ID: 992627646

View in Genome Browser
Species Human (GRCh38)
Location 5:78649107-78649129
Sequence GGTTCCTCCGGGCCGCACCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 64}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992627640_992627646 -9 Left 992627640 5:78649093-78649115 CCGGGGTCCTGCGAGGTTCCTCC 0: 1
1: 0
2: 2
3: 8
4: 193
Right 992627646 5:78649107-78649129 GGTTCCTCCGGGCCGCACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 64
992627639_992627646 -8 Left 992627639 5:78649092-78649114 CCCGGGGTCCTGCGAGGTTCCTC 0: 1
1: 0
2: 0
3: 16
4: 137
Right 992627646 5:78649107-78649129 GGTTCCTCCGGGCCGCACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 64
992627628_992627646 25 Left 992627628 5:78649059-78649081 CCCTGAGCCCGCCGGGCAGCGGC 0: 1
1: 1
2: 3
3: 23
4: 200
Right 992627646 5:78649107-78649129 GGTTCCTCCGGGCCGCACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 64
992627633_992627646 17 Left 992627633 5:78649067-78649089 CCGCCGGGCAGCGGCGGCGGCGT No data
Right 992627646 5:78649107-78649129 GGTTCCTCCGGGCCGCACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 64
992627632_992627646 18 Left 992627632 5:78649066-78649088 CCCGCCGGGCAGCGGCGGCGGCG 0: 1
1: 5
2: 23
3: 134
4: 630
Right 992627646 5:78649107-78649129 GGTTCCTCCGGGCCGCACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 64
992627626_992627646 30 Left 992627626 5:78649054-78649076 CCGGTCCCTGAGCCCGCCGGGCA 0: 1
1: 0
2: 0
3: 11
4: 183
Right 992627646 5:78649107-78649129 GGTTCCTCCGGGCCGCACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 64
992627629_992627646 24 Left 992627629 5:78649060-78649082 CCTGAGCCCGCCGGGCAGCGGCG 0: 1
1: 0
2: 3
3: 28
4: 239
Right 992627646 5:78649107-78649129 GGTTCCTCCGGGCCGCACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 64
992627634_992627646 14 Left 992627634 5:78649070-78649092 CCGGGCAGCGGCGGCGGCGTCTC 0: 1
1: 0
2: 8
3: 48
4: 352
Right 992627646 5:78649107-78649129 GGTTCCTCCGGGCCGCACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992627646 Original CRISPR GGTTCCTCCGGGCCGCACCG GGG Intronic