ID: 992624510

View in Genome Browser
Species Human (GRCh38)
Location 5:78625087-78625109
Sequence TGCAATTCTCCAAATGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 133}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992624506_992624510 5 Left 992624506 5:78625059-78625081 CCTTGGTTGGGGCCCATGGCAAC 0: 1
1: 0
2: 1
3: 7
4: 123
Right 992624510 5:78625087-78625109 TGCAATTCTCCAAATGGAGTTGG 0: 1
1: 0
2: 2
3: 9
4: 133
992624499_992624510 24 Left 992624499 5:78625040-78625062 CCACTGTAAGACCTGGTTTCCTT 0: 1
1: 0
2: 3
3: 28
4: 317
Right 992624510 5:78625087-78625109 TGCAATTCTCCAAATGGAGTTGG 0: 1
1: 0
2: 2
3: 9
4: 133
992624507_992624510 -7 Left 992624507 5:78625071-78625093 CCCATGGCAACAGAGTTGCAATT 0: 1
1: 0
2: 1
3: 12
4: 147
Right 992624510 5:78625087-78625109 TGCAATTCTCCAAATGGAGTTGG 0: 1
1: 0
2: 2
3: 9
4: 133
992624508_992624510 -8 Left 992624508 5:78625072-78625094 CCATGGCAACAGAGTTGCAATTC 0: 1
1: 0
2: 0
3: 19
4: 198
Right 992624510 5:78625087-78625109 TGCAATTCTCCAAATGGAGTTGG 0: 1
1: 0
2: 2
3: 9
4: 133
992624504_992624510 13 Left 992624504 5:78625051-78625073 CCTGGTTTCCTTGGTTGGGGCCC 0: 1
1: 0
2: 1
3: 11
4: 177
Right 992624510 5:78625087-78625109 TGCAATTCTCCAAATGGAGTTGG 0: 1
1: 0
2: 2
3: 9
4: 133
992624498_992624510 25 Left 992624498 5:78625039-78625061 CCCACTGTAAGACCTGGTTTCCT 0: 1
1: 0
2: 0
3: 12
4: 149
Right 992624510 5:78625087-78625109 TGCAATTCTCCAAATGGAGTTGG 0: 1
1: 0
2: 2
3: 9
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992624510 Original CRISPR TGCAATTCTCCAAATGGAGT TGG Intronic
903023840 1:20413065-20413087 TCCAATTCTTCAAGTGGAATTGG - Intergenic
907254313 1:53166944-53166966 CATAATTCTCAAAATGGAGTTGG + Intergenic
907766816 1:57421460-57421482 TTCAATTCTACACATCGAGTTGG - Intronic
911097022 1:94063066-94063088 TGCATTTCTCCAAAGTCAGTGGG - Intronic
912216648 1:107621379-107621401 TTGAATTCTCCAAATGTTGTAGG - Intronic
919426519 1:197439133-197439155 AGGAATTCTTAAAATGGAGTTGG + Intronic
920655313 1:207869729-207869751 TGCAATTCTCAGAAGGGTGTAGG - Intergenic
921280914 1:213567387-213567409 TGTAAGTGTCCACATGGAGTCGG - Intergenic
1068825115 10:61428455-61428477 TGCAAATCCCCAAATGGATAGGG + Intronic
1069236989 10:66088556-66088578 TGCAGTTCTCCAAATGTATCTGG + Intronic
1073821854 10:107273287-107273309 TGGAAGTCTCTAAATGGATTTGG + Intergenic
1074947592 10:118296395-118296417 AGCAATGCTCCCAATGGAGCAGG + Intergenic
1075955435 10:126519259-126519281 TGCTATTCTCCAAATAGGCTGGG - Intronic
1080861314 11:36152638-36152660 TGCAAATGGCCAAAGGGAGTTGG - Intronic
1081080870 11:38737690-38737712 TGCAATGCTTAATATGGAGTTGG - Intergenic
1087591443 11:100194200-100194222 GGCAATCAACCAAATGGAGTGGG + Intronic
1088604012 11:111512140-111512162 TTGAATTTTCCAAATGGAGGTGG - Intronic
1094281733 12:28747633-28747655 TGTGATTTTACAAATGGAGTGGG + Intergenic
1095268087 12:40183497-40183519 TGCAATTGGCCAAATGGCATCGG - Intergenic
1100234638 12:92648494-92648516 TGCAATTCTCCAAAAATGGTTGG + Intergenic
1102743939 12:115233200-115233222 TTAAATTATCCAATTGGAGTGGG - Intergenic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1105574976 13:21642144-21642166 TGTTATTCTCCAAATAGAATGGG + Intergenic
1106616591 13:31335927-31335949 TACAATTCTCCAAAAGGATTTGG + Intergenic
1115277951 14:31629150-31629172 AGCAATTCTCCAAATATGGTTGG - Intronic
1115964610 14:38873702-38873724 CCCAATTCTCCAAATGCAATAGG - Intergenic
1117670095 14:58097884-58097906 TTCAATGCTCCAAGTGGAGTGGG + Intronic
1117988720 14:61413462-61413484 TGCAATTTTCCAGATTAAGTAGG - Intronic
1119014058 14:71031191-71031213 TGCAAATATGCAAATGGAGAAGG + Intronic
1120235369 14:81884346-81884368 TGCAACTGTCAAATTGGAGTTGG - Intergenic
1124906780 15:33876138-33876160 TGTAATTTTGGAAATGGAGTTGG - Intronic
1126570232 15:50142790-50142812 TGCAATCCTCCAAAGTCAGTAGG + Intronic
1126795327 15:52256103-52256125 TGCAAGTTTCCAAATAGACTTGG - Intronic
1130684220 15:86022888-86022910 TGGAGTTCTCCAAAAGGAGGAGG + Intergenic
1134042552 16:11079650-11079672 TGCATTTTTCTAAATGCAGTTGG + Intronic
1135871176 16:26151991-26152013 TGGAATTCTACAAATGGAATGGG - Intergenic
1145758440 17:27409740-27409762 TGCAATTCCCCAAATGCACCAGG - Intergenic
1150530025 17:65968520-65968542 TACAATTCTCTAAAAGTAGTGGG - Intronic
1151690565 17:75681901-75681923 TGCAATGCTGCAAAAGGACTCGG - Intronic
1151909446 17:77072231-77072253 TGCTGTTCTGCAAATGGAGCAGG + Intergenic
1155066270 18:22271834-22271856 TGTAAGTCTCCATATTGAGTTGG + Intergenic
1155610131 18:27658186-27658208 TCCAATTCTCCAAAAAGAGAGGG - Intergenic
1157052624 18:44185006-44185028 TGGAATCCTCTAAAAGGAGTAGG - Intergenic
1157428374 18:47602910-47602932 TCAAATTTTCCAGATGGAGTTGG + Intergenic
1158748765 18:60233775-60233797 TGTAATTCTTCAAATGTAATGGG - Intergenic
1158868208 18:61658529-61658551 TGTAATTCACCAAATGCAGGCGG + Intergenic
1159354896 18:67325861-67325883 AGCAATTTTTCCAATGGAGTTGG - Intergenic
1161494491 19:4580107-4580129 TGCAATTTTACAAATGGGGCAGG + Intergenic
1165320325 19:35080846-35080868 TGCAGTTCTCCATGTGGACTTGG - Intergenic
924975532 2:171138-171160 TGCAATTCCCCAGATGTGGTTGG + Intergenic
928359656 2:30652956-30652978 TGCAAATATCCAAATGGGGGTGG + Intergenic
929214050 2:39391810-39391832 GGCATTTCTGCACATGGAGTTGG + Intronic
930576315 2:53153955-53153977 TGCACTTGTCCAAATTGAATGGG - Intergenic
931934265 2:67178466-67178488 TGAAATTAACCAAATGGGGTAGG + Intergenic
933134481 2:78715483-78715505 TGCAATTCTCCTAATTGTTTAGG + Intergenic
933621038 2:84541672-84541694 TGCTTTCCTCCAAATGGAGATGG - Intronic
933950608 2:87326267-87326289 TGGAATACTGTAAATGGAGTTGG + Intergenic
934880683 2:97974376-97974398 TGGAATCCTCAAAATGGGGTTGG + Intronic
936329170 2:111532312-111532334 TGGAATACTGTAAATGGAGTTGG - Intergenic
937280548 2:120714500-120714522 TGCAATTCCCCCAAAGGAGATGG - Intergenic
938656507 2:133440158-133440180 GGTACTTCTCCAAATGCAGTTGG + Intronic
939024855 2:136999965-136999987 TGAAATTCTTCAATTGGAATTGG - Intronic
939561837 2:143741664-143741686 TGCAAGTCTCCAAATGTATTCGG - Intronic
941618690 2:167753074-167753096 TGCAATGCTCTGAATGCAGTAGG - Intergenic
941692518 2:168515955-168515977 GGACATTCTCCAAATGGAGGTGG + Intronic
946122350 2:217527305-217527327 TGCAACTCTCCAACCTGAGTTGG - Intronic
947679578 2:232017820-232017842 TTTAATTCTCCAAGTAGAGTTGG + Intronic
948294408 2:236849949-236849971 TGCAAGTCTCCCAGTGGACTTGG - Intergenic
1168766396 20:384255-384277 TGGAATTATCCAAAGGCAGTGGG - Intronic
1169447927 20:5688018-5688040 TGTAATTCATCACATGGAGTGGG - Intergenic
1170949582 20:20924665-20924687 GGCAATTCTCCAGAGGGCGTGGG - Intergenic
1179595018 21:42437626-42437648 GGCTATTCTCCAAGGGGAGTGGG + Intronic
1184545940 22:45167886-45167908 TTAATTTTTCCAAATGGAGTCGG + Intronic
951381535 3:21989370-21989392 TGCCATTCTCCAAATTACGTAGG + Intronic
954879004 3:53821404-53821426 TGCCCTTCTCCAAATGAAATAGG + Intronic
955963433 3:64364013-64364035 AGGACTTCTCCAGATGGAGTTGG + Intronic
957131549 3:76229120-76229142 TACTTTTCTCCAAATGCAGTGGG - Intronic
957219993 3:77369759-77369781 TGAAATTGTCCAAATGGTGTAGG + Intronic
957805437 3:85142436-85142458 TGAAATTATCCAAAAGGATTTGG + Intronic
958653036 3:96962542-96962564 TGAAATTCTCTTGATGGAGTGGG - Intronic
962273586 3:133995998-133996020 TCCAATTCTCCAAATGGAGATGG - Intronic
967786162 3:193499394-193499416 TGCAATTTTGCAAATAGAGCAGG + Intronic
968108823 3:196025424-196025446 TGCAATTCCCCAGATGTGGTTGG + Intergenic
972100637 4:35410282-35410304 TTTAATTCTACAGATGGAGTTGG - Intergenic
972975249 4:44626482-44626504 GGCAGTTCTACAAATGGAGTGGG + Intronic
973903274 4:55500014-55500036 TGTAATTTTACAAATGGAGATGG + Intronic
976093958 4:81487844-81487866 TGCATTTCTCTAAATGGTGTTGG + Intronic
976927453 4:90516910-90516932 GGCAATTGCACAAATGGAGTGGG + Intronic
979975496 4:127190932-127190954 TGCAATTGTTCAACAGGAGTTGG - Intergenic
983163326 4:164444944-164444966 TGCAAAGCTCCAAATAAAGTGGG + Intergenic
983540441 4:168903691-168903713 TTCAGTTCTCCAAATAGAGTAGG + Intronic
984863825 4:184263715-184263737 TGGAGTTCTCCAAGTGGACTTGG + Intergenic
984938112 4:184907548-184907570 TGGATTTATCCAAATGGAGCTGG + Intergenic
985148327 4:186918597-186918619 TGTAACTCTGTAAATGGAGTAGG + Intergenic
985420143 4:189777134-189777156 CGTACTTCTCCAAATGTAGTTGG - Intergenic
985470584 5:41641-41663 TGCAATTCCCCAGATGTGGTTGG + Intergenic
987290786 5:16506060-16506082 TGATATTCACCAAATGGACTTGG - Intronic
990633154 5:57692942-57692964 TGCCTTTCCCCAAATGGAATTGG + Intergenic
991174157 5:63667267-63667289 TGCATTTCCCCAAATGCATTTGG - Intergenic
992216495 5:74529452-74529474 GGTAATTCTCCAAAGGAAGTCGG + Intergenic
992624510 5:78625087-78625109 TGCAATTCTCCAAATGGAGTTGG + Intronic
993018024 5:82558684-82558706 TGAAAAACTCCAAATGGAATTGG - Intergenic
993451885 5:88081771-88081793 TGTAATTCACCAGATGGAGAAGG - Intergenic
994132929 5:96251183-96251205 TACAAATCTGCAAATGTAGTAGG + Intergenic
994844143 5:104963929-104963951 TGCAATTATCCAATTGCAGGTGG - Intergenic
995165871 5:109040975-109040997 TTCAATTCTTGAAATGAAGTAGG + Intronic
996551575 5:124735749-124735771 GACAATTGACCAAATGGAGTTGG + Intronic
997286086 5:132679659-132679681 TCCCATCCTCCAAATGGAGCTGG + Intronic
998182062 5:139952731-139952753 TTCAATGCTCCAAATGGAGTGGG + Intronic
999997825 5:157109030-157109052 TTTAACTCTCCAAATGGACTGGG + Exonic
1002779280 6:353995-354017 TGCAATTCTGCAGATGGTGGGGG + Intergenic
1012446430 6:99311711-99311733 TGCTATTCTCCAGATGAGGTTGG - Intronic
1013228035 6:108134711-108134733 TGCAAGTCAACAAAAGGAGTTGG + Intronic
1013618325 6:111865561-111865583 TGGTATTATCCAAATGGACTTGG - Intronic
1014310052 6:119788291-119788313 TGTAATTCCCAAATTGGAGTTGG - Intergenic
1014911486 6:127099147-127099169 ACCAAATCTCCAAATAGAGTTGG - Intergenic
1015013899 6:128386522-128386544 TGAAATACTCCTAATGGAGATGG + Intronic
1015068656 6:129061799-129061821 TGAAATTCACCAAGTGGAATTGG + Intronic
1015352807 6:132242455-132242477 TAAAATTCTTCAAATGGTGTTGG + Intergenic
1017499992 6:155015250-155015272 TGCTACTCTACTAATGGAGTTGG + Intronic
1017904958 6:158751631-158751653 TGGTCTTCGCCAAATGGAGTAGG + Intronic
1019984093 7:4642369-4642391 TTCAATGCTCCAAAGGGAGGAGG + Intergenic
1022391958 7:29951011-29951033 TGCAATTTTGCAAATGGTGGGGG - Intronic
1023444603 7:40218355-40218377 CCCACTTCTCCAAATGAAGTGGG + Intronic
1023665939 7:42523551-42523573 TGAGATTCTCCAAAGAGAGTGGG - Intergenic
1023841759 7:44102123-44102145 TGCAGGTCTTCAAGTGGAGTGGG + Intergenic
1027624075 7:80526926-80526948 TGCAGTTCTCCAAATACACTAGG - Intronic
1029993278 7:104982526-104982548 TCCAGTTCTCCAACTGGTGTGGG + Intergenic
1030712483 7:112766722-112766744 TGCAGTTCTTCAAATGGTCTTGG + Exonic
1032955891 7:136971904-136971926 TGCTAATCTCTAAAGGGAGTAGG + Intronic
1034221360 7:149449044-149449066 TGCCATTCTGCAAAAGGAGAAGG + Intronic
1035949966 8:4009584-4009606 TGCAATTGTAAAAATTGAGTTGG - Intronic
1040477085 8:47788266-47788288 GGCAAGTCTCCAGATGGAGGAGG + Intronic
1040934070 8:52765146-52765168 TGCATTTCTCCCAATGGAACTGG + Intergenic
1041313102 8:56536302-56536324 TGCAATCTTCTAAATGGTGTGGG + Intergenic
1041691160 8:60688738-60688760 TGCAATTCTCCAAACATGGTGGG + Intronic
1045395723 8:101758889-101758911 TGCAACTCTCCAATTTAAGTAGG - Intronic
1045690056 8:104751177-104751199 TGGAATTTTCCAACTGGAGCTGG - Intronic
1046804746 8:118467672-118467694 TGCCAGTCTCCAAATTGATTAGG - Intronic
1053277622 9:36795168-36795190 GGCCATTCTCCAAATGGTCTGGG + Intergenic
1060358916 9:122936331-122936353 TCCTATTCTTCAGATGGAGTAGG + Intergenic
1062100381 9:134724933-134724955 TGCCATCCTCCAGATGGGGTTGG + Intronic
1185744291 X:2559584-2559606 TGCAATTCTCCCAATGAAATGGG + Intergenic
1195757119 X:108210329-108210351 TGCTTTCCTCCAAAAGGAGTAGG - Intronic
1197459133 X:126717864-126717886 TAAAATGCTCAAAATGGAGTTGG - Intergenic