521398 11:3037511-3037533 CAGCCACAGGGAAAGGCCTGAGG + Intronic
1077665177 11:4101607-4101629 GAGCCACTAGGCCTGGCCTGTGG + Intronic
1078667602 11:13339563-13339585 CAGTCAGAGGGCCAGGTGTGGGG - Intronic
1080643677 11:34173319-34173341 CAGAGAGAGGGTCAGGCCTGGGG + Intronic
1080917026 11:36670394-36670416 CATCCAGAAAGCCAGGCATCAGG - Intergenic
1081675525 11:44966852-44966874 CAGCCAGCAGGCCGGGCCCAGGG - Intergenic
1081686776 11:45048550-45048572 GAGACAGAAGGCCAGGTCAGTGG - Intergenic
1082693501 11:56332309-56332331 CAGCCATGAGGCCCGGGCTGTGG + Intergenic
1084162157 11:67355787-67355809 AAGGCAGAAAGCCAGGCCTAGGG - Intronic
1084169255 11:67392588-67392610 CAGCCAGAGGGCTGGGTCTGTGG + Intronic
1084323488 11:68386249-68386271 CAGGCACAAGTCTAGGCCTGGGG - Intronic
1084441011 11:69173417-69173439 CAGCCAGAAAGCATGTCCTGGGG - Intergenic
1084482741 11:69431315-69431337 GAGGCAGATGGCCAGGCCAGAGG - Intergenic
1084603432 11:70159735-70159757 CAGCTGGAGCGCCAGGCCTGTGG - Intronic
1084604717 11:70165734-70165756 CAGCCACCATGCCTGGCCTGGGG - Intronic
1084727138 11:70949323-70949345 CGGGCAGCATGCCAGGCCTGGGG - Intronic
1084883943 11:72191162-72191184 CAGCCAGCTGGACAGCCCTGGGG - Intronic
1084961818 11:72720905-72720927 CAGACAGCAGGGCTGGCCTGTGG - Intronic
1085045276 11:73349106-73349128 CAGCCAGAATGCCAGGCAGGAGG + Intronic
1085477909 11:76799301-76799323 CTGGCAGGAGGCCAGGGCTGCGG - Intergenic
1085507757 11:77069851-77069873 CAGCAGGAAGGCCAAGCCTCAGG - Intronic
1085610646 11:77945697-77945719 CAGCCAAAAAGCCAATCCTGCGG + Intronic
1088280034 11:108126285-108126307 GAGCCACTAGGCCCGGCCTGAGG + Intronic
1088746656 11:112809675-112809697 CAGCTTTATGGCCAGGCCTGGGG + Intergenic
1088866331 11:113851401-113851423 CAGCAAGGAGGCCAGGGCTAAGG - Intronic
1089070036 11:115692787-115692809 CATCCAGCAGGGCTGGCCTGGGG - Intergenic
1089583404 11:119495463-119495485 CAGCCAGAGGGACCTGCCTGAGG + Intergenic
1089770264 11:120797347-120797369 CAGCCAGGCAGCCAGGCCTGGGG + Intronic
1090953781 11:131496935-131496957 AAGCCAGAGGGAGAGGCCTGAGG - Intronic
1092262871 12:6961883-6961905 CAGCCGGAAGCGCAGACCTGAGG + Intergenic
1092450796 12:8600282-8600304 CAGTCACAAGTCCAGGCCTCTGG + Intergenic
1092930703 12:13312763-13312785 CAGACAGGAGGCCAGGCCAGAGG - Intergenic
1093691885 12:22118337-22118359 CATCCAGGAGGCCTGGGCTGTGG - Intronic
1094199172 12:27779949-27779971 CAGCCGGCAGGTCAGGCCGGCGG + Intergenic
1094498874 12:31006072-31006094 CAGGAAGGAGGCAAGGCCTGTGG + Intergenic
1096467545 12:51855778-51855800 GAGCCAGGAGCCCAGGCCTCTGG + Intergenic
1097692047 12:62742720-62742742 TATCCACAAGTCCAGGCCTGAGG - Intronic
1098059183 12:66541630-66541652 CAGCCACATGGGCAGACCTGGGG + Intronic
1098878666 12:75893238-75893260 CAGCCAGCAGCAGAGGCCTGTGG - Intergenic
1100122591 12:91386043-91386065 CTGACAGAAGGGCAGGGCTGGGG - Intergenic
1100308222 12:93370817-93370839 CAGTCACAAGGTCAGGCCTCTGG + Intergenic
1101379113 12:104198691-104198713 CAAAAAGAAGGCCAGGCGTGGGG + Intergenic
1101647558 12:106645310-106645332 CAGCAAGTAGGCCGGGACTGCGG - Intronic
1101751202 12:107583755-107583777 CATCCTGAATGCCAGGGCTGAGG - Intronic
1101772816 12:107767237-107767259 CAGTCACAAGTCCAGGCCTGTGG + Intergenic
1103704136 12:122862322-122862344 AGGCCCGAGGGCCAGGCCTGAGG - Exonic
1103938168 12:124487368-124487390 CAGCCAGAAGGGTAAGCCTTAGG + Intronic
1104162929 12:126198087-126198109 CAGCCAGCAGGCTAGCTCTGGGG - Intergenic
1104857718 12:131909737-131909759 CAGCCTGACTGCCAGGGCTGCGG - Intronic
1104919232 12:132281997-132282019 CTGCAGCAAGGCCAGGCCTGGGG + Intronic
1104919293 12:132282221-132282243 CTGCAGCAAGGCCAGGCCTGGGG + Intronic
1104935135 12:132360406-132360428 GAGCCAGAAGGCCGGACTTGAGG + Intergenic
1104974517 12:132546445-132546467 CACCCTGAAGGCCAGACCGGGGG + Intronic
1105284320 13:18992395-18992417 AACCCAGAAGGGCAGGCCAGAGG + Intergenic
1105285010 13:18996386-18996408 AACGCAGAAGGCCAGGCCAGAGG + Intergenic
1106405212 13:29467437-29467459 CATCCAGAAGGCCCGGGCAGTGG - Intronic
1106719383 13:32423000-32423022 TAGCCAGCAGGCCTGGACTGTGG - Intronic
1107111581 13:36703612-36703634 CATCCAGAAAGCCAGGCATTAGG + Intergenic
1108284127 13:48889078-48889100 CAGCCAGAAGGTCAGTTCTGTGG + Intergenic
1108554908 13:51583349-51583371 CTACCAGAAGGCCTGGCATGTGG - Intergenic
1109041168 13:57338851-57338873 CAGCGACAAGTCCAGGCCTCCGG - Intergenic
1109900159 13:68758271-68758293 AAGCCAGAACGCCTGGCCTAAGG - Intergenic
1110238097 13:73237119-73237141 CACCCAGATGGGGAGGCCTGTGG + Intergenic
1110725394 13:78816929-78816951 CAGCCAACAGGCCCGTCCTGTGG - Intergenic
1113541284 13:111111813-111111835 CAGCCAGATGGCACGGCCTTAGG + Intergenic
1113628714 13:111865437-111865459 CAGCCAGATGGACAGGTCTGTGG + Intergenic
1113917446 13:113882998-113883020 CAGGGAGATGGCCAGGCCTGCGG - Intergenic
1114741744 14:25104809-25104831 CAGCCAGAATTTCAAGCCTGTGG - Intergenic
1116069545 14:40026205-40026227 TGGCCAGAAGGCCTGGCCTCTGG + Intergenic
1116396349 14:44452045-44452067 CAGTCACAAGTCCAGGCCTCTGG - Intergenic
1117066253 14:52015353-52015375 AGGCCAGGAGGCCAGGCATGGGG - Intronic
1117455922 14:55896718-55896740 CAGCCAGAACCCCCGGCATGAGG - Intergenic
1118049032 14:62005801-62005823 CAGTCTGAAGGAGAGGCCTGTGG - Intronic
1118615857 14:67574130-67574152 CAGGCAGAAGGCCAGCCCCTTGG + Intronic
1118836549 14:69482420-69482442 GAGCCAGGGAGCCAGGCCTGAGG + Intergenic
1119514677 14:75238899-75238921 CTGCCAGAATGTGAGGCCTGCGG + Exonic
1119728228 14:76935228-76935250 CTAACAGAAGGCCAGGCCTGGGG + Intergenic
1121053254 14:90833078-90833100 CAGTCACAAGTCCAGGCCTCTGG - Intergenic
1121286688 14:92741560-92741582 CATCCTGAAGGCCAGGCACGGGG + Intronic
1121645814 14:95516561-95516583 GGGCCGGGAGGCCAGGCCTGGGG - Intronic
1122138779 14:99649955-99649977 AGGCCAGATGGCCAGGCCTCAGG - Intronic
1122309836 14:100787522-100787544 CACCCAGAAGGTCATGCCTCAGG - Intergenic
1122470046 14:101960369-101960391 CAGCCTGAGGGCCAAGCCTTGGG + Intergenic
1122599511 14:102914385-102914407 GAGGCTGGAGGCCAGGCCTGGGG + Intergenic
1122780726 14:104142372-104142394 CAGCCCGGAGACAAGGCCTGAGG - Intronic
1122784783 14:104158642-104158664 CTGCCAGAATGCCAGGCCTGAGG + Intronic
1122945220 14:105005600-105005622 CATCCAGAAGGCGAAGCATGGGG + Intronic
1122986273 14:105213069-105213091 CAGGCTGGAGGCCTGGCCTGAGG - Intronic
1202892082 14_KI270722v1_random:168249-168271 CAGCCAGCAGGACAGGCCAGGGG - Intergenic
1124157039 15:27234989-27235011 CAGCCAACAGGCCAGAACTGTGG - Intronic
1124631927 15:31342986-31343008 CAGCAAGCAGGCCCTGCCTGGGG - Intronic
1124635335 15:31361314-31361336 CACCCAGAAGGGTGGGCCTGAGG - Intronic
1125000344 15:34763324-34763346 AAGACAAAAGGCCAGGCTTGGGG + Intergenic
1126186236 15:45832876-45832898 CATCCAGAAGGTGAGGTCTGGGG + Intergenic
1127527879 15:59811828-59811850 CAGCCAGCCGGCCAGCCCTACGG - Intergenic
1127627509 15:60794864-60794886 CAGGCAGAACTCCAGGCCTACGG - Intronic
1128086921 15:64893130-64893152 CAGCCATGAGGCCCAGCCTGGGG - Intronic
1128496255 15:68200294-68200316 CAGCCTGGAGGCCAGGGCAGGGG - Intronic
1128578120 15:68790007-68790029 GAGCCAGGAAGCCAGGCCTTAGG + Intronic
1128706056 15:69838069-69838091 CAGACAGTAGGACAGGGCTGGGG + Intergenic
1128764570 15:70243284-70243306 CAGACAGAAGGCCAGGCTTCAGG - Intergenic
1128794344 15:70454020-70454042 CAGCCACAGGGCCAGGACTAGGG + Intergenic
1128977129 15:72162190-72162212 CAGCCAGGCAGCCTGGCCTGAGG + Intronic
1129227726 15:74179695-74179717 CAGCGTGAAGGCCAAGGCTGAGG + Intronic
1129228255 15:74182250-74182272 CAGCCAGAAGGGCCTGCCAGTGG + Exonic
1129451714 15:75654799-75654821 CAGGCAGGAGGCCAGGGATGGGG - Intronic
1129952054 15:79600644-79600666 CAGTCTGAAGGGCAGGCGTGGGG - Intergenic
1130027283 15:80280797-80280819 CAACCAGAAGAGCAGGTCTGGGG - Intergenic
1130989214 15:88865872-88865894 CAGGCAGAAGGCCAGGTGTCCGG - Intronic
1131117511 15:89804072-89804094 CTGGCAGATGGCCAGCCCTGGGG - Intronic
1131149496 15:90037977-90037999 TGGCTGGAAGGCCAGGCCTGTGG - Intronic
1131353336 15:91721673-91721695 CAGGCACAAGTCCAGGCCTCTGG + Intergenic
1131873131 15:96780647-96780669 CCACCAGAAAGCCAGGCCTGGGG - Intergenic
1132466607 16:80297-80319 GAACCAGAAAGGCAGGCCTGGGG - Intronic
1132597641 16:760629-760651 CAGGCAGCGGGCCAGGCCTGGGG - Intronic
1132686389 16:1163889-1163911 CACCTCGAAGGCCAGGTCTGGGG + Intronic
1132930765 16:2458097-2458119 GAGCCAGCAGCCCACGCCTGGGG + Exonic
1132936841 16:2485612-2485634 CAGTCAGAAGTCCAGGCCTCTGG - Intronic
1132987322 16:2774368-2774390 CTGGCAGCAGGCCAGACCTGGGG + Intronic
1133122571 16:3619318-3619340 GAGCCACAATGCCTGGCCTGTGG + Intronic
1135822485 16:25696332-25696354 CAGCCAGTTGGCCTGGCCCGAGG - Intronic
1137621829 16:49881318-49881340 GAGCCAGAGGACCAGACCTGAGG + Intergenic
1138088815 16:54157361-54157383 CAGCCACCATGCCAGGCCCGTGG + Intergenic
1138433713 16:56985571-56985593 CAGCCAGGAGGCTGGGGCTGTGG + Intergenic
1139080516 16:63513595-63513617 CATCCTGAAGGACATGCCTGAGG + Intergenic
1139596091 16:67959193-67959215 CAGCCAGGAGGCCAGGGCAGAGG + Intronic
1140035414 16:71367899-71367921 GAGCTAGAAGGGCAGCCCTGTGG - Intronic
1140229429 16:73105465-73105487 GAGCCAGCACGCCTGGCCTGGGG - Intergenic
1141085932 16:81095880-81095902 CAGCCGGGAGGGGAGGCCTGCGG - Intronic
1141242772 16:82278469-82278491 CAGCCTGAGGGCCTGCCCTGTGG - Intergenic
1141423127 16:83930158-83930180 CAGCCCCGGGGCCAGGCCTGTGG - Intronic
1141425780 16:83943563-83943585 CAGCAAGAATGACAGGCATGTGG - Intronic
1141487594 16:84351169-84351191 CAGCCAGAAAGGCAGCCCTCAGG - Intergenic
1141658784 16:85430531-85430553 CACCTCGAAGGCCAGGCCAGGGG + Intergenic
1141787248 16:86209781-86209803 AAGCCAGAGGCCCAGGGCTGTGG - Intergenic
1141982982 16:87561237-87561259 CAGCCAGAAGGCCAGCAAGGAGG - Intergenic
1142122621 16:88394556-88394578 CACCTTGAAGGACAGGCCTGTGG + Intergenic
1142163056 16:88569340-88569362 GAGCCACAGTGCCAGGCCTGTGG + Intergenic
1142489539 17:269384-269406 CAGCAAGGGGGCCAGGGCTGAGG - Intronic
1142519519 17:495048-495070 CAGCCAGCATGCGGGGCCTGGGG - Intergenic
1143119527 17:4598274-4598296 AAGACAGAGGGCCAGGGCTGTGG + Intronic
1143452426 17:7043719-7043741 CAGCCAGATCCCCAGGCCCGAGG + Exonic
1143637731 17:8176064-8176086 CAGGCTGCAGGGCAGGCCTGGGG + Intronic
1144516185 17:15918916-15918938 CAGCCAGAGGCCCAGGCAGGAGG + Intergenic
1144576653 17:16433880-16433902 CAGGCAGATGGCCAGTCATGTGG - Intronic
1144849647 17:18237607-18237629 AAGCCAGCAGGCCAGGGCAGCGG - Exonic
1145005622 17:19336170-19336192 CTGCCAGAACTGCAGGCCTGCGG + Exonic
1145267929 17:21389433-21389455 CAGCCAGGGGGCCAGGGCTCCGG - Intronic
1145288997 17:21528363-21528385 CAGCCAGAAGCCCAGAAATGGGG - Exonic
1145781971 17:27569392-27569414 CAGTCAGCAGGACAGGCTTGCGG - Intronic
1146259873 17:31414354-31414376 CAGCCAGACTGACTGGCCTGTGG - Intronic
1146287036 17:31581131-31581153 CTGCCCGCAGGCCAGGCCTCTGG - Intergenic
1146856713 17:36262010-36262032 CAGCCAGAAGCCCATCCCTCAGG - Intronic
1147253362 17:39166538-39166560 GAACCAGGAGGCCAGGCCTGAGG + Intronic
1148208163 17:45792466-45792488 CAGGCAGAGGGCCAGGAGTGAGG - Intronic
1148988691 17:51646714-51646736 CAGCCAGAAGGTTAGCCCAGTGG - Intronic
1149656440 17:58311839-58311861 CACCCAGGAGGCCAGGCCATGGG - Intronic
1149657695 17:58319034-58319056 TATCCAAAAGCCCAGGCCTGGGG + Intronic
1151147702 17:72056873-72056895 CAGCCCAGAGGCCTGGCCTGTGG + Intergenic
1151190710 17:72395821-72395843 CATCCAGAAGGCCAGACCCACGG + Intergenic
1151598801 17:75093927-75093949 CACCCAGGAGGCAAAGCCTGTGG - Intronic
1151696872 17:75722297-75722319 CAGCCAGAGGGCCACCCCAGAGG - Intronic
1151747252 17:76018185-76018207 CCGCCTGAAGGCCAGTGCTGTGG - Exonic
1151829902 17:76543350-76543372 CAGCCAGCAGCCCAGGCAAGAGG + Exonic
1152081322 17:78189134-78189156 CAGCCTCATGGCAAGGCCTGAGG - Intronic
1152471631 17:80492767-80492789 CAGCCAGGAGGGCAGGAGTGAGG - Intergenic
1152800049 17:82326759-82326781 CAGACAGCAGCCCTGGCCTGGGG - Intronic
1152906455 17:82973107-82973129 CACTCACAAGCCCAGGCCTGGGG + Intronic
1153925555 18:9832207-9832229 CAGCCAGCACCCCAGGCCGGTGG + Intronic
1154416799 18:14179631-14179653 CTGCCAGAAAGCCGGACCTGGGG - Intergenic
1155356750 18:24960723-24960745 CAGCCAGAAGCCCAGGCAGTGGG - Intergenic
1155820178 18:30365188-30365210 AAGTCACAAGTCCAGGCCTGTGG + Intergenic
1156195511 18:34770003-34770025 GAGCCACAACGCCTGGCCTGGGG + Intronic
1156360177 18:36377863-36377885 CAGCCAGAAGCCCAGGTCCAGGG - Intronic
1156472083 18:37383788-37383810 CAGCCACAGGGCCAGGGCTCTGG + Intronic
1157121841 18:44918360-44918382 CATGGAGAAGGCCTGGCCTGGGG - Intronic
1158587770 18:58756267-58756289 CAGCCAGCAGCACTGGCCTGGGG - Intergenic
1158684220 18:59598473-59598495 CACCCAGAATGCCAGGTTTGAGG + Intronic
1159017677 18:63114946-63114968 CAGTCAGAAGTCCAGGCCTTTGG - Intergenic
1160246199 18:77162159-77162181 CAGCCAGAAGCCCCACCCTGTGG - Intergenic
1160557634 18:79736393-79736415 CAGCGAGAAGAGGAGGCCTGAGG + Exonic
1160855484 19:1215331-1215353 CAGCGAGCAGACCAGGCCTGCGG + Intronic
1161036298 19:2086640-2086662 GAGCCAGCATGCCTGGCCTGAGG + Intronic
1161124793 19:2549766-2549788 CAGCCAGCAGGCCGGGGGTGAGG + Intronic
1161209086 19:3057018-3057040 CAGCCAGAAGAATAGGGCTGGGG - Intronic
1162003944 19:7765298-7765320 TAGCCAAAAGGCCAGGCCTGGGG - Intronic
1162465337 19:10836150-10836172 TAGCCACAAGGCCAGGGCTAGGG + Exonic
1162792398 19:13069873-13069895 CAGCCACGAGGCAGGGCCTGGGG + Intronic
1163157027 19:15445221-15445243 CAGCCTGAACTCCAAGCCTGGGG + Intronic
1163354718 19:16802714-16802736 GAGCCAGCAGGCCCGGCCTCAGG - Intronic
1165928520 19:39342172-39342194 CGGGCAGTCGGCCAGGCCTGGGG - Intronic
1166823287 19:45593734-45593756 CAGCAATAGGGCCAGGGCTGGGG + Intronic
1167209090 19:48121989-48122011 CAGGCAGAAGCTCAGCCCTGGGG + Intronic
1167608912 19:50496799-50496821 CAGCCAGCTGGGGAGGCCTGTGG - Intergenic
1167644142 19:50696575-50696597 CCTCCAGAAGGACAGGGCTGTGG - Intronic
1167768535 19:51499876-51499898 CAGCCAGAGGGGAAGGCCCGAGG - Intronic
1168014196 19:53558119-53558141 TAGCCACAAGACCAGGCCTCTGG + Intronic
1168276656 19:55282592-55282614 CAGCAAAAAGGCCTGTCCTGTGG - Intronic
1168409066 19:56127365-56127387 CAGACAGCGGGCCAGGCCTGGGG - Intergenic
925183286 2:1830706-1830728 CAGGAGGAAGGCCAGGCCTGGGG + Intronic
925402389 2:3585025-3585047 GAGCCAGCATGCCTGGCCTGGGG + Intergenic
925639334 2:5972183-5972205 CAGCCAGAAAGAAAGGCCTGCGG - Intergenic
926141200 2:10369504-10369526 CAGCCAGGAAGCCAGGGCTCCGG - Intronic
926225814 2:10966237-10966259 CAGCCAGGAGGAAAGTCCTGTGG + Intergenic
926331033 2:11825347-11825369 CATCCACAAGGCCAAGTCTGAGG - Intronic
927192025 2:20523575-20523597 AAGACAGAAGGCAAGGTCTGTGG - Intergenic
927503250 2:23596159-23596181 CAGCCGGACGGGCAGGCCGGGGG + Intronic
927600273 2:24434729-24434751 CCTCCTGTAGGCCAGGCCTGGGG + Intergenic
928239488 2:29574245-29574267 CAGCAAGAAGCCCAGGCTTAGGG - Intronic
928432772 2:31234392-31234414 CATCCAGCAGCCCAGGCCGGAGG - Exonic
928461174 2:31474217-31474239 CAGCCAGAGAGCTAGGGCTGTGG - Intergenic
928916242 2:36474569-36474591 GAGCCACCATGCCAGGCCTGAGG - Intronic
929568822 2:43006946-43006968 CAGGCAGAAGGACAGGCCCAGGG + Intergenic
931434106 2:62232255-62232277 CAACCAGGAGGCCAGAGCTGTGG + Intergenic
932463363 2:71897500-71897522 CAGCCCTAAAACCAGGCCTGGGG + Intergenic
932604941 2:73158812-73158834 CAACCAGAATTCCAGGCCGGAGG + Intergenic
933784611 2:85828646-85828668 CAGCCAGACTGCCAGGACTGAGG + Intergenic
934548033 2:95234909-95234931 CAGCCACAAGTCCAGACCTCTGG - Intronic
936014824 2:108950077-108950099 CAGCCAGCAGGCCCCTCCTGGGG - Intronic
936192341 2:110342739-110342761 GAGCCAGCAGGGCAGGGCTGTGG - Intergenic
937356151 2:121199391-121199413 CAGTCACAAGTCCAGGCCTCCGG - Intergenic
937986271 2:127639542-127639564 TAGCCAGCAGGCCAGGCCCTAGG + Intronic
938288262 2:130136242-130136264 CACCCAGAAGCACAGGCTTGAGG + Intergenic
938291148 2:130151272-130151294 AAGCCAGAGGTCCAGGCCTGTGG + Intergenic
938457429 2:131475791-131475813 CAGGGAGAGGGGCAGGCCTGGGG + Intronic
938465397 2:131521687-131521709 AAGCCAGAGGCCCAGGCCTGTGG - Intergenic
938698292 2:133854256-133854278 CAGCCAGAAGGCCAGGCAGTTGG + Intergenic
940185321 2:150978111-150978133 CAGCCAGATGCCTAGGGCTGAGG + Intergenic
941805298 2:169706549-169706571 CAGCCACCACGCCTGGCCTGTGG - Intronic
941922338 2:170863767-170863789 CTGCCAGGGGCCCAGGCCTGAGG - Intergenic
946241996 2:218362063-218362085 CCGGCTGAAGGCCAGGCGTGTGG + Intronic
947503715 2:230690993-230691015 CAGCCAGCAGGCACTGCCTGGGG + Intergenic
947594019 2:231399706-231399728 CAGCCAGGGAGCCAGGCCTGGGG - Exonic
948196835 2:236103017-236103039 CACCCAGGAGGCCAGGCCTGGGG - Intronic
948893365 2:240917431-240917453 CAGCCACCAGCCCAGGCCTGAGG + Intergenic
948941951 2:241201149-241201171 CACGCAGAAGCACAGGCCTGCGG - Intronic
948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG + Exonic
1168799594 20:635591-635613 CAGGCAGGAGGGCAGGCCTGGGG - Intergenic
1168997935 20:2146587-2146609 GAGCCAGGAGGCCTGGCCAGGGG - Exonic
1169353381 20:4888188-4888210 CAGCCAGTGGGCCAAACCTGGGG + Intronic
1171499819 20:25585123-25585145 CAGCCCCAAGGCTCGGCCTGAGG - Intronic
1172096757 20:32464188-32464210 CAGGCAGGGGGCCAGTCCTGGGG - Intronic
1172934875 20:38612957-38612979 CAGCCAGCAGCGCAGCCCTGTGG - Intronic
1172982022 20:38950565-38950587 CAGCCACAAGGACAAGCTTGAGG + Intronic
1173293892 20:41738796-41738818 GAGCAAAAAGGCCAGGCCTGGGG - Intergenic
1173304515 20:41835584-41835606 AAGTCAGAAGGCCAGGGCAGTGG + Intergenic
1173539280 20:43839013-43839035 GAGGCAGGAGGCCTGGCCTGTGG + Intergenic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1174368917 20:50073269-50073291 CAGCCCCAGGGCCAGGCCTAGGG + Intergenic
1174920774 20:54699647-54699669 CAGCGTGAAGGCAAGGGCTGTGG - Intergenic
1175047992 20:56125428-56125450 CAGCCAGGAGACCAGGGGTGAGG + Intergenic
1175640637 20:60626996-60627018 CAGTCATAAGTCCAGGCCTTTGG + Intergenic
1176178203 20:63738382-63738404 CAGCCTGGCGGCCAGCCCTGTGG + Exonic
1176268347 20:64222376-64222398 CAGGGAGAGGGCCAGGCCTCTGG - Intronic
1176294122 21:5061484-5061506 CTGCCTGTAGGCCAGGACTGTGG - Intergenic
1178618298 21:34153055-34153077 TAGCCAGGAGGCCAGGCTTTTGG - Intergenic
1179421195 21:41238220-41238242 CAGCCTGAAGGCATGCCCTGGGG + Intronic
1179863137 21:44202164-44202186 CTGCCTGTAGGCCAGGACTGTGG + Intergenic
1179924749 21:44528324-44528346 CAGCCTGACGGCCAAGCCTGAGG + Intronic
1180086981 21:45512085-45512107 GAGGCAGGAGGCCAGCCCTGGGG - Intronic
1180087030 21:45512280-45512302 CAGCGAGGAGGCCTGGCCCGTGG - Exonic
1180187002 21:46145115-46145137 GAGCCAGGAGCCCAGGCTTGGGG - Intronic
1180239125 21:46487912-46487934 CAGTCTGAATACCAGGCCTGAGG + Intronic
1180833035 22:18915790-18915812 AAGCCACAGGGCCAGGCTTGGGG - Intronic
1181053383 22:20248024-20248046 GGGCCAGCAGGCCAGGCCAGAGG + Intronic
1181066785 22:20310464-20310486 AAGCCACAGGGCCAGGCTTGGGG + Intergenic
1181110787 22:20601748-20601770 AAACCAGAGGGCCAGGCCCGTGG + Intergenic
1181446541 22:22980197-22980219 CATCCAGAATGCCAGGCATCAGG - Intergenic
1181510600 22:23387109-23387131 CAGCCAGGAGGACGGGTCTGCGG - Intergenic
1181775310 22:25154921-25154943 CAGCCAGAAGGAACAGCCTGGGG - Intronic
1182051073 22:27313215-27313237 AGGCCTGAGGGCCAGGCCTGAGG - Intergenic
1182595355 22:31415948-31415970 CAGCAAGAAGGCCAGTTATGGGG - Intronic
1183107092 22:35622517-35622539 CAGCCAAGCGGCCAGGGCTGGGG + Intronic
1183480320 22:38060638-38060660 CGGCCAGGAGGCCAGGCCTGGGG - Intronic
1183589149 22:38769864-38769886 ATGCCACAGGGCCAGGCCTGAGG - Intronic
1183963885 22:41429612-41429634 CAGACAGAAGGCTAGGCCCCTGG + Intergenic
1184074082 22:42165088-42165110 CAGCCACAATGCCTGGGCTGGGG + Intronic
1184215791 22:43066391-43066413 CCCCCAGATGGCCAGGCCCGAGG - Intronic
1184406903 22:44305547-44305569 CAGCCTGAAGGCGGGGGCTGGGG + Intronic
1184902425 22:47456208-47456230 CAGCAAGAAGGGCAGGGCCGAGG + Intergenic
1185080772 22:48708303-48708325 CAGCCACCAGGCCAGGCCCAGGG - Intronic
1185316801 22:50182868-50182890 CAGCCAGAGGAACAGGTCTGGGG - Intergenic
1185337775 22:50278438-50278460 CAGCCAGCAGGACCTGCCTGGGG - Exonic
1203283119 22_KI270734v1_random:141094-141116 AAGCCACAGGGCCAGGCTTGGGG - Intergenic
949095276 3:78246-78268 CAGCCAGAAGCTCAGGTCTGAGG - Intergenic
949214338 3:1547140-1547162 GAGCCACCACGCCAGGCCTGTGG + Intergenic
949290939 3:2464794-2464816 AAGGCAGAAGGCCAGGACTGAGG + Intronic
949981883 3:9507222-9507244 CAGGCACTAGACCAGGCCTGCGG + Intronic
950416890 3:12873932-12873954 CACCCAGTAGAGCAGGCCTGGGG + Intergenic
950739563 3:15039449-15039471 CAGCAGGAGGGCCAGGACTGTGG + Intronic
950793814 3:15494510-15494532 CAGGCACTGGGCCAGGCCTGTGG + Intronic
952527172 3:34222794-34222816 CAGCAAGATGGCAAGGTCTGAGG + Intergenic
952830663 3:37562124-37562146 CAACCAGAAGGCCAGAGCTAAGG - Intronic
952873567 3:37922886-37922908 AGGCCAGAATGCCAAGCCTGTGG - Intronic
953414957 3:42710397-42710419 CAGCCTGCAGGCCAGACCTCAGG - Intronic
953883999 3:46705412-46705434 CAGAGACAAGGCGAGGCCTGGGG - Intronic
954330120 3:49885378-49885400 CAGAGAGAAGTCCAGTCCTGGGG - Intergenic
954461244 3:50628195-50628217 CACTCAGCAGGCCAGGCCTCTGG - Intronic
954784856 3:53085194-53085216 CAGACAGCAGGCCAGCCCTCAGG - Intronic
954797613 3:53169436-53169458 CACCCAGGAGGGCAGGCTTGTGG + Intronic
955060733 3:55489542-55489564 CAGGAAGGAGGCCAGGGCTGGGG - Intronic
955643745 3:61114395-61114417 CAGCCAGAAGCCCAAGCTTTAGG + Intronic
956414347 3:69012108-69012130 CAGCCAGAAGGCCTGGCCGGTGG + Intronic
956855786 3:73273679-73273701 CAGTCAGGAAGCCAGGCCCGGGG + Intergenic
957072411 3:75577295-75577317 CATCCAGAGCACCAGGCCTGGGG + Intergenic
958712919 3:97740055-97740077 CAGCTACAAGGCTAGTCCTGAGG - Intronic
959441053 3:106376108-106376130 CAGCAAGAATGCCTCGCCTGTGG + Intergenic
961424489 3:126834484-126834506 GAGCTGGAGGGCCAGGCCTGGGG + Intronic
961439651 3:126945284-126945306 GAGCTGGAAGGGCAGGCCTGTGG + Intronic
961450349 3:126999705-126999727 CAGCCAGCAGGGCCAGCCTGGGG + Intronic
961455259 3:127020754-127020776 CACCCAGGAGACCAGGCCAGTGG - Intronic
961486968 3:127223430-127223452 AGGCCAGAAGGACAGGCTTGAGG + Intergenic
961596579 3:128022629-128022651 CTGCCTGAGGGCCAGGGCTGGGG - Intergenic
961654780 3:128435273-128435295 CAGCCAGCAGGAAAGGCCAGTGG + Intergenic
961659397 3:128460492-128460514 CAGCAAGAAGGCCAGGAAGGTGG - Intergenic
961818014 3:129561274-129561296 CAGCCAGGAGGCTGTGCCTGGGG + Intronic
961907438 3:130277038-130277060 CACCCAGAAGGGCATACCTGTGG + Intergenic
961937774 3:130603874-130603896 CAACCAGAAAGCCAGGCTTTGGG + Intronic
963289430 3:143472908-143472930 CAGCCTGTGGGGCAGGCCTGAGG - Intronic
963576514 3:147067147-147067169 CATCCAGAAAGCCAGGCATTAGG - Intergenic
964571388 3:158110459-158110481 AAGACAGAAGGCCAAGCTTGAGG - Intronic
964849567 3:161080869-161080891 CAGCCTAAAGGCCAGGGCAGTGG - Intergenic
965319788 3:167239092-167239114 CAGCCTGCAGGCCAGCCCTGTGG - Intergenic
965889474 3:173493269-173493291 CATCCAGAAGGCAGGGACTGTGG - Intronic
967758302 3:193195703-193195725 CAGCAGAAAGGCCAGGCCTGAGG + Intergenic
967794856 3:193588853-193588875 CAGCCACCGTGCCAGGCCTGAGG - Intronic
967844902 3:194035596-194035618 CAGCCTGCAAGGCAGGCCTGTGG - Intergenic
967878617 3:194283310-194283332 CAGCCAAAAAGCGAGCCCTGGGG + Intergenic
968855286 4:3115681-3115703 CAGACAGAGGGCCAGGCCCTGGG - Intronic
968933202 4:3595253-3595275 CAGCAAGAATGCCAGGCATTGGG - Intergenic
968956638 4:3722815-3722837 CAGCCAGTAGGCCTGGGCTTTGG - Intergenic
969429385 4:7145309-7145331 CGGTGAGAAGGGCAGGCCTGTGG - Intergenic
969652738 4:8477563-8477585 CAGCCAGGAGCCCAGCACTGAGG + Intronic
969666068 4:8558193-8558215 AAGCCAGGAAGCCAGTCCTGGGG - Intergenic
969667836 4:8572250-8572272 CAGCCAGAAGGCCTGTCCCATGG - Intronic
971858726 4:32077562-32077584 CTGCCTGAAGGACCGGCCTGAGG + Intergenic
972346733 4:38198648-38198670 CAGTCAGACAGGCAGGCCTGGGG - Intergenic
972369799 4:38412318-38412340 CTGGCAGGAGCCCAGGCCTGGGG + Intergenic
973696039 4:53492297-53492319 CAGCAAGAATGCCAGGCCTGAGG + Intronic
974674302 4:65070718-65070740 CAGCCTAAAGTCCTGGCCTGTGG - Intergenic
975856912 4:78634264-78634286 CAGACAGAGGGCCTGGCATGTGG + Intergenic
978359215 4:107910461-107910483 CAGCCAGGAGGCCAAGACAGCGG - Exonic
979474154 4:121135089-121135111 CAGGCAGGAGGCCAGGGCTTAGG + Intronic
980302134 4:131009097-131009119 CATCCAGAAAGCCAGGCATTAGG + Intergenic
980642730 4:135600661-135600683 CATCCAGAAAGCCAGGCATCAGG - Intergenic
980809226 4:137853681-137853703 CGGCCAGAGGGCGGGGCCTGAGG - Intergenic
980979371 4:139641075-139641097 AGGCCAGAAGGCCAAGCCTGGGG + Intergenic
982126562 4:152188900-152188922 TGGCCAGAAAGCCAGACCTGAGG + Intergenic
982209986 4:153026678-153026700 CAGCCAGAAGCCCAGGAAAGGGG + Intergenic
982462656 4:155690283-155690305 CAGTCAGTAGCCCAGGCCTGCGG + Intronic
982850828 4:160313587-160313609 CAGTCAGAGGGCCAGGCTTAAGG - Intergenic
983643224 4:169963129-169963151 CAGCCTGAGGACCAGACCTGCGG - Intergenic
984782899 4:183541952-183541974 AAGCCAGCAAGCCAGGTCTGTGG - Intergenic
986749771 5:10776555-10776577 CAGAGAGAAGGCCAGGGCTCTGG + Intergenic
986874519 5:12091899-12091921 CAGCCAGGAGCCAAGGACTGTGG + Intergenic
990355374 5:54961362-54961384 CAAACACATGGCCAGGCCTGGGG + Intergenic
991628634 5:68631570-68631592 CAGCCAGCATGGCAGGTCTGGGG - Intergenic
992189867 5:74281239-74281261 CAGCCAGAAGAACAAGCATGTGG + Intergenic
992499217 5:77325136-77325158 CAACCAAAAGACCAGGCCTATGG - Intronic
992615630 5:78543587-78543609 CAGCCAGAAGGCCAGGCCTGGGG - Intronic
992865297 5:80951784-80951806 CAGTCTGAAGGGCAGGACTGTGG + Intergenic
994135120 5:96277890-96277912 CAGCCAGCAGGCCATGAGTGTGG + Intergenic
994995079 5:107050878-107050900 CAGCCAGAAAGCCAGGAGAGGGG + Intergenic
995873231 5:116764168-116764190 CTGCCAAAGGACCAGGCCTGTGG + Intergenic
996476389 5:123927045-123927067 CATCCAGAAAGCCAGGCATCAGG + Intergenic
996752515 5:126903267-126903289 CAAGCAAAAGGCAAGGCCTGGGG + Intronic
997080036 5:130727075-130727097 CAGGCACAAGTCCAGGCCTCTGG - Intergenic
997597837 5:135119023-135119045 CAGCCAGAGGGCAGGGCATGTGG + Intronic
998565662 5:143213846-143213868 CAGCCAGATGGCAAGACATGAGG - Intronic
998706537 5:144768491-144768513 CAGCCATGAGGCCAAGCCGGAGG - Intergenic
999112062 5:149130135-149130157 CATCCAGAAGTCCAGGTATGTGG + Intergenic
999143920 5:149380455-149380477 CAGCCAGGAGGGTGGGCCTGAGG - Intronic
999250501 5:150179691-150179713 CCCCCAGGAGGACAGGCCTGAGG - Intronic
999261647 5:150242121-150242143 CTCCTAGAAGTCCAGGCCTGGGG + Intronic
1000046264 5:157524266-157524288 CAGCCAGAAGGCATGAGCTGGGG + Intronic
1000280798 5:159780279-159780301 CAGGAAGAAAGCTAGGCCTGGGG - Intergenic
1001629329 5:173163188-173163210 CAGCCAGTATCCCTGGCCTGAGG + Intronic
1001642561 5:173254932-173254954 CAGCCAGAGGGCCAGCCCCGGGG + Intergenic
1002467318 5:179414049-179414071 CACAGAGAAGGCCAGGCCTGGGG + Intergenic
1002876442 6:1215164-1215186 CATCCTGCAGGCCTGGCCTGAGG + Intergenic
1003014083 6:2454052-2454074 CAGCAAGAAAGCCAGGGATGGGG - Intergenic
1003262430 6:4531668-4531690 CAGTCACAAGGCCAGGACTCTGG + Intergenic
1004053595 6:12112721-12112743 CATCCAGAAGCCCAGCCCTGTGG - Intronic
1004250114 6:14016596-14016618 CAGCCAGACTGACAGGCCAGAGG - Intergenic
1004369406 6:15039135-15039157 CACCCTGAAATCCAGGCCTGTGG - Intergenic
1006228107 6:32557992-32558014 CAGCCAGAAGGGCATCCCGGAGG - Intronic
1006368561 6:33630638-33630660 CAGCCAGAAACCCAGGCCTGTGG + Intronic
1006802829 6:36770233-36770255 AGGCCAGAGGGCCAGGCCAGAGG + Intronic
1007533488 6:42564037-42564059 CAGCGAGAGTGTCAGGCCTGGGG + Intergenic
1007735769 6:43981439-43981461 CAGCCAGAAGGGTTGCCCTGAGG + Intergenic
1007994254 6:46289245-46289267 CATCCAGAGACCCAGGCCTGGGG - Intronic
1008508427 6:52253737-52253759 CTGCCAGAATGCAATGCCTGGGG + Intergenic
1010387759 6:75302164-75302186 CAGCCAGGAGTCCTGGACTGGGG - Intronic
1011663073 6:89610815-89610837 AAACCTGAAGACCAGGCCTGGGG + Intronic
1014009749 6:116462078-116462100 CAGCAAGAAGACCAGGCCGTAGG - Exonic
1017728910 6:157297038-157297060 TAGCCAGTAGGCCAGGAGTGAGG + Intronic
1018626942 6:165789002-165789024 CAGCCAGAAGAGCAGCCTTGTGG - Intronic
1019136612 6:169912448-169912470 CAGACAGATGGGCAGGCTTGGGG - Intergenic
1019601222 7:1884753-1884775 CAGACAGGAGGCCTGGGCTGGGG - Intronic
1019703687 7:2487571-2487593 GACCCAGATGCCCAGGCCTGGGG + Intergenic
1020204799 7:6105591-6105613 CAGCCAGGTGGCTAGGCCTGGGG - Intronic
1020282355 7:6656058-6656080 CAGCCAGGCTGCCAGGGCTGGGG + Exonic
1020350468 7:7213545-7213567 CATCCAGAAAGCCAGGCATCAGG + Intronic
1023483368 7:40658801-40658823 AAGCCACCAGGCCAGGCATGAGG - Intronic
1023626178 7:42117257-42117279 CAGCAAAAAGGCCAGGGCTCTGG + Intronic
1024259466 7:47563092-47563114 CAGGCAGAGGGCCTGGCCCGGGG - Intronic
1024328748 7:48135267-48135289 CATCCAGAAAGCCAGGCATTAGG + Intergenic
1024489142 7:49957605-49957627 CAGGCAGAATGCAAGGGCTGTGG + Intronic
1024675863 7:51637566-51637588 CAGGGAGGAGACCAGGCCTGGGG + Intergenic
1025261124 7:57417857-57417879 CAGCCAGCAGCCCTGGCTTGGGG + Intergenic
1025295519 7:57772784-57772806 CAGCCCGAATGCCACCCCTGAGG - Intergenic
1025842456 7:65163349-65163371 CAGCCAAAAAGCCAATCCTGCGG - Intergenic
1025880589 7:65532620-65532642 CAGCCAAAAAGCCAATCCTGCGG + Intergenic
1025892848 7:65669984-65670006 CAGCCAAAAAGCCAATCCTGCGG - Intergenic
1025937745 7:66050762-66050784 CAGGCAGGAGGCCATGCCTCAGG - Intergenic
1025959076 7:66205057-66205079 CAACCACCCGGCCAGGCCTGCGG + Intergenic
1026826553 7:73585845-73585867 CAGCTAGAGGGCCAGGCAAGTGG - Intergenic
1027055270 7:75045465-75045487 CCTCTGGAAGGCCAGGCCTGGGG - Intronic
1027535489 7:79394635-79394657 TAGGAAGAAGGCCATGCCTGGGG - Intronic
1028352073 7:89861063-89861085 CATCCAGAAAGCCAGGCATCAGG - Intergenic
1029375469 7:100174580-100174602 CAGCCAGCAGGACAGGCCTTGGG - Intronic
1029539362 7:101173631-101173653 CGGGCACCAGGCCAGGCCTGGGG + Intronic
1030715387 7:112802247-112802269 CAGCCAGTGGGCCACGTCTGTGG + Intergenic
1031604046 7:123748364-123748386 CAGGCTGGAGGACAGGCCTGCGG + Intronic
1032265946 7:130370105-130370127 AGGCCAGAAGGCCAAACCTGGGG + Intergenic
1032487810 7:132301053-132301075 CTTGCAGAAGGCCAGGCCTATGG - Intronic
1033165465 7:139035592-139035614 CAGCAGGACGGCCAGGCCCGCGG + Intronic
1033660091 7:143396985-143397007 CATCCTGGAGGCCAGGGCTGTGG - Intronic
1034411031 7:150942319-150942341 CAGCCAGGTGCCCAGCCCTGCGG + Intergenic
1035524607 8:302588-302610 AAGCCAGAGGGGCAGTCCTGGGG - Intergenic
1036217044 8:6889420-6889442 CATTCAGAAGTCCTGGCCTGTGG - Intergenic
1037771460 8:21802641-21802663 AAGACAGAAGGCCAGGCGTGGGG - Intronic
1037899044 8:22676868-22676890 CAGAAAGAAAGCCAGGCCTGAGG + Intergenic
1038018919 8:23536689-23536711 GAGGCAGAAGGGCAGGCCCGAGG - Intronic
1038032538 8:23655268-23655290 CAGTCTGAAAGCCATGCCTGTGG + Intergenic
1038547465 8:28436436-28436458 CAAACACAAAGCCAGGCCTGTGG - Intronic
1039184020 8:34896618-34896640 CATCCAGAAAGCCAGGCATCAGG - Intergenic
1039645388 8:39277284-39277306 AAGCCAGAAGGCTAGACCAGTGG - Intronic
1039803413 8:40979357-40979379 CAGACAAAAGGCCTGGACTGAGG + Intergenic
1039886897 8:41659901-41659923 CAGCCCGAAAGCCAGGCTAGGGG - Intronic
1040384595 8:46905776-46905798 CAGCCAGAACCCCTGGCATGTGG - Intergenic
1040472248 8:47743815-47743837 CAGCCAGAAGTGGAGGCTTGAGG - Intergenic
1041839779 8:62255750-62255772 GAGGCAATAGGCCAGGCCTGAGG + Intronic
1049277070 8:141725246-141725268 CATCCAGCAGCCCAGGCCTGGGG + Intergenic
1051592425 9:18789960-18789982 CAGTCAGAATGAGAGGCCTGAGG + Intronic
1051677277 9:19571070-19571092 CAGCCAGATGGAGAGGCATGGGG + Intronic
1051920303 9:22257082-22257104 CAGGCAGAATGCCAGGCATTTGG - Intergenic
1053082475 9:35188592-35188614 CATCCAGAAAGCCAGGCATCAGG + Intronic
1054456928 9:65436556-65436578 CAGCAAGAATGCCAGGCATTGGG + Intergenic
1058646361 9:107134950-107134972 AAGACAGAAGGCCAGTCCTATGG + Intergenic
1060110133 9:120901066-120901088 CAGCCAAAGGGCAAGCCCTGTGG - Intergenic
1060187935 9:121575212-121575234 CAGATAGAAGCCCAGGCCTGGGG - Intronic
1061001332 9:127904627-127904649 CAGGCTGCAAGCCAGGCCTGGGG + Intronic
1061230649 9:129313849-129313871 CAGCGATACGGCCAGGTCTGTGG - Intergenic
1061369590 9:130191006-130191028 AAGTCAGAGGGCCAGGCCTTGGG - Intronic
1062240899 9:135537392-135537414 CATCCACAGGGCCAGGGCTGAGG + Intergenic
1062380453 9:136284408-136284430 CAAGCAGGAGGCCAGGCCGGCGG - Intronic
1062403739 9:136383726-136383748 CAGCAAGCAGGCCAGCCCTTTGG + Intronic
1062493686 9:136821735-136821757 CAGCCCGGCGGCCCGGCCTGTGG - Intronic
1203489229 Un_GL000224v1:87610-87632 CAGTCAGCAGGACAGGCCAGGGG - Intergenic
1203501850 Un_KI270741v1:29505-29527 CAGTCAGCAGGACAGGCCAGGGG - Intergenic
1185631022 X:1515883-1515905 CAGGAAGAGGGCCAGGCATGGGG + Intronic
1186513769 X:10150657-10150679 CAGGCAGAATGCAAGGCCCGAGG - Intergenic
1187480437 X:19650147-19650169 CTGCCAGAAAGCCAGGCCTCTGG - Intronic
1189214328 X:39310387-39310409 CAGCTAGAATGCCAGTCCTGTGG + Intergenic
1191616615 X:63176580-63176602 CAGCCAGAAGTGCAGGAATGAGG + Intergenic
1191619682 X:63202343-63202365 CAGCCAGAAGTGCAGGAATGAGG - Intergenic
1192215425 X:69154670-69154692 CAGCTACAAGGCCAGGCCCCCGG - Intergenic
1192362179 X:70446939-70446961 CAGACAGAAGGCCAGAACTGAGG - Intronic
1193144604 X:78064084-78064106 CAGGAAGAAGGCCAGGCTTCAGG + Intergenic
1194656226 X:96577000-96577022 CAGCCAGGAGGCTAGAGCTGAGG - Intergenic
1195135797 X:101906505-101906527 CAGCCTGGAGGGCAGGGCTGTGG - Intronic
1195746199 X:108121241-108121263 CAGCCAGAAGACCAAGGCTCTGG - Intronic
1196082693 X:111649679-111649701 CAGCCTGAAGGCAGGGTCTGTGG + Intergenic
1196330086 X:114461834-114461856 CAGACTGAAGGTCATGCCTGTGG + Intergenic
1196968143 X:121080313-121080335 CATCCAGAAAGCCAGGCATTAGG + Intergenic
1196973581 X:121135343-121135365 CATCCAGAAAGCCAGGCATTAGG + Intergenic
1197243196 X:124141822-124141844 CATCCAGAAAGCCAGGCATTAGG + Intronic
1199847453 X:151701373-151701395 CAGCCCCCAGGCCAGGCCTGTGG - Exonic
1199851103 X:151725398-151725420 GAGCCAGAGGGCCAGGCAGGAGG - Intergenic
1200100397 X:153687177-153687199 CAGCCAGGACCTCAGGCCTGAGG + Intronic
1200734397 Y:6778429-6778451 CATCCAGAAAGCCAGGCATTAGG + Intergenic
1200827127 Y:7657448-7657470 CAGCCAGGAGGCAGGGCATGGGG + Intergenic
1200884090 Y:8251991-8252013 CAGCCAGAAGGCAGGGGATGGGG + Intergenic
1201783059 Y:17744372-17744394 CAGCCAGGAGCCCAGGCCAGGGG - Intergenic
1201818494 Y:18161615-18161637 CAGCCAGGAGCCCAGGCCAGGGG + Intergenic
1201863036 Y:18620408-18620430 CACCCAGAAAGCCAGGCATTAGG - Intergenic
1201870287 Y:18699970-18699992 CACCCAGAAAGCCAGGCATTAGG + Intergenic