ID: 992617165

View in Genome Browser
Species Human (GRCh38)
Location 5:78555818-78555840
Sequence GCCCCTTCATCAAGGTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992617165_992617169 -2 Left 992617165 5:78555818-78555840 CCCAGAGACCTTGATGAAGGGGC 0: 1
1: 0
2: 0
3: 10
4: 142
Right 992617169 5:78555839-78555861 GCAGGCAAAAGAAGTCAGCCAGG 0: 1
1: 0
2: 4
3: 19
4: 245
992617165_992617171 20 Left 992617165 5:78555818-78555840 CCCAGAGACCTTGATGAAGGGGC 0: 1
1: 0
2: 0
3: 10
4: 142
Right 992617171 5:78555861-78555883 GTAGACTGAGAAGAAACATCAGG No data
992617165_992617172 25 Left 992617165 5:78555818-78555840 CCCAGAGACCTTGATGAAGGGGC 0: 1
1: 0
2: 0
3: 10
4: 142
Right 992617172 5:78555866-78555888 CTGAGAAGAAACATCAGGAGAGG 0: 1
1: 0
2: 5
3: 44
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992617165 Original CRISPR GCCCCTTCATCAAGGTCTCT GGG (reversed) Intronic
900213576 1:1468967-1468989 GCCCCATCATCAAGGTTTGCAGG - Exonic
900221136 1:1509782-1509804 GCCCCATCATCAAGGTTTGCAGG - Intergenic
901980471 1:13030134-13030156 GCCTCTTACTCATGGTCTCTGGG - Intronic
902001617 1:13198797-13198819 GCCTCTTACTCATGGTCTCTGGG + Intergenic
902020846 1:13344507-13344529 GCCTCTTACTCATGGTCTCTGGG + Exonic
906480773 1:46197780-46197802 GCCCCCTCATCAAGCCCTTTGGG - Exonic
906865096 1:49409509-49409531 GTGCCTTCTTTAAGGTCTCTGGG - Intronic
910739687 1:90501464-90501486 ACCCCTTCAGAAATGTCTCTGGG - Intergenic
911187137 1:94915586-94915608 GCCCCAACACAAAGGTCTCTTGG + Intronic
915304410 1:154969497-154969519 GCCCCTTCACAAAGGGCCCTAGG + Intronic
915359737 1:155278542-155278564 ACCTCTACATCAAGGTCGCTAGG + Intronic
915557978 1:156670571-156670593 GCCCCTTCACCTTGGCCTCTGGG - Exonic
918180931 1:182085684-182085706 ACCCCTGCATCAGAGTCTCTTGG + Intergenic
919000034 1:191818919-191818941 GCTTCTTCATCAAGGTGCCTTGG + Intergenic
920398972 1:205665386-205665408 TCCCCTTCATCCTGGTCTTTGGG - Intronic
920799584 1:209173988-209174010 GCCCCTTTTTCAGGGTCTCAGGG - Intergenic
1063859187 10:10289909-10289931 GCCCCTTTTTCAGGGTCTGTGGG + Intergenic
1072754868 10:98012672-98012694 GCCCCTTCATTTTGGTCTCTGGG - Intronic
1073703377 10:105955477-105955499 GCCACTTGCTCAAGGTCTCATGG + Intergenic
1076263495 10:129090901-129090923 TCCCCTTCCTCAAAGTCCCTGGG - Intergenic
1076541961 10:131220302-131220324 GCCCCATCCTCCAGGGCTCTTGG + Intronic
1078320006 11:10326017-10326039 GACCCTTCTGCATGGTCTCTTGG - Intronic
1078450737 11:11438723-11438745 GCCCCTCGCTCAAGGTCTCTGGG - Intronic
1082959315 11:58903812-58903834 GCCCCTTCTTAAGGCTCTCTGGG + Intronic
1083643147 11:64156453-64156475 GACACTTCAGCAAGGCCTCTGGG - Intronic
1083934605 11:65863709-65863731 GGCCCTTCACCTGGGTCTCTAGG - Exonic
1085450616 11:76629941-76629963 GCCCCTTCATCTAGAGCCCTGGG - Intergenic
1086230388 11:84562415-84562437 GCCCCTACATGAAGGCTTCTGGG + Intronic
1087027115 11:93661048-93661070 GCCCCATCATGAAGATATCTTGG - Intergenic
1087120119 11:94564888-94564910 ACCCTTTCATCAGGTTCTCTTGG - Intronic
1088701544 11:112417428-112417450 GCCCCTTCTTCAAAGTTGCTTGG + Intergenic
1088911101 11:114193120-114193142 GCCCCATCCACAAGATCTCTGGG - Intronic
1089002204 11:115061119-115061141 CTCCCTTCATCAAGGTGGCTGGG - Intergenic
1089781923 11:120879242-120879264 ACCCCTTCAGCCAGGTCTGTTGG + Intronic
1090259376 11:125307701-125307723 GCCTGTTCACCAACGTCTCTAGG - Intronic
1091103719 11:132899023-132899045 GCCCCATGATCAAGGTCAATGGG + Intronic
1091250329 11:134138987-134139009 ACACCTTGATGAAGGTCTCTGGG - Intronic
1094054634 12:26256553-26256575 GCACCCTCATCAGGGTCTGTGGG + Intronic
1096053168 12:48628863-48628885 GCCCCTTCCTCAAAGTCTGATGG + Intergenic
1100934700 12:99649460-99649482 GCCCCTTCATCAGGCACTATAGG - Exonic
1101065109 12:101012856-101012878 TCCAATCCATCAAGGTCTCTGGG - Intronic
1101136141 12:101744901-101744923 GCCCCTTGATCTTGGACTCTCGG + Intergenic
1104440085 12:128787111-128787133 GCCCCTCCAGAAAGGACTCTCGG + Intergenic
1108130621 13:47295946-47295968 GCAACTTCAGCAAGGTCTCAGGG + Intergenic
1109086196 13:57973831-57973853 GCACTTTTATCAAAGTCTCTAGG + Intergenic
1113343956 13:109455327-109455349 GGCCCTTCATAAAGAACTCTCGG + Intergenic
1118047333 14:61985126-61985148 GCCCAGTCATCAAGGACCCTAGG + Intergenic
1119807892 14:77494347-77494369 GCTTCTTCATTAAGGTCTTTGGG + Intronic
1120568060 14:86083715-86083737 GCCTCTTCATCAAAGACTCTGGG - Intergenic
1121934346 14:98003366-98003388 GCAACTTCAGCAAGGTCTCAGGG + Intergenic
1124380521 15:29161215-29161237 CCTCCTTCCTCAAGGTTTCTTGG - Intronic
1126868426 15:52961349-52961371 GCCACTTAGTCAAGATCTCTTGG + Intergenic
1127608080 15:60610092-60610114 TGCCCTTCCTTAAGGTCTCTTGG - Intronic
1129628785 15:77234895-77234917 GCCCCTTGATCCAGTTCTCAAGG - Intronic
1130043845 15:80429217-80429239 GCCCCTTCTTGAAGCTGTCTAGG - Intronic
1130082932 15:80750401-80750423 GCCCCTCCAGCAAGGACTGTGGG - Intronic
1130974180 15:88760248-88760270 GACCCTTCACCAAGGTTGCTGGG + Intergenic
1132060629 15:98689724-98689746 GCCCCCTTATATAGGTCTCTCGG + Intronic
1132463724 16:68134-68156 GCCTCTACATCCAGGTCTCCTGG + Intronic
1133775705 16:8893681-8893703 GTCCCTGGCTCAAGGTCTCTGGG - Exonic
1134814736 16:17196619-17196641 ACCCCTTCATCTAGGTCTCCTGG + Intronic
1137693633 16:50446926-50446948 GACACTTCCTCAAGGTCACTTGG + Intergenic
1138336886 16:56260469-56260491 CAGCCTTCATCATGGTCTCTGGG - Intronic
1139172439 16:64648092-64648114 GCCACTTCATCCAGCTCTCTGGG - Intergenic
1139652831 16:68371266-68371288 GCCCCTTCACCAGGGACTCCCGG + Exonic
1148094829 17:45045112-45045134 GCACCTTTATCTAGGTATCTAGG + Intronic
1148182180 17:45614120-45614142 CCCGCTCCATCAAGATCTCTAGG + Intergenic
1148266677 17:46231576-46231598 CCCGCTCCATCAAGATCTCTAGG - Intergenic
1148853559 17:50566452-50566474 GCCCCTTCTTAAGGGTCCCTTGG - Intronic
1149985547 17:61344317-61344339 GCCTCTTCAACCAAGTCTCTGGG + Intronic
1152153731 17:78619119-78619141 GCTCCCTCATCAAGCTCTCCTGG + Intergenic
1154111882 18:11577285-11577307 GCCCCTTCAACAAGAGCACTGGG + Intergenic
1157825309 18:50806842-50806864 GACCCATCACCCAGGTCTCTTGG - Exonic
1159733954 18:72070835-72070857 ACCCTTTCTTCAAGCTCTCTGGG + Intergenic
1160705766 19:529602-529624 GCCCCTTCACCAAGGTTCCCAGG - Intergenic
1163020979 19:14480584-14480606 ACGCCTTCATCAAGGTGCCTGGG - Exonic
1163889532 19:19998576-19998598 GCCTCTTCCTCAAGGTCTTTAGG + Intronic
1165168746 19:33875828-33875850 GAACCTTCTTCAAGTTCTCTGGG - Intergenic
1167671345 19:50855443-50855465 GGCCAAGCATCAAGGTCTCTGGG - Intronic
1168182142 19:54668706-54668728 GCCACTTCAGCAAGGTTTGTTGG + Exonic
927772716 2:25878059-25878081 GCCCCTTCAGCCGGGTCCCTGGG + Intronic
932139066 2:69259504-69259526 CCCCCTTGATCCAGGTTTCTTGG - Intergenic
936750778 2:115638991-115639013 GGCACTTCAGCAAGGTCTGTAGG + Intronic
940801714 2:158139973-158139995 GTCCCTTCAGTAAGTTCTCTCGG + Intergenic
946766002 2:223041633-223041655 GCCCCTTCATGCAAGTCTCCTGG - Intergenic
948652190 2:239455226-239455248 TCCCAGTCATCAGGGTCTCTTGG - Intergenic
1169132973 20:3176553-3176575 GCCCCTTTATCAAGGTTTTCAGG - Intergenic
1170411809 20:16100598-16100620 GTCCCTTTATCAAGGGCTCCAGG - Intergenic
1176235124 20:64050340-64050362 GCCCCTTCCCCAAGGGCCCTTGG - Intronic
1176263137 20:64193739-64193761 TCCTCTTCTTCTAGGTCTCTGGG + Intronic
1181693123 22:24577111-24577133 GTTCCTTCATCCAGGTCTCTGGG + Intronic
1183589142 22:38769834-38769856 GCCCCTTCTTCCAGGTCTGAGGG - Intronic
1184042546 22:41952604-41952626 GCCCCTTCTTCACCCTCTCTGGG - Intergenic
1184386557 22:44179863-44179885 GCGCCTCCAGCAAGGACTCTTGG + Intronic
1184954755 22:47878510-47878532 GGCCCTGGATCCAGGTCTCTGGG + Intergenic
950225956 3:11234694-11234716 GCCACTTCTGCAAGGTCTCAGGG - Intronic
950610640 3:14124690-14124712 GCCGCTTCTGCAAGGTCTCAGGG - Exonic
956807219 3:72827467-72827489 TTCCCTTCATCATGGTCCCTTGG - Intronic
967092861 3:186150146-186150168 GCCCCATCATCATGGGCGCTTGG + Exonic
967217530 3:187223123-187223145 TCACCTCCATCAGGGTCTCTGGG + Intronic
968696680 4:2033765-2033787 GCCCCCTCATCCAGGTCACTGGG + Intronic
969499720 4:7545357-7545379 GCCTCTTCCTCAAGTGCTCTGGG + Intronic
969879238 4:10159231-10159253 GCCCTTCCATCAAGGTCTGGTGG + Intergenic
970965738 4:21925660-21925682 ACTTCTTCATGAAGGTCTCTAGG + Intronic
972963804 4:44485925-44485947 GCACCTTCTCCATGGTCTCTGGG - Intergenic
973637679 4:52875167-52875189 TCCCTGTCATCAAGGGCTCTGGG + Intronic
977429316 4:96911681-96911703 GCCCCTTAATCTCTGTCTCTTGG - Intergenic
987579043 5:19764945-19764967 GCCATTTCATCAAGTTTTCTAGG + Intronic
987598869 5:20038981-20039003 GCAACTTCATCAAAGTCTCAGGG + Intronic
992407586 5:76474706-76474728 ACACCTGCATCAAGGTCACTTGG + Intronic
992617165 5:78555818-78555840 GCCCCTTCATCAAGGTCTCTGGG - Intronic
995046750 5:107658628-107658650 GGCTCTTCTTCAAGGACTCTTGG - Intronic
1000930820 5:167249179-167249201 GCCCCTTCATCCATATCTTTAGG + Intergenic
1001533877 5:172484212-172484234 GCCTCTTGCTCATGGTCTCTCGG - Intergenic
1006763786 6:36486958-36486980 GCCCCTTCATCCAGATGTCATGG + Exonic
1007309620 6:40935071-40935093 GACCCTATATAAAGGTCTCTTGG - Intergenic
1007616797 6:43184620-43184642 GCCACTTCATCCAGGCCTCCTGG - Exonic
1009198631 6:60717343-60717365 GCCCCTCCTTCAAGGTCTCATGG + Intergenic
1015947782 6:138520978-138521000 GCCCCACCTTCATGGTCTCTCGG - Intronic
1017209631 6:151840714-151840736 GCCCTTCCAGCAGGGTCTCTTGG - Intronic
1018838087 6:167500098-167500120 GCCCTTTCCTCAGGGCCTCTGGG - Intergenic
1019294428 7:266444-266466 GCCCCTGCATCCAGGACCCTCGG - Intergenic
1022197532 7:28083168-28083190 GCCCCTTCCACATGCTCTCTTGG + Intronic
1022603284 7:31782547-31782569 ACCCCTTCATCAGGGCCTCCTGG - Intronic
1022619868 7:31971992-31972014 GTCCTTTCATCAAAATCTCTTGG + Intronic
1023803017 7:43851125-43851147 GCCCCTTCCTTCAGGTCTCCTGG + Intergenic
1024762001 7:52609945-52609967 TACCCTTCCTCAAGGACTCTTGG - Intergenic
1026978238 7:74511872-74511894 CCCCCTACATTAAGGCCTCTGGG + Intronic
1027051607 7:75024794-75024816 GCCCCTTCCTCAGGGTCCCCAGG - Exonic
1029482881 7:100823635-100823657 ACCCCTACATCAAGGTACCTGGG - Exonic
1037315483 8:17595676-17595698 GCCCCTTTTTCAGGGTCTCAGGG + Intronic
1038310680 8:26444127-26444149 CCCCCTTCATAAAGGCCTCTTGG + Intronic
1038482720 8:27912817-27912839 GGCCCTACATCAGGGTCTTTGGG - Intronic
1039330664 8:36533517-36533539 TCCCCATCATGAAGGTATCTAGG - Intergenic
1039887874 8:41665440-41665462 GCCCCCACTTCCAGGTCTCTGGG - Intronic
1040010516 8:42657547-42657569 ACCCCTTACTCAAGGTTTCTTGG - Intergenic
1046227131 8:111296890-111296912 GGCGCTTCATATAGGTCTCTTGG + Intergenic
1047026500 8:120830063-120830085 GCCATTTCCTCAAGGACTCTGGG - Intergenic
1049455092 8:142682622-142682644 GCCCCTTCCTCCAGGCCTCCAGG - Exonic
1052491813 9:29179083-29179105 GCATCTTTAACAAGGTCTCTTGG - Intergenic
1053424581 9:38002817-38002839 GACCCTGCATCAAGTTCCCTGGG + Intronic
1057831291 9:98409203-98409225 GACCCTTTGTCATGGTCTCTGGG - Intronic
1060120738 9:120987219-120987241 GCCCCCTAATCAATGTCTCAAGG - Intronic
1062062218 9:134502670-134502692 GCCCCTTCACCAAGCCCTGTGGG - Intergenic
1185886128 X:3784996-3785018 TCCCCCTCATCATGGTCCCTGGG + Intergenic
1189483131 X:41408379-41408401 GCCCCATCCACAAGGTTTCTGGG - Intergenic
1191933896 X:66405252-66405274 GCTCCTTCATCAAACCCTCTGGG + Intergenic
1192103555 X:68291239-68291261 TCTCCCTCATTAAGGTCTCTTGG - Intronic
1192996423 X:76517405-76517427 GCCCTGTGATCAAGGTCTATGGG + Intergenic
1193625639 X:83817110-83817132 GCAACTTCAGCAAAGTCTCTGGG - Intergenic
1195236716 X:102906493-102906515 GGCCCTACACCCAGGTCTCTTGG - Intergenic
1195301625 X:103535771-103535793 GGCCCTACACCCAGGTCTCTTGG + Intergenic
1200067971 X:153514111-153514133 GCCCCTTCCCCAAGGCCTCAGGG - Intergenic