ID: 992621245

View in Genome Browser
Species Human (GRCh38)
Location 5:78595408-78595430
Sequence AAGGGCTTATAGATTTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992621245_992621254 11 Left 992621245 5:78595408-78595430 CCACCAGAAATCTATAAGCCCTT 0: 1
1: 0
2: 2
3: 19
4: 181
Right 992621254 5:78595442-78595464 GAACAATGTCTCAGTGTGGGAGG 0: 1
1: 0
2: 1
3: 18
4: 166
992621245_992621252 7 Left 992621245 5:78595408-78595430 CCACCAGAAATCTATAAGCCCTT 0: 1
1: 0
2: 2
3: 19
4: 181
Right 992621252 5:78595438-78595460 AGGTGAACAATGTCTCAGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 158
992621245_992621253 8 Left 992621245 5:78595408-78595430 CCACCAGAAATCTATAAGCCCTT 0: 1
1: 0
2: 2
3: 19
4: 181
Right 992621253 5:78595439-78595461 GGTGAACAATGTCTCAGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992621245 Original CRISPR AAGGGCTTATAGATTTCTGG TGG (reversed) Intronic
909508713 1:76426047-76426069 AAAGTCATGTAGATTTCTGGAGG - Intronic
910145051 1:84070203-84070225 TATGGCTTATAGAATTCTGCAGG + Intergenic
910536391 1:88302719-88302741 AAGGACTGTTACATTTCTGGTGG + Intergenic
912410179 1:109475778-109475800 AATGGTTTTTAGGTTTCTGGAGG - Intronic
912905966 1:113707760-113707782 AGGAGCTTATAGACTTCTGAAGG + Intronic
913059426 1:115191302-115191324 AAGGACTTAGAGACTGCTGGAGG - Intergenic
914391425 1:147226378-147226400 AGGGGCTTACAGATTAGTGGAGG + Intronic
918735796 1:188061491-188061513 AAATGCTTATATATTGCTGGTGG - Intergenic
918755721 1:188337839-188337861 AAGGGCCTCTAGAATTTTGGAGG - Intergenic
919168091 1:193920147-193920169 CAGGGCTTACAGATTTTGGGTGG - Intergenic
921721415 1:218475954-218475976 AAGGGCTTGTTGATTTCTGGAGG + Intergenic
923194873 1:231655710-231655732 AAAAGCTTATATACTTCTGGTGG - Intronic
923205499 1:231754805-231754827 AAAGGCCTATACTTTTCTGGGGG - Intronic
923325204 1:232874663-232874685 AAGGGCTTCTGGAATTCAGGAGG + Intergenic
924083581 1:240424873-240424895 AGGGGCCTAGACATTTCTGGAGG - Intronic
1063727544 10:8655131-8655153 AAAGGCTTATACATTGTTGGAGG + Intergenic
1063728048 10:8661479-8661501 AAAGGCTTATACATTGTTGGAGG + Intergenic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1065292285 10:24242700-24242722 GAGTGCTTATACATTGCTGGTGG - Intronic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1067468935 10:46522468-46522490 AAGGGAAGAGAGATTTCTGGTGG - Intergenic
1068961110 10:62867516-62867538 AGGCCCTTATAGATGTCTGGGGG + Intronic
1075548741 10:123376611-123376633 AAGTCCTTATTGATCTCTGGTGG - Intergenic
1076115905 10:127899852-127899874 AAATGCTGAGAGATTTCTGGGGG - Intergenic
1077304164 11:1861248-1861270 AAAGGCATATGGAGTTCTGGAGG - Intronic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1078646357 11:13144272-13144294 ATTGGCTTATAGAATTATGGAGG + Intergenic
1082095489 11:48126207-48126229 AAGGACTTGTAGATTTGTGTGGG + Intronic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1085079122 11:73619452-73619474 AGGGGCTTATGGATGTCAGGTGG + Intergenic
1085438630 11:76535747-76535769 AGGGGCTTATAGTCTTCTTGGGG + Intronic
1090936133 11:131344272-131344294 GAGGACTTCTAGATTTCCGGAGG + Intergenic
1092087838 12:5778837-5778859 AAAGGCTTATAGAATTTTGATGG + Intronic
1092362884 12:7852644-7852666 AAGGGATTACATATTTCTAGTGG - Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092625892 12:10328106-10328128 ATTGGCTTATAGTTTTCTTGTGG + Intergenic
1095560077 12:43553572-43553594 AAAGAATTATAGACTTCTGGTGG + Intergenic
1095867714 12:46991168-46991190 GAGGGCTTATATATTGTTGGGGG + Intergenic
1098219495 12:68253418-68253440 AAGAGCTCACAGATTTCTGCAGG + Exonic
1098916567 12:76262943-76262965 TAGTTCTTATAGATTTTTGGTGG + Intergenic
1098989826 12:77053043-77053065 AAAAGTTTATATATTTCTGGGGG + Intronic
1101223915 12:102668490-102668512 ATGAGATTATAGGTTTCTGGAGG - Intergenic
1102796761 12:115695579-115695601 AAAGTCTTAGAGATTCCTGGTGG - Intergenic
1106614975 13:31318363-31318385 AATGGATTATACACTTCTGGAGG + Intronic
1107345984 13:39461448-39461470 TAGTGCTTATACATTGCTGGTGG - Intronic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1108480854 13:50869724-50869746 AAAGTCTTATACATTGCTGGTGG + Intergenic
1109044824 13:57396450-57396472 AAAATCTTATAGATTTCTGGTGG - Intergenic
1109114144 13:58360007-58360029 AAGTGCTTATATACTGCTGGTGG + Intergenic
1110874466 13:80491200-80491222 CAGGGCTTCTCAATTTCTGGGGG - Intergenic
1111868751 13:93803463-93803485 AAGCCCTTATACATTGCTGGTGG + Intronic
1115150478 14:30278788-30278810 AAAGGCTTATACAGTTTTGGTGG + Intergenic
1117038795 14:51751683-51751705 AAGGGCCTATCGAACTCTGGGGG + Intergenic
1117620106 14:57576898-57576920 AAGGGGTTACAGATTCCTTGAGG + Intronic
1117676547 14:58161062-58161084 AAGAGCTTATAGTTTTCTTGGGG - Intronic
1127439684 15:58993727-58993749 AGGGGCTTATGGCTTGCTGGTGG + Intronic
1129764170 15:78150396-78150418 AATTGTTTATAGATTTCTAGGGG - Intronic
1130047566 15:80457655-80457677 AATGGCATATAGAGTTCTGGAGG + Intronic
1130997427 15:88911798-88911820 AGGGGCTTTGAGATTTCAGGAGG - Intronic
1131084561 15:89565463-89565485 TAGGGGTTATGGCTTTCTGGGGG + Intergenic
1131412055 15:92216734-92216756 GAGGGCTTATACATTTTTGTTGG + Intergenic
1132194832 15:99906369-99906391 AGCGGCTCAGAGATTTCTGGAGG + Intergenic
1132214582 15:100053339-100053361 AATGGCTCACAGGTTTCTGGAGG + Intronic
1136176498 16:28520720-28520742 AACGGCTATGAGATTTCTGGTGG - Intergenic
1137005523 16:35271842-35271864 AATGGCTTTTAGATATTTGGAGG + Intergenic
1139005431 16:62565104-62565126 AAGTGCTTATAAATATCTGCAGG - Intergenic
1142347696 16:89564719-89564741 GAGGGCCTGAAGATTTCTGGTGG + Exonic
1146369653 17:32257609-32257631 AGGGACTAAGAGATTTCTGGAGG - Intergenic
1146412044 17:32594717-32594739 AAGGGCATATGGATTTTTTGGGG + Intronic
1147291996 17:39451087-39451109 AAGGGCTTATCCTTTTGTGGCGG - Exonic
1150788859 17:68184197-68184219 AAGGGGTTGTACATTGCTGGGGG - Intergenic
1151033382 17:70769469-70769491 AAGGCCTTTTATATTTTTGGAGG + Intergenic
1153049102 18:884467-884489 AAGAGCTTCTAGTTTTCTGTGGG + Intergenic
1155989272 18:32262310-32262332 AAGAGCTTATAGCTTTCCAGGGG + Intronic
1158019936 18:52829995-52830017 CAAGCCTTAAAGATTTCTGGAGG + Intronic
1158777435 18:60601722-60601744 AAGTGCTTAGAGATTTCATGAGG - Intergenic
1162272824 19:9630212-9630234 AAGGGCTTAGGAAATTCTGGGGG + Intronic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1165819720 19:38666738-38666760 GAGGGGTGACAGATTTCTGGGGG - Intronic
1167124492 19:47539790-47539812 AAGGGCTTCTTGGTTCCTGGGGG + Exonic
1167421653 19:49407446-49407468 AAGGGCTTCTAGATCCCTGAGGG - Intronic
1168129411 19:54308029-54308051 AAGGGCTCAGTGACTTCTGGGGG - Intronic
925268581 2:2585212-2585234 TAGGGCTTATAGGTTACAGGTGG - Intergenic
926739163 2:16096867-16096889 CAGGGCTTACAGTTTCCTGGTGG + Intergenic
929649831 2:43667317-43667339 AAGGTCTCATACATTGCTGGTGG + Intronic
930386474 2:50701723-50701745 AAGGGCTTACAACTTACTGGAGG - Intronic
930733881 2:54755522-54755544 AATGGTTTATAATTTTCTGGAGG + Intronic
931585724 2:63825025-63825047 AAGGTCTTAAAGATTTCTTAAGG - Intronic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
935941990 2:108248657-108248679 TATGGCTAATAGTTTTCTGGTGG - Intronic
936389341 2:112057142-112057164 AAGGGCTTTTAGACTTCTGGCGG - Intronic
936630498 2:114197526-114197548 AAAGTCTTATATACTTCTGGTGG - Intergenic
937718848 2:125066840-125066862 AAATGCTTATACACTTCTGGTGG - Intergenic
938009444 2:127817102-127817124 AATGGCTTTTACATTTCTGAAGG + Intergenic
938703298 2:133898437-133898459 AAGGGCTTATAGCTCTAAGGGGG - Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
941510536 2:166402736-166402758 AAGGGCTTACTGACTACTGGGGG - Intergenic
941875815 2:170431810-170431832 AAGGGATTGTAGTTTTGTGGAGG - Intronic
942017356 2:171830247-171830269 TAGGGCTTATACATTTCTGTGGG - Intronic
942101474 2:172588583-172588605 AAGGGCATGTAGATGTATGGAGG - Intronic
944319454 2:198321294-198321316 AAGTGCTTATATATTTTTAGTGG - Intronic
945569698 2:211450757-211450779 AAGGGTTTAGAGACTTATGGAGG - Intronic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1173572378 20:44085793-44085815 AAGGGATTCAAGGTTTCTGGGGG - Intergenic
1177032981 21:16005423-16005445 AAGGGATTATAGATCTATGAAGG + Intergenic
1177708644 21:24741462-24741484 AAATGCTTATACATTTCTGGTGG - Intergenic
1178118148 21:29438509-29438531 AAGGGGTTATAAATATGTGGAGG + Intronic
1181159175 22:20947071-20947093 AATGGCTGAGAGACTTCTGGTGG - Intronic
1182340530 22:29616913-29616935 AAGGGATTTTAGTTTTTTGGGGG + Intronic
1183865910 22:40703996-40704018 CAGAGCTTATACATTTCTGGTGG + Intergenic
953488233 3:43323487-43323509 AAATGCTCATACATTTCTGGTGG + Intronic
954840665 3:53508854-53508876 AAGAGGTTCTAGAATTCTGGAGG + Intronic
956986546 3:74708081-74708103 GAGGGCTTAGAGATTATTGGTGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
957497284 3:81008184-81008206 AAGGGCTAATAGAATTCTCAAGG - Intergenic
960389067 3:117054674-117054696 AAGGGCTTATAGGATTTGGGTGG + Intronic
964110709 3:153084475-153084497 AATGGCTTAGAGAATTCTGTAGG + Intergenic
965116682 3:164499459-164499481 AAAGGCTTCTGGATTTCTCGAGG - Intergenic
965430021 3:168574764-168574786 AGGGGCTCATAAATTGCTGGAGG + Intergenic
966326613 3:178763078-178763100 AAGGATGTATAGATTTGTGGTGG + Intronic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
970163881 4:13215875-13215897 TAGGGCTTGTAAATTTCTGGTGG + Intergenic
974014621 4:56637671-56637693 AAGGGCTTATTGTTTTCTAATGG - Intergenic
975381395 4:73704427-73704449 AAGGCCTTATTGTTTCCTGGTGG + Intergenic
979720789 4:123897887-123897909 AAGGACTGATACATTTCTGGTGG + Intergenic
982596854 4:157396445-157396467 GAGTGCTTATACATTGCTGGTGG + Intergenic
983778090 4:171633489-171633511 AAAGGCTTATACACTGCTGGTGG - Intergenic
987110047 5:14677245-14677267 AGGGGCTTATGGACTGCTGGAGG - Intronic
988656599 5:33218651-33218673 TAGGGCTAATAGATTTTTGAAGG - Intergenic
989205841 5:38808371-38808393 AAGGGCTGATAGATTCCTCAAGG + Intergenic
989685369 5:44079873-44079895 AAGGGCTTATATTTTTCTAGAGG + Intergenic
990086855 5:51989066-51989088 AAGGCTTTATAGATTAATGGGGG - Intergenic
992621245 5:78595408-78595430 AAGGGCTTATAGATTTCTGGTGG - Intronic
994944080 5:106362388-106362410 AAAGGCTTATACACTTCTGAAGG - Intergenic
995945421 5:117639243-117639265 AAGGGTTTACAGTTTTCTGCAGG - Intergenic
997909781 5:137859362-137859384 AAAGGCTTAAAGATTTGTGCTGG + Intergenic
998596325 5:143534244-143534266 AATGGCTTATTGAATTATGGAGG - Intergenic
999967693 5:156827013-156827035 GAGGGGTTATAGATTACTAGAGG - Intergenic
1001805903 5:174585955-174585977 GAAGGCTTATACATTGCTGGTGG - Intergenic
1004929675 6:20450237-20450259 AAAGGCTTATACATTGTTGGTGG - Intronic
1005160844 6:22861543-22861565 AAGGGTTTAACAATTTCTGGAGG + Intergenic
1005942611 6:30571885-30571907 CAGGGCTCATATATTCCTGGTGG - Intronic
1008725611 6:54414736-54414758 ACTGGCATGTAGATTTCTGGAGG - Intergenic
1010477796 6:76310637-76310659 AAGGGCATAGAGATTATTGGGGG - Intergenic
1010878734 6:81141457-81141479 AAGGGTTTTTAAATTTCTGTGGG - Intergenic
1014955140 6:127606294-127606316 ATGGGCTGATAGATTTATGGAGG + Intergenic
1017557577 6:155588520-155588542 AAGAGTTTATAGATGTCTGATGG - Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020601727 7:10283225-10283247 AAGGGTGTATAGATATCTGCAGG - Intergenic
1022941459 7:35244636-35244658 AAGGGAATATACATTTTTGGAGG - Intronic
1022979745 7:35593508-35593530 AACAGCTTTTAGATTTCTGCCGG + Intergenic
1023041707 7:36178471-36178493 AAGGGCTTAGAGACAGCTGGAGG - Intronic
1026020801 7:66704367-66704389 ATGGACTGATGGATTTCTGGAGG + Intronic
1026895440 7:74007562-74007584 AATGGTTTATAGAGTGCTGGTGG - Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1029463503 7:100710590-100710612 AAGGGCTAATAACTTCCTGGTGG + Intergenic
1029795025 7:102885240-102885262 GAACACTTATAGATTTCTGGTGG - Intronic
1034783943 7:153907925-153907947 AAGTGTTTTTAGATATCTGGAGG + Intronic
1035733398 8:1869378-1869400 AATGGCTTATTGATGTGTGGTGG + Intronic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036262044 8:7248817-7248839 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036304547 8:7590741-7590763 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036314083 8:7707356-7707378 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036355400 8:8038733-8038755 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036372999 8:8176578-8176600 AAGGGCTTATTGAACTCTGGGGG + Intergenic
1036877906 8:12489063-12489085 AAGGGCTTATTGAACTCTGGGGG - Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1037628652 8:20631878-20631900 AAGAGCATCTAGATTTCTGGAGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1038939090 8:32284235-32284257 AAGGGCTTATACATTACAGGTGG - Intronic
1039093285 8:33855863-33855885 ATTGGCTTATAAATTCCTGGAGG + Intergenic
1040424870 8:47275284-47275306 TAGGTTTTATAGATTTATGGGGG - Intronic
1041040185 8:53838907-53838929 AAGAGCTTACAGATTGTTGGGGG - Intronic
1042917611 8:73890699-73890721 AAAGGGTTAGAGGTTTCTGGGGG + Intergenic
1044606554 8:94053000-94053022 AGAGGTTTATAGAATTCTGGGGG - Intergenic
1047923848 8:129663012-129663034 AAGAGCTTATAGTTTTGTGAAGG - Intergenic
1048141468 8:131798861-131798883 AAGGGAATATAGGCTTCTGGGGG - Intergenic
1052580749 9:30350444-30350466 AATGGCTTATACATTGTTGGTGG + Intergenic
1052711495 9:32062103-32062125 GAGTGCTTATACATTACTGGTGG - Intergenic
1056850429 9:90079404-90079426 GAGGGCTCACAGATTTCAGGGGG + Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1058867355 9:109173179-109173201 AAATGCTTATACATTGCTGGTGG + Exonic
1060695428 9:125705675-125705697 GAGCGCTTATAGAATTCTAGAGG + Intronic
1061017036 9:127987292-127987314 AAGGGCATATTGATTTGTGCTGG + Intergenic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1189802589 X:44705651-44705673 AAGGGCTGATAGAACTCTAGAGG + Intergenic
1189871707 X:45391069-45391091 AAATGCTTATACACTTCTGGTGG - Intergenic
1193229379 X:79026117-79026139 GAATGCTTATATATTTCTGGTGG + Intergenic
1193392613 X:80946955-80946977 AAAAGCTTATACACTTCTGGTGG - Intergenic
1195241111 X:102953048-102953070 AAATGCTTATACACTTCTGGTGG - Intergenic
1195398661 X:104438297-104438319 AATGGCTTCTAGATTTCCAGAGG - Intergenic
1198763602 X:140059087-140059109 AACCGCTTATGGATGTCTGGGGG + Intergenic
1199181996 X:144868468-144868490 AACAGCTTATACATTGCTGGTGG - Intergenic
1200948291 Y:8867426-8867448 AAGGGCCTATAGAACTCTGGGGG + Intergenic