ID: 992627224

View in Genome Browser
Species Human (GRCh38)
Location 5:78647453-78647475
Sequence CTCTAACAGCTCTGGCTCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992627220_992627224 1 Left 992627220 5:78647429-78647451 CCGGTTTACCTCTCTGGGGTGAG 0: 1
1: 0
2: 0
3: 14
4: 128
Right 992627224 5:78647453-78647475 CTCTAACAGCTCTGGCTCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 86
992627216_992627224 19 Left 992627216 5:78647411-78647433 CCTTCAAGCTCAGTTACTCCGGT 0: 1
1: 0
2: 0
3: 2
4: 80
Right 992627224 5:78647453-78647475 CTCTAACAGCTCTGGCTCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 86
992627214_992627224 20 Left 992627214 5:78647410-78647432 CCCTTCAAGCTCAGTTACTCCGG 0: 1
1: 0
2: 0
3: 2
4: 75
Right 992627224 5:78647453-78647475 CTCTAACAGCTCTGGCTCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 86
992627221_992627224 -7 Left 992627221 5:78647437-78647459 CCTCTCTGGGGTGAGCCTCTAAC 0: 1
1: 0
2: 0
3: 6
4: 116
Right 992627224 5:78647453-78647475 CTCTAACAGCTCTGGCTCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992627224 Original CRISPR CTCTAACAGCTCTGGCTCGC CGG Intronic
903774180 1:25782338-25782360 CTCTGAGAGCTCTGGCCCGATGG - Intronic
906315425 1:44784125-44784147 CTCTAATAGAGCTGGCTGGCAGG + Exonic
910433430 1:87180913-87180935 ATCCAACAGCTCTGGCAGGCTGG - Intergenic
911017647 1:93351509-93351531 CTCTACAAGCTCTGCCTCCCGGG + Intronic
917298571 1:173548653-173548675 CTCTAACCACTCTGGTTTGCAGG - Intronic
922570912 1:226634278-226634300 CTCTAACAGCACTGGCCGCCAGG + Exonic
922703520 1:227776235-227776257 TTCTATCAGGTCTGGCTCGCAGG + Intronic
923029611 1:230237335-230237357 CTCTAACAGCACTGACACACTGG - Intronic
1063124764 10:3128508-3128530 CTCCCACAGCTCTGGAGCGCAGG + Intronic
1064263920 10:13809176-13809198 CCCTAACAGCACTGACTGGCAGG - Intronic
1064289203 10:14018012-14018034 TTCTAACTGCTCTTGCTTGCTGG + Intronic
1065136137 10:22672256-22672278 CCCTGACAGCTCTGGGTCGGGGG + Intronic
1065341884 10:24714952-24714974 CACTGAAAGCTCTGCCTCGCGGG - Intronic
1067535189 10:47104358-47104380 TTCTATCAGCTCTGGCTCCATGG + Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1076694537 10:132240761-132240783 CTCTAACCCCCCTGGCTGGCTGG - Intronic
1077820225 11:5730265-5730287 CACTACCAGCTCTGCCTCCCGGG + Intronic
1079018941 11:16893440-16893462 CTCTTACAGCTCTGACACCCTGG + Intronic
1080635939 11:34123231-34123253 CTCTATCAGCACTGACTTGCTGG - Intronic
1082114708 11:48315608-48315630 CTCCAACACCTCTGGCCCACAGG + Intergenic
1082898717 11:58221667-58221689 CACTAAAAGCTCTGCCTCCCGGG - Intergenic
1083310312 11:61780527-61780549 CTCAGACAGCCCTGACTCGCAGG - Intronic
1083459369 11:62800422-62800444 CTAGAAGAGCTCTGGCTCGATGG - Exonic
1088772047 11:113044827-113044849 CGCTGAAAGCTCTGCCTCGCAGG + Intronic
1095396412 12:41767200-41767222 CTCTAATAGCTCCTGCTCCCAGG - Intergenic
1101348713 12:103908133-103908155 CACTGACAGCTCTGCCTCCCGGG - Intergenic
1104767852 12:131341868-131341890 CTCTCACAGGTCTGGGTCACAGG - Intergenic
1104811868 12:131624214-131624236 CTCTCACAGGTCTGGGTCACAGG + Intergenic
1122197244 14:100097716-100097738 CTCCCACAGCTCTGGCTCTCCGG + Intronic
1122355881 14:101122606-101122628 CTCTAGCAGCTCTGCCTCCTTGG + Intergenic
1122702144 14:103597038-103597060 CACTACCACCTCTGGCTCCCAGG - Intronic
1122704540 14:103612010-103612032 CTCTGAAAGCTCTGCCTCCCAGG + Intronic
1122996154 14:105265823-105265845 CACTACAAGCTCTGCCTCGCGGG - Intronic
1126152426 15:45535635-45535657 CTCTAACAGCTGGGGCTCCTTGG + Intergenic
1129175929 15:73839698-73839720 CTCTCCCAGCTCTGGCCAGCAGG - Intergenic
1129667894 15:77589780-77589802 CTCCAGCAGCTCTGTCTTGCTGG + Intergenic
1130060945 15:80569591-80569613 CCCTAACTGCTCTGGCTCTGTGG - Intronic
1130402921 15:83574065-83574087 CTCTCACAGCCCTGGCCCTCTGG - Intronic
1132413094 15:101600294-101600316 CTCTGACACCTCTGCCTCACGGG + Intergenic
1132645029 16:995004-995026 CTCTCACAGCTGTGGGTCCCAGG + Intergenic
1134211982 16:12285245-12285267 CTCTCCCAGCTCTTGCTTGCCGG + Intronic
1140790799 16:78389124-78389146 CTCTCTCAGATCTGGCTGGCTGG - Intronic
1145984887 17:29038988-29039010 CTGAACAAGCTCTGGCTCGCTGG - Intronic
1149075746 17:52595139-52595161 CTCTAATAGCTGTGGCTAGTAGG - Intergenic
1152312711 17:79560639-79560661 CTGTGACAGCACTGGCTGGCAGG - Intergenic
1152446396 17:80347049-80347071 CTCTATGAGCTCTGTCTCGTTGG - Exonic
1161539787 19:4843430-4843452 CACTACCAGCTCTGCCTCCCAGG - Intronic
1163916628 19:20246030-20246052 CTTTAATAGCTGTGGCTGGCAGG - Intergenic
1164480648 19:28608886-28608908 CTCTAATAGCTGCGGCTAGCAGG - Intergenic
1165120242 19:33554107-33554129 CTTTAACAGCTGTGGCTTCCGGG - Intergenic
1167220721 19:48196550-48196572 GTCTGCCAGCTCTGGCCCGCAGG - Intronic
928846365 2:35678134-35678156 CTATAACAGTTCTGGATCTCAGG + Intergenic
930518138 2:52433127-52433149 CTCTAATAGCTGCGGCTAGCAGG - Intergenic
931782034 2:65587206-65587228 CACTAAAAGCTCTGCCTCCCGGG + Intergenic
935499621 2:103822132-103822154 ATCTATAAGCTCTGCCTCGCGGG - Intergenic
939885120 2:147673009-147673031 GTCTAAAAGCTCTTGCTTGCTGG - Intergenic
945185882 2:207139174-207139196 CTGTAACAGCTCTAACTCCCAGG + Intronic
947597987 2:231426035-231426057 CTCTGACAGCTCTCGCCCTCAGG - Intergenic
948879827 2:240851008-240851030 CTCCACCAGCCCTGGCCCGCTGG + Intergenic
1175688220 20:61046680-61046702 ATCTACCAGCTCTGTCTAGCTGG + Intergenic
1176058652 20:63162106-63162128 CTCTATCAGCACGGGCTCTCTGG - Intergenic
1183497504 22:38156527-38156549 CACTACCAGCTCTGCCTCCCGGG + Intronic
949157705 3:848721-848743 CTCTTATAGCTGTGGCTAGCAGG - Intergenic
950532371 3:13559756-13559778 CTCCATCAGCTCTGGCCCCCTGG - Intronic
959082693 3:101818839-101818861 CACTAAAACCTCTGCCTCGCAGG + Intronic
968013247 3:195301575-195301597 CTTTAAAAGTTCTGGCTCCCAGG + Exonic
968123639 3:196143194-196143216 CCCTGCCAGCGCTGGCTCGCCGG - Intergenic
972041344 4:34604028-34604050 CTCTAACAGCTGTGGTTGGATGG + Intergenic
978938555 4:114409873-114409895 CACTACAAGCTCTGCCTCGCAGG - Intergenic
979494157 4:121365376-121365398 CACTAAAAGCTCTGCCTCCCAGG - Intronic
980943204 4:139294657-139294679 CACTGAAAGCTCTGCCTCGCGGG - Intronic
992089253 5:73303244-73303266 CACTAACAGCCCTGACTCCCGGG - Intergenic
992627224 5:78647453-78647475 CTCTAACAGCTCTGGCTCGCCGG + Intronic
995501404 5:112810947-112810969 CACTACCAACTCTGGCTCCCAGG - Intronic
998464497 5:142332693-142332715 CTATAACACCTCTGCCTCCCTGG + Intergenic
1002932618 6:1644793-1644815 CTCTGACAGCTTTGGCTCTCAGG + Intronic
1007835485 6:44670825-44670847 CTCAAAACGCTCTGGCCCGCTGG - Intergenic
1011227807 6:85127043-85127065 CTTTCACATCTCTGGCTCTCAGG + Intergenic
1015693814 6:135957156-135957178 CTCTTCCAGCTCTGCCTGGCCGG - Intronic
1016814145 6:148288144-148288166 CTCTGACAGCTGGGGCCCGCGGG - Intronic
1023554203 7:41403138-41403160 CACTAAAAGCTCTGCCTCCCGGG - Intergenic
1023579332 7:41664509-41664531 CTCTAACAGCTCTGGGGCCAGGG - Intergenic
1023959180 7:44912515-44912537 TTCTAACAGCTGGGGCTCTCAGG + Intergenic
1031677249 7:124625466-124625488 CACTGAAAGCTCTGGCTCCCGGG - Intergenic
1036624575 8:10457558-10457580 ATTTCACAGCTCTGGCTCTCTGG - Intergenic
1043955173 8:86351362-86351384 CTCCGACAGCTCTGTCTCCCAGG + Intronic
1049163281 8:141111302-141111324 CACTAACAGCTCTGCTTCCCAGG - Intergenic
1053283964 9:36838737-36838759 CTCTCACAGCCCCGGCTCCCTGG + Exonic
1060906694 9:127313378-127313400 CTCTACCATCTGTGGCTGGCAGG + Intronic
1200249171 X:154543079-154543101 CTGGAACAGCTCCGGCTCCCAGG - Intronic