ID: 992627408

View in Genome Browser
Species Human (GRCh38)
Location 5:78648406-78648428
Sequence GGCTCCCCATGCGCCCGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992627396_992627408 23 Left 992627396 5:78648360-78648382 CCGCGCCAGCCGCGGCTCAAGCA 0: 1
1: 0
2: 0
3: 20
4: 229
Right 992627408 5:78648406-78648428 GGCTCCCCATGCGCCCGCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 104
992627400_992627408 14 Left 992627400 5:78648369-78648391 CCGCGGCTCAAGCAGCCAGGGCT 0: 1
1: 0
2: 1
3: 18
4: 201
Right 992627408 5:78648406-78648428 GGCTCCCCATGCGCCCGCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 104
992627403_992627408 -1 Left 992627403 5:78648384-78648406 CCAGGGCTCGGCCGGCCGCAACG 0: 1
1: 0
2: 1
3: 5
4: 93
Right 992627408 5:78648406-78648428 GGCTCCCCATGCGCCCGCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 104
992627397_992627408 18 Left 992627397 5:78648365-78648387 CCAGCCGCGGCTCAAGCAGCCAG 0: 1
1: 0
2: 1
3: 12
4: 147
Right 992627408 5:78648406-78648428 GGCTCCCCATGCGCCCGCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 104
992627395_992627408 24 Left 992627395 5:78648359-78648381 CCCGCGCCAGCCGCGGCTCAAGC 0: 1
1: 0
2: 0
3: 15
4: 207
Right 992627408 5:78648406-78648428 GGCTCCCCATGCGCCCGCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992627408 Original CRISPR GGCTCCCCATGCGCCCGCGC GGG Intronic