ID: 992623435

View in Genome Browser
Species Human (GRCh38)
Location 5:78615932-78615954
Sequence ACCTTTGCAAAGCTGGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992623433_992623435 -7 Left 992623433 5:78615916-78615938 CCACAGAAGAGAGGTTACCTTTG 0: 1
1: 0
2: 1
3: 16
4: 161
Right 992623435 5:78615932-78615954 ACCTTTGCAAAGCTGGTGCTAGG 0: 1
1: 0
2: 2
3: 12
4: 162
992623430_992623435 4 Left 992623430 5:78615905-78615927 CCCAGATGACTCCACAGAAGAGA 0: 1
1: 1
2: 1
3: 16
4: 228
Right 992623435 5:78615932-78615954 ACCTTTGCAAAGCTGGTGCTAGG 0: 1
1: 0
2: 2
3: 12
4: 162
992623431_992623435 3 Left 992623431 5:78615906-78615928 CCAGATGACTCCACAGAAGAGAG 0: 1
1: 0
2: 1
3: 20
4: 184
Right 992623435 5:78615932-78615954 ACCTTTGCAAAGCTGGTGCTAGG 0: 1
1: 0
2: 2
3: 12
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992623435 Original CRISPR ACCTTTGCAAAGCTGGTGCT AGG Intronic
902659606 1:17891978-17892000 ACCTTTGGAAGGCAGGGGCTGGG - Intergenic
905922991 1:41731410-41731432 ACCCATGCACAGCAGGTGCTGGG + Intronic
906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG + Intergenic
907127103 1:52060601-52060623 ACTTTTGCAAAGATTGTGTTGGG - Intronic
907348080 1:53800858-53800880 ACATTTTAAAAGCTGGTGTTTGG - Intronic
909549516 1:76882159-76882181 CCATTTGCAAAGTTGGTGGTTGG - Intronic
910150984 1:84145200-84145222 AGCTTTGCTAAAATGGTGCTGGG + Intronic
911096737 1:94061337-94061359 ACCTGTGCATGGCTGGTGGTGGG - Intronic
912401343 1:109396472-109396494 ACCTTTACACAGCTGCTGCTCGG + Intronic
912703957 1:111898292-111898314 ACCTTCTCAAAGCAGGTGATGGG - Intronic
913406663 1:118501450-118501472 ATCTTTGCAACTTTGGTGCTTGG - Intergenic
913489884 1:119369015-119369037 ACCTTGGCAAAGATGGTCCTAGG + Intronic
916265388 1:162885491-162885513 AGCTTGGCCAAGCTGCTGCTTGG - Intergenic
916876428 1:168974417-168974439 ACCTTTGCAAAGTTAGTCCATGG + Intergenic
917285193 1:173415924-173415946 AGCTGTGCAAAACTGGTGCATGG + Intergenic
920397973 1:205660289-205660311 ACATTAGCACAGCTGGGGCTGGG - Intronic
921688807 1:218123187-218123209 ACCTTTGCATAATTGGAGCTTGG + Intergenic
924333557 1:242964687-242964709 CTCTTTGCCAAGCTTGTGCTTGG - Intergenic
1063418458 10:5891314-5891336 ACCTGAGCAAAGCTGGTACTTGG - Intronic
1064064399 10:12168696-12168718 ACCTGGGCACAGCAGGTGCTTGG + Intronic
1065235208 10:23643605-23643627 ACCATTGCATAGCTATTGCTTGG + Intergenic
1067254895 10:44627764-44627786 ATCTTTGCAAGGCTGGGGCAGGG - Intergenic
1069748383 10:70730383-70730405 ACCATTGCAAAGCTCATCCTCGG - Intronic
1070018391 10:72558615-72558637 ACCTTTGCCAAACTGTTGTTGGG + Intronic
1072485508 10:95850702-95850724 ACCTTTTTAAGGGTGGTGCTGGG - Intronic
1074528824 10:114282832-114282854 ATGTCTGCAAAGCTGGTGCTCGG - Intronic
1076168022 10:128297832-128297854 GCCTTTCCAAAGCTGGCCCTGGG + Intergenic
1076198323 10:128537208-128537230 ATTTTTGCAAAGATGTTGCTTGG + Intergenic
1076247652 10:128959801-128959823 ACCTTTGCAGCTCTGGGGCTGGG + Intergenic
1081050464 11:38333578-38333600 AATTCTGCATAGCTGGTGCTGGG - Intergenic
1082994004 11:59234225-59234247 ACCTTAGCAGAGTTGGTGCATGG - Intergenic
1083180140 11:60979975-60979997 GCATATGCATAGCTGGTGCTTGG - Intronic
1083316814 11:61820266-61820288 ACCTTACCAAAGTAGGTGCTGGG - Intronic
1084219873 11:67671273-67671295 ACATGTGCACATCTGGTGCTCGG + Intronic
1091368223 11:135039183-135039205 ACCTTTGCGGAGGTGGAGCTGGG - Intergenic
1092962558 12:13609892-13609914 ACCTTTGCATAGACAGTGCTTGG + Intronic
1097862782 12:64534603-64534625 ACCTCTGCAAGGCTGGTAGTAGG + Intergenic
1104430072 12:128709048-128709070 TAGTTTGCAAAGCTGGGGCTCGG - Intergenic
1105816457 13:24040618-24040640 AACTTTACAAAATTGGTGCTTGG - Intronic
1114896500 14:26997344-26997366 ACCTTTGCAATGCCAGTGTTTGG + Intergenic
1118285960 14:64472995-64473017 AATTTTGCAAAGCTGGGGGTTGG + Exonic
1118448985 14:65880169-65880191 CACTTTGCAAAGCTTGTGCAGGG + Intergenic
1125240632 15:37570637-37570659 ACTTTTCAAAAACTGGTGCTAGG + Intergenic
1132992853 16:2806002-2806024 TCCTTGGCCAAGCTGATGCTGGG - Intergenic
1134501795 16:14774883-14774905 ACACGTGCAAAGCTTGTGCTGGG - Intronic
1134578766 16:15353995-15354017 ACACGTGCAAAGCTTGTGCTGGG + Intergenic
1134723822 16:16403550-16403572 ACACGTGCAAAGCTTGTGCTGGG - Intergenic
1134943608 16:18308320-18308342 ACACGTGCAAAGCTTGTGCTGGG + Intergenic
1135621822 16:23962398-23962420 ACCTTTGCAATGCTTTTCCTTGG + Intronic
1137874476 16:51982790-51982812 ACCTTTGAAAACCTGCTTCTAGG + Intergenic
1138596175 16:58030211-58030233 TCCTTTACAAAGCGGGTCCTGGG + Intronic
1139938827 16:70590507-70590529 ACCCTTGTAAAGGTGGTGCTCGG + Intronic
1140212506 16:72981808-72981830 CCCTTTGGAAGGCTGGTGCTGGG - Intronic
1141500966 16:84443780-84443802 GCCTTCCCAAAGCTGGTGCTGGG + Intronic
1141789324 16:86223696-86223718 ACCTCTGCAAAGATGGAGCCAGG - Intergenic
1143185728 17:5008850-5008872 ACCTTTGTATACCTGGAGCTGGG + Intronic
1147667268 17:42156566-42156588 ACCTTTCCAAGGCTGGAGGTGGG + Intergenic
1149683294 17:58520343-58520365 GCCTGAGCAGAGCTGGTGCTGGG + Exonic
1149686175 17:58536514-58536536 ATCTCTAGAAAGCTGGTGCTTGG + Intronic
1150581290 17:66476321-66476343 AGCTCTGCAAGCCTGGTGCTTGG + Intronic
1151319214 17:73342644-73342666 TCCTCTGCAAAGCTGGGGCCTGG - Intronic
1152199300 17:78935851-78935873 ACCATTGCAAAGAGTGTGCTGGG + Intergenic
1152721028 17:81923893-81923915 AACTTTGAAAAGCTGGGGGTGGG + Intronic
1156574355 18:38297334-38297356 ACATTTGCAAAGTTGATGGTTGG + Intergenic
1159849653 18:73512787-73512809 ACAGTTGCATAGCTAGTGCTTGG - Intergenic
1159878372 18:73834615-73834637 GCCTTTAAAAAGCTGTTGCTTGG + Intergenic
1161842732 19:6692799-6692821 CCCTTTGCAAAGATTGGGCTGGG - Intronic
1164702912 19:30298361-30298383 GCCTCTGCACAGCTGGTGATGGG - Intronic
1167065441 19:47182249-47182271 ACCTTTGCAAAGCAGGCCATAGG + Intronic
1167285214 19:48595415-48595437 TCCCTTGCAAAGCTGATGGTGGG + Intronic
925591786 2:5517124-5517146 ATCTTTGCACAGCTGGACCTTGG - Intergenic
925621420 2:5797214-5797236 ACATTTGCAAGGCAGCTGCTTGG + Intergenic
925783812 2:7408707-7408729 TCATTTTCCAAGCTGGTGCTAGG + Intergenic
926617022 2:15006726-15006748 GAGTTTGCAAAGCAGGTGCTTGG - Intergenic
926720952 2:15959800-15959822 ACCCATGCAAAGCAGGTGCATGG - Intergenic
927081197 2:19632552-19632574 GCCTTTGCGAGGCTGGTGATGGG - Intergenic
928087898 2:28357021-28357043 ACCAGAGCAAAGCTGGTGCTAGG - Intergenic
934572372 2:95381064-95381086 ACCTTTGCCATGCAGATGCTTGG + Intronic
934876702 2:97927988-97928010 ACCTTTGCATTGCTGTTTCTTGG - Intronic
935130752 2:100259143-100259165 ACCTTAAGGAAGCTGGTGCTGGG + Intergenic
935750833 2:106232513-106232535 GCCTCTGCACAGCTGCTGCTAGG - Intergenic
937992965 2:127674494-127674516 ACCCCTGCACAGCTGGTGCTTGG + Intronic
939250793 2:139679861-139679883 ACCTTCTCAAAGCTGCTGCCTGG + Intergenic
939632971 2:144547533-144547555 ACATCTGCAAAGCTGGTCCAAGG - Intergenic
945758345 2:213878880-213878902 CCCTTTTCAAAAATGGTGCTGGG - Intronic
946470713 2:219958017-219958039 ACCTTAGCAAAGCTAGTGTCTGG + Intergenic
946917384 2:224538782-224538804 TCCTTTGCAAAGCTAGTACCAGG - Intronic
1170441762 20:16386430-16386452 ACCTTTGCTGGGCTGGGGCTGGG + Intronic
1170766298 20:19292237-19292259 ACTGTTGCAAAGTGGGTGCTTGG - Intronic
1170827223 20:19807144-19807166 AACCTTGTAAAGCTTGTGCTTGG + Intergenic
1172824718 20:37771585-37771607 ACCTTTGCAGAGCAGGAGATAGG - Intronic
1176234154 20:64046477-64046499 ACCTATGCAGAGGGGGTGCTGGG + Intronic
1180066906 21:45417136-45417158 ATCTTCCCAAAGGTGGTGCTGGG + Intronic
1182998291 22:34834562-34834584 ACCTTTGCAATTCTGGAGCAAGG - Intergenic
1184092166 22:42298596-42298618 ATCTTTGCACGGATGGTGCTGGG + Intronic
1184538614 22:45104726-45104748 ACCTTTCCAAAGCAGCTTCTTGG - Intergenic
949874742 3:8618784-8618806 AGCTTTGGAGAGGTGGTGCTGGG - Intergenic
953304300 3:41812511-41812533 ACGATTTCAGAGCTGGTGCTGGG + Intronic
954117787 3:48476720-48476742 ACCTTTATAAAGCAGGTCCTAGG + Intronic
954431581 3:50473533-50473555 AGCTTGGCAGAGCTGGTGCCAGG + Intronic
955492569 3:59498078-59498100 ACCTTTGCTAAGCTGCTCCAAGG - Intergenic
956267890 3:67418184-67418206 ACCTTTGCAGGGTTGGTGCCAGG + Intronic
956610109 3:71113859-71113881 ACCTTTCCAAAGATGGCACTAGG + Intronic
956685446 3:71823076-71823098 AGCTTTCCAAAGCTGCAGCTTGG - Intergenic
957147327 3:76441162-76441184 ATTTTCACAAAGCTGGTGCTTGG + Intronic
957314911 3:78564607-78564629 ACCTGTAAAAAGCTGGTGCAAGG - Intergenic
960340501 3:116469169-116469191 GCCTTTGCGGAGCTGGTGTTAGG - Intronic
961174936 3:124827288-124827310 TGCTTTGCAGAGCTGCTGCTAGG + Intronic
962385768 3:134930962-134930984 TCCTATGCCAGGCTGGTGCTGGG - Intronic
964714935 3:159712062-159712084 ACCCTTACAAAGCTGGTGGCAGG + Intronic
967981639 3:195069513-195069535 GCCTGTGCACTGCTGGTGCTTGG - Exonic
968909534 4:3470537-3470559 ACCCCTGCAAGGCTGGTGGTGGG - Intronic
969201774 4:5612575-5612597 ATCTATGCAAAAATGGTGCTAGG + Intronic
970193190 4:13533939-13533961 ACCCTTGCAAAGCTGGTGTGGGG - Intergenic
979728294 4:123991257-123991279 ATCTTTCCAAAGATAGTGCTTGG - Intergenic
984886323 4:184452915-184452937 ACCTTGGCCAAGCTGCTGTTTGG - Intronic
985514979 5:337749-337771 CCCTTCCCAAAGCTGGGGCTCGG + Intronic
986166520 5:5277154-5277176 ACCTTAGCAAACCTCATGCTGGG - Intronic
987681265 5:21138844-21138866 ACCATGGCATAGCTGCTGCTGGG + Intergenic
991944748 5:71889220-71889242 GCCTTGTCAAAGCAGGTGCTTGG + Intergenic
992616256 5:78548644-78548666 GCCCTTGGAAAGCTGTTGCTGGG + Intronic
992623435 5:78615932-78615954 ACCTTTGCAAAGCTGGTGCTAGG + Intronic
994860334 5:105184765-105184787 CCCTATGTAAAGATGGTGCTGGG - Intergenic
995065575 5:107858187-107858209 CCCTTCCCAAAGCTGCTGCTCGG + Intergenic
996455103 5:123672684-123672706 ACCTGTGCAAAACTAGTGCATGG - Intergenic
996863221 5:128088302-128088324 AACTCTTCAAAGCTGATGCTAGG + Intronic
999031854 5:148302323-148302345 CCCTTTGCAGAGCTGCTGTTAGG - Intergenic
1002065838 5:176651248-176651270 ACCTGACCGAAGCTGGTGCTGGG - Intronic
1002439260 5:179255910-179255932 CCCTTTGCACAGATGCTGCTGGG + Intronic
1002599712 5:180347257-180347279 ACCTCTGCAAAGATGGCCCTGGG + Intronic
1008174028 6:48244197-48244219 ATAATTGCAAAGCTGCTGCTAGG + Intergenic
1008428684 6:51389134-51389156 ACCTTTGCACAGTTGGGGCATGG + Intergenic
1008647280 6:53527539-53527561 CTCTTTGCTAAGCAGGTGCTGGG + Intronic
1011001458 6:82592453-82592475 AGCTTTCCATAGCTGGTGCGGGG - Intergenic
1013278298 6:108608260-108608282 CCCTTTGAAAAACTGATGCTTGG + Intronic
1015731941 6:136357911-136357933 AAATTTGCAAAGCTGGTGACAGG + Intronic
1016313320 6:142758305-142758327 ACTTGTGAAAAGATGGTGCTGGG + Intronic
1016381501 6:143487326-143487348 AACTTACAAAAGCTGGTGCTTGG - Intronic
1019659762 7:2217620-2217642 ACAGTTGCACAGCTGGAGCTGGG - Intronic
1019724495 7:2593595-2593617 ACCCTGGAAAACCTGGTGCTCGG + Intronic
1022113128 7:27243437-27243459 ACCTTTGCTGTGCTGGTACTCGG - Exonic
1024696297 7:51859905-51859927 GCCCTTGCAGAGCTGGTGCCCGG + Intergenic
1028798507 7:94932720-94932742 TCATTTACAAAGATGGTGCTGGG + Intronic
1029977942 7:104851832-104851854 ATCTTTGCAGTGCTGGTGCCTGG - Intronic
1034559468 7:151870840-151870862 ACGTTTGCAGAGATGGGGCTGGG - Intronic
1034746614 7:153529093-153529115 ATCTTTGCAAAGCTGGGTTTTGG - Intergenic
1037403589 8:18518277-18518299 TCGTTTGCCAAGCTTGTGCTGGG - Intergenic
1037416533 8:18656652-18656674 ACCTTTGTAATGCTAGAGCTGGG - Intronic
1037605890 8:20436778-20436800 GCCCTTGGAAAACTGGTGCTTGG - Intergenic
1039104236 8:33973039-33973061 CCACCTGCAAAGCTGGTGCTTGG + Intergenic
1040434047 8:47372313-47372335 ATCTTTGCATAGCCGGTGCTAGG + Intronic
1040918822 8:52593363-52593385 ATCTTTGCACAGTTGGTGATAGG - Intergenic
1041638181 8:60167162-60167184 CCCTTTTCAAAAATGGTGCTGGG + Intergenic
1043008680 8:74854634-74854656 TACTGTGCTAAGCTGGTGCTTGG + Exonic
1044166206 8:88987032-88987054 ACTTTTGCAAATTTGGTGATTGG + Intergenic
1045030385 8:98129397-98129419 ACCATTGCTATGCTGGTGGTGGG + Intronic
1049341075 8:142112974-142112996 GGCTTTTCACAGCTGGTGCTGGG + Intergenic
1049817820 8:144616119-144616141 ACATTTGCAAAGCTGCTGCTTGG + Intergenic
1050421012 9:5465284-5465306 GGCTTTGAAAAGGTGGTGCTGGG - Intronic
1052088860 9:24301572-24301594 TCCTTGGCATAGTTGGTGCTTGG - Intergenic
1053302085 9:36959519-36959541 ACTTTTGCAAAGGAGGAGCTTGG + Intronic
1056921376 9:90792285-90792307 ACCTTTGTAAAGCTTGTGAAAGG - Intergenic
1057504808 9:95625452-95625474 AGCTTTGCAGAGGAGGTGCTGGG + Intergenic
1058299957 9:103359300-103359322 ACATTTCCTAAGCTGGTGGTAGG + Intergenic
1058970847 9:110081630-110081652 GCCTTTGGGAAGCGGGTGCTGGG - Intronic
1061423600 9:130485481-130485503 ACATTTGCAGGGCTGGAGCTGGG - Intronic
1186529933 X:10285232-10285254 AGCTGTGCAAAACTGGGGCTTGG + Intergenic
1187862905 X:23698842-23698864 AACTTAGCAGTGCTGGTGCTGGG + Intergenic
1189205263 X:39232825-39232847 ACCTCTGAAAAGCTGGTTATGGG + Intergenic
1189973982 X:46444558-46444580 TCCTGGGCAAAGCTGGTGCCAGG + Intergenic
1191681578 X:63846232-63846254 ACCATTGCCAAGCTGAAGCTGGG + Intergenic
1192737617 X:73863847-73863869 ACCTAGGCTAACCTGGTGCTAGG - Intergenic
1194192340 X:90853129-90853151 TCCTTTTCAAAAATGGTGCTGGG - Intergenic
1194886530 X:99322200-99322222 ACCTTTGACAAATTGGTGCTTGG + Intergenic
1199850715 X:151723368-151723390 AACTTTGCAAAGCTGGGGCTGGG - Intergenic
1200538975 Y:4435580-4435602 TCCTTTTCAAAAATGGTGCTGGG - Intergenic
1202391245 Y:24372714-24372736 CTCTTTGCCAAGCTTGTGCTTGG + Intergenic