ID: 992616184

View in Genome Browser
Species Human (GRCh38)
Location 5:78548219-78548241
Sequence GCTTATGTACCGTAGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992616184_992616189 19 Left 992616184 5:78548219-78548241 CCTCCCAGCTACGGTACATAAGC 0: 1
1: 0
2: 0
3: 2
4: 32
Right 992616189 5:78548261-78548283 TAAAGAGCTCCACCCGGCCTTGG No data
992616184_992616192 26 Left 992616184 5:78548219-78548241 CCTCCCAGCTACGGTACATAAGC 0: 1
1: 0
2: 0
3: 2
4: 32
Right 992616192 5:78548268-78548290 CTCCACCCGGCCTTGGGGCATGG No data
992616184_992616187 13 Left 992616184 5:78548219-78548241 CCTCCCAGCTACGGTACATAAGC 0: 1
1: 0
2: 0
3: 2
4: 32
Right 992616187 5:78548255-78548277 TCCACGTAAAGAGCTCCACCCGG 0: 1
1: 0
2: 0
3: 5
4: 101
992616184_992616191 21 Left 992616184 5:78548219-78548241 CCTCCCAGCTACGGTACATAAGC 0: 1
1: 0
2: 0
3: 2
4: 32
Right 992616191 5:78548263-78548285 AAGAGCTCCACCCGGCCTTGGGG 0: 1
1: 0
2: 0
3: 4
4: 69
992616184_992616190 20 Left 992616184 5:78548219-78548241 CCTCCCAGCTACGGTACATAAGC 0: 1
1: 0
2: 0
3: 2
4: 32
Right 992616190 5:78548262-78548284 AAAGAGCTCCACCCGGCCTTGGG 0: 1
1: 0
2: 2
3: 2
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992616184 Original CRISPR GCTTATGTACCGTAGCTGGG AGG (reversed) Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
903776344 1:25796512-25796534 GCATCAGCACCGTAGCTGGGAGG - Intergenic
905603493 1:39274519-39274541 GATTATTTAAAGTAGCTGGGAGG + Intronic
1079258596 11:18854595-18854617 GCTTATGAAGCTTAGCTTGGTGG - Intergenic
1089659311 11:119975703-119975725 GCTTCTGTATCCAAGCTGGGAGG - Intergenic
1141785639 16:86198729-86198751 GTTTATGGACCCCAGCTGGGTGG - Intergenic
1146425179 17:32731767-32731789 GGTCCTGCACCGTAGCTGGGCGG - Intronic
1146886565 17:36474765-36474787 GCCCAGGTGCCGTAGCTGGGAGG + Intergenic
1147214679 17:38892348-38892370 GCTTCTGTGCCGCAGGTGGGTGG - Intronic
1153606762 18:6841670-6841692 TCTTATGTACCATTGCTGTGGGG + Intronic
1160301596 18:77686663-77686685 GGTTATTTAACGTAGCTGGCAGG + Intergenic
1162429241 19:10617342-10617364 TCTTATTAACCTTAGCTGGGTGG - Intronic
1163327426 19:16614204-16614226 GCTTCTGGACCTTAGCTGGAAGG - Intronic
930185089 2:48405359-48405381 GCTCTTGTAAGGTAGCTGGGTGG - Intergenic
939542667 2:143512845-143512867 GCTTATGTGCCGCAGATGAGCGG - Intronic
948510922 2:238464645-238464667 GCTAATATGCCCTAGCTGGGGGG + Intergenic
1170629574 20:18056176-18056198 GCTTATGTTCTGGACCTGGGCGG - Intronic
1179792557 21:43764015-43764037 GCTTATGTACCGTAGGGGAGGGG + Intergenic
1181854251 22:25770864-25770886 GCTTTAGCACCGTAGCTGGTTGG - Exonic
1184152353 22:42646407-42646429 GCTCATGCACCATAGCTGAGGGG + Intronic
959125053 3:102281086-102281108 GCTTATGAAGCTTAGCTAGGTGG + Intronic
963368686 3:144369613-144369635 GCTGGGGTGCCGTAGCTGGGAGG - Intergenic
968385821 4:136420-136442 ACTTGTGTACTGTAGCTGAGAGG + Intronic
975671707 4:76787069-76787091 GCTTAGGTACTGTTGCTGGGAGG - Intergenic
977015660 4:91690609-91690631 GCTTATGAAGCTTAGTTGGGTGG + Intergenic
980831485 4:138133962-138133984 GCCTATGCAGGGTAGCTGGGTGG + Intergenic
992616184 5:78548219-78548241 GCTTATGTACCGTAGCTGGGAGG - Intronic
998057225 5:139088462-139088484 GCTGATGGACAGGAGCTGGGTGG - Intronic
1006513632 6:34534450-34534472 GCTTCTGCACTGGAGCTGGGAGG - Exonic
1011344478 6:86353823-86353845 GATTCTGTACATTAGCTGGGTGG - Intergenic
1017319729 6:153075931-153075953 GCTTATTTACAGTAGGCGGGTGG + Intronic
1034453693 7:151152290-151152312 TCTTATGCACTGGAGCTGGGCGG - Intronic
1038196649 8:25374219-25374241 GCTTCTGTACAGTAGTGGGGAGG + Intronic
1047383546 8:124386766-124386788 GCTTATGTACCCTAGGGGAGAGG + Intergenic
1193747156 X:85296488-85296510 GCTTATGAAGCATAGCTTGGTGG + Intronic