ID: 992629097

View in Genome Browser
Species Human (GRCh38)
Location 5:78663772-78663794
Sequence TAAAGTATACAGAAGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 1, 2: 13, 3: 25, 4: 243}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992629097 Original CRISPR TAAAGTATACAGAAGGATGC TGG Intronic
903517071 1:23918459-23918481 GAAAGTAAACAGAAGCAGGCCGG + Intergenic
903566297 1:24268292-24268314 TAAAGTATACAGGAGGGGGCTGG - Intergenic
904491317 1:30861308-30861330 GAGAGAATAGAGAAGGATGCAGG - Intergenic
904742005 1:32685003-32685025 TAAAGAAGAAAAAAGGATGCAGG - Exonic
904841652 1:33375850-33375872 TAAAGTATATAGGAGGATGTGGG + Intronic
905007313 1:34720306-34720328 TGAGGCAGACAGAAGGATGCTGG + Intronic
905918084 1:41699661-41699683 GAAAGGATGCAGAGGGATGCTGG + Intronic
906485870 1:46234569-46234591 TAAAGTAGAAGGAAGGAGGCTGG - Intergenic
908745754 1:67375096-67375118 AAAAGTACACAAAAGGAGGCTGG + Intronic
908956780 1:69640109-69640131 TGAAGTCTCCAGAAGGATACAGG + Intronic
909310215 1:74137254-74137276 TATAGTATATAGAAAGATGTTGG - Intronic
910296481 1:85651017-85651039 TAAATTTTACATAAAGATGCTGG - Intronic
910379792 1:86614040-86614062 TAGAGTCTACAGAAGCAGGCAGG + Intergenic
911255329 1:95626807-95626829 TAAAATATACAGCAGGAAACAGG - Intergenic
911294418 1:96097162-96097184 TAAACTAAACAGATGGATGTGGG + Intergenic
911460498 1:98183024-98183046 TACAGTATACTGAAGGGTGAGGG - Intergenic
911709349 1:101052056-101052078 TATAGTTTAGAGAAGGAAGCAGG - Intergenic
913042441 1:115040640-115040662 TAAAGTATACAGGAGGAGCTAGG + Intergenic
914335323 1:146709749-146709771 TAGAGTATACAGGAGGGTGTTGG - Intergenic
914505259 1:148283184-148283206 TACAGTATACAGAAGTTTTCTGG - Intergenic
914507306 1:148300963-148300985 TACAGTATACAGAAGTTTTCTGG + Intergenic
915059819 1:153172074-153172096 TCATGTATTCAGGAGGATGCTGG - Intergenic
916803643 1:168237807-168237829 TAAGATATGGAGAAGGATGCTGG + Intronic
917384928 1:174462012-174462034 TAAGGTATACAGAAGGTTCTTGG - Intronic
917761562 1:178165044-178165066 TAAAGTATACAGGAAGATGTAGG + Intronic
919467197 1:197936413-197936435 TAAAATATCCAGAAGGAGGCTGG - Intergenic
920144122 1:203843426-203843448 AAAAGTATACAGAGACATGCAGG - Intronic
924187252 1:241506326-241506348 CAAAGTATAGGGAAGGATGAGGG + Intronic
1063550402 10:7027284-7027306 AAAAGTATAGAGAAGGCTGTCGG + Intergenic
1064196857 10:13250706-13250728 TAAAGCAGAAAGAAGGATGAAGG + Intergenic
1066292281 10:34025409-34025431 TATAGTATGAAAAAGGATGCTGG + Intergenic
1066311694 10:34203529-34203551 TAAAGTATACAGGAGGATGTGGG - Intronic
1066816104 10:39415703-39415725 AAAAGTAGACAGAAGTATACTGG + Intergenic
1066816368 10:39420975-39420997 AAAAGTATACAGAAGCATCCTGG + Intergenic
1066816413 10:39421827-39421849 AAAACTATACAGAAGCATTCTGG + Intergenic
1067938200 10:50629202-50629224 TAAAGTGTACAGGAGGATATGGG - Intergenic
1068124709 10:52825317-52825339 TAAAGTATGTGGAAGGATGTGGG + Intergenic
1068506840 10:57911461-57911483 TATATTAAACATAAGGATGCTGG + Intergenic
1071778094 10:88811577-88811599 TAGAGAATAGAGAAGGATGAAGG - Intronic
1071930308 10:90462282-90462304 TAAAATCTACAGAAGGGTCCTGG - Intergenic
1073691510 10:105814367-105814389 CAAAGAATTAAGAAGGATGCTGG + Intergenic
1074857004 10:117481007-117481029 TAAAGTGTACAGGAAGAGGCTGG + Intergenic
1075042562 10:119119751-119119773 TTAATGATACAGAAAGATGCTGG + Intronic
1075280798 10:121136515-121136537 GAAAGGATATAGAAGAATGCAGG - Intergenic
1076525358 10:131109230-131109252 TGAAGTTTACAGAAGAATTCAGG - Intronic
1079176795 11:18149620-18149642 TAAAGTATATAGGAGAATGTGGG + Intronic
1079395774 11:20062074-20062096 AAAAGTATTCAGAAGGTTGAAGG + Intronic
1080138535 11:28887665-28887687 TCAAGTATACAGAAAGCTGAGGG - Intergenic
1081854643 11:46295778-46295800 TAAATTTTAGAGAAGGATCCGGG - Intronic
1082138692 11:48580723-48580745 TAAATTACACTGAAGGAAGCAGG - Intergenic
1082315847 11:50720057-50720079 TAAAGTACACAGAGGCATTCTGG - Intergenic
1083692230 11:64416661-64416683 TAAATTATAAAGAATGAGGCTGG + Intergenic
1085874329 11:80387825-80387847 TAAAGCATATAGAAGGATGCAGG - Intergenic
1086889600 11:92241672-92241694 TAACGAATACAGAATGTTGCTGG + Intergenic
1089154412 11:116389947-116389969 AAAAGAATACAGGAAGATGCGGG - Intergenic
1096187560 12:49591807-49591829 TAATATATACAGGAGGATGTGGG - Intronic
1096296650 12:50389799-50389821 TAAAGAATACAGATGGATTTTGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097236562 12:57544292-57544314 CAAAGTATACAGGAGGGTGTAGG - Intronic
1097788923 12:63793065-63793087 TTAAGAATTCAGAATGATGCTGG - Intronic
1098764212 12:74465825-74465847 TAATGCATCCAGAAGGATACAGG - Intergenic
1101521896 12:105491484-105491506 AGAAGTATACAGAAGAATGGTGG - Intergenic
1102226429 12:111231810-111231832 TAAAGTATACAGGAGGGGCCAGG + Intronic
1104692209 12:130835125-130835147 TAAAAAATACAGAAGTTTGCTGG + Intronic
1106622639 13:31385737-31385759 TAAATGATACAGAAGGGGGCGGG - Intergenic
1106830067 13:33571446-33571468 TAAGGTATGCAGAAAAATGCAGG - Intergenic
1107924248 13:45243193-45243215 TAAAGTACACAGAAGGATGGAGG - Intronic
1111716397 13:91884866-91884888 TAAAGGATACAGAAGGTTTCAGG - Intronic
1112517183 13:100064368-100064390 TACAGTATACAATAGGATTCTGG - Intergenic
1113996212 14:16076579-16076601 AAAACTATACAGAAGCATTCTGG + Intergenic
1114619564 14:24087158-24087180 TAAAGGAGACAGAAAGATGTAGG + Intronic
1115227651 14:31120876-31120898 TAAAGTATTAAGAACTATGCTGG + Intronic
1119734649 14:76974171-76974193 TCAAGTATACAAAATGAGGCTGG + Intergenic
1121594899 14:95154753-95154775 AAAAGTATGGAGATGGATGCTGG + Intronic
1122303521 14:100746507-100746529 TAAAGTCTACAGTAGTGTGCAGG + Intergenic
1123226333 15:17036758-17036780 TAAACTATACAGAAGCATTCTGG + Intergenic
1123737301 15:23197879-23197901 TAAAGGATACAGAAGGTTTCAGG - Intergenic
1124288518 15:28426543-28426565 TAAAGGATACAGAAGGTTTCAGG - Intergenic
1124294708 15:28490771-28490793 TAAAGGATACAGAAGGTTTCAGG + Intergenic
1126445241 15:48735783-48735805 TAAAGCAAACAGAAGGAAGAGGG + Intronic
1126477984 15:49087203-49087225 TAAATTATACAGAAGAAAGTAGG - Intergenic
1126703462 15:51386944-51386966 TGAAGTATACAGGAGGAGGTGGG + Intronic
1126811776 15:52413833-52413855 TAAATAATAGAGAAGGAAGCAGG + Intronic
1131164451 15:90132225-90132247 TAAAGTATATGGGAGGATGTGGG - Intergenic
1131593226 15:93771396-93771418 TAAAGTATGCAGAAGCAGGTGGG + Intergenic
1131646451 15:94350134-94350156 TAGAGTATAAAGAAAGATGCTGG + Intronic
1132504503 16:300657-300679 TAAAGAGGACAGACGGATGCTGG + Intronic
1133636872 16:7675139-7675161 TAAAGTTCACAGAAAGATACAGG - Intronic
1133892827 16:9897054-9897076 ATAAGTACACAGAAGCATGCTGG + Intronic
1137446873 16:48537307-48537329 TAAAGGAGACAGAAGCTTGCCGG + Intergenic
1139072945 16:63405211-63405233 TAAAATATTCAGTAGGATCCAGG + Intergenic
1139271462 16:65687326-65687348 TAAAGAATACAGAAGGAGAGGGG + Intergenic
1139998300 16:71001479-71001501 TAGAGTATACAGGAGGGTGTTGG + Intronic
1144252492 17:13431826-13431848 TAAAGTATATGGGAGGATGTGGG - Intergenic
1144317727 17:14079190-14079212 TAAAGCATACAACAGCATGCTGG + Intronic
1145925860 17:28646000-28646022 TAAACTACACAGAAGGAAGCAGG - Intergenic
1147698022 17:42371279-42371301 TCAAGTTTGCAGCAGGATGCAGG + Intronic
1148183941 17:45627796-45627818 TAGAGTATACGGGAGGATGGGGG - Intergenic
1153445395 18:5166526-5166548 TGAAGTATATAGAAGTATGGTGG - Intronic
1154115710 18:11611523-11611545 TAAAGTATACAGGAGGATGTGGG + Intergenic
1154120154 18:11645742-11645764 TAAAGTATACAGGAGGATGTGGG + Intergenic
1156111686 18:33735178-33735200 TAAAGGACACAGATGGTTGCAGG + Intronic
1158734257 18:60061936-60061958 TAGAATATAGAGAAGGATCCTGG + Intergenic
1159095635 18:63898395-63898417 TAAAATATACAGAGGGAGGCAGG - Intronic
1159097906 18:63925705-63925727 TAATGAATACAGAAGAATGATGG + Intronic
1159305536 18:66637086-66637108 TAAAGTATACAGAAGCAGAAGGG - Intergenic
1162672783 19:12271849-12271871 TAGAGTATACAGGAGAATGTGGG + Exonic
1162678226 19:12317108-12317130 TAGAGTATACAGGAGGATGTGGG + Intergenic
1164352479 19:27368429-27368451 AAAACTAGACAGAAGGATTCTGG - Intergenic
1165586251 19:36918371-36918393 TAATGTATAAAGAAGGATGTAGG - Intronic
1165667324 19:37644167-37644189 TGAATTATACAGAAAGATGAAGG + Intronic
1167135576 19:47613329-47613351 TCAAGAATGCAGAAGGCTGCTGG + Intronic
1167822598 19:51942397-51942419 CAAAGTATAATGAGGGATGCCGG + Intronic
1168396401 19:56052568-56052590 TGAAGAATAAAGAGGGATGCAGG - Intronic
925270540 2:2603763-2603785 TAAAGTATACAAGAGGTGGCCGG - Intergenic
927069223 2:19508526-19508548 TAAATTATACACAAGGGTGTGGG - Intergenic
929991709 2:46795563-46795585 TTAAGTATACAGAAGGATGTGGG - Intergenic
931085826 2:58830073-58830095 CCAAGTATTCAAAAGGATGCAGG + Intergenic
932030083 2:68174553-68174575 TAAAGTATATGGGAGGATGTGGG + Intronic
933315006 2:80704998-80705020 TAAAGCATACACAAGGAAGAAGG + Intergenic
933783762 2:85821709-85821731 TAAAGAATACATAACGATGAAGG + Intergenic
935236517 2:101143376-101143398 TAAAGTAAAAAGCAGGAAGCAGG + Intronic
936096328 2:109532903-109532925 GAAACTAAACAGAAGGAAGCAGG - Intergenic
937327237 2:120997720-120997742 CAAACTATACAAAAGGATGTAGG + Intergenic
937645554 2:124262471-124262493 TTAAGTTTACAGAATGATGCTGG - Intronic
937794535 2:126001125-126001147 TAAAGAACACAGCAAGATGCTGG + Intergenic
938005072 2:127782712-127782734 TAAAGTATACAGCAGGAGCCAGG + Intronic
938042707 2:128089496-128089518 GAAAGTAGACAGAAAGATGTTGG + Intergenic
938535973 2:132247725-132247747 AAAACTATACAGAAGCATTCTGG - Intronic
939178541 2:138779929-138779951 TAAAGTAGGCAGAAGGTGGCCGG - Intronic
939195601 2:138967136-138967158 TAAAGCATACAGGGGGATGTGGG - Intergenic
939209656 2:139157708-139157730 TAAAGTATACAGGAGGATGTGGG + Intergenic
939675640 2:145069024-145069046 TGAAGTATCAAGAAGGAGGCTGG + Intergenic
939925657 2:148171197-148171219 TAATATATACATAAGGATACTGG - Intronic
940966656 2:159845671-159845693 TTAAGTATACAGGAGGATGTAGG + Intronic
941082167 2:161074276-161074298 TAAAGTATACAGAGGGATGTAGG - Intergenic
942081503 2:172403490-172403512 TGAAGTAAACAGAAGGAAGCTGG + Intergenic
942442773 2:176053160-176053182 TAAAGTATGAAGAAGGAAACTGG - Intergenic
943369018 2:186992761-186992783 TAAAGTACACAGAGGAATGTCGG - Intergenic
945520701 2:210823908-210823930 TAAAGTATACCTAGGGATGTTGG - Intergenic
946585779 2:221185907-221185929 AAATGTAGACAGAAGGGTGCAGG + Intergenic
946846720 2:223865669-223865691 TAATATATGTAGAAGGATGCTGG + Intronic
947462562 2:230315974-230315996 TAAAGGATTCAGCAGGATGTAGG + Intergenic
948412064 2:237771446-237771468 TAAAGTGTACCGGAGAATGCAGG + Intronic
949024670 2:241761241-241761263 TAAAGTATACAGGAGGGGCCGGG + Intronic
1170869464 20:20191754-20191776 TAAAGTGCAAAGAAGAATGCTGG - Intronic
1171737208 20:28804819-28804841 TAAACTACACAGAAGAATTCTGG - Intergenic
1172968270 20:38854695-38854717 TAAAGTGGAGAGAATGATGCAGG + Intronic
1173152561 20:40580366-40580388 TATAGTATACAGGAGGATGCGGG + Intergenic
1177247388 21:18546035-18546057 TAAATTATTCAGAAAGAGGCAGG + Intergenic
1179263084 21:39775821-39775843 TAAAGTCTACAGTGGGGTGCTGG - Intronic
1179421109 21:41237551-41237573 TGAAGTACACACAAGGAAGCTGG + Exonic
1180310847 22:11230567-11230589 AAAACTATACAGAAGCATTCTGG - Intergenic
949148386 3:732486-732508 GATAGTGTACAAAAGGATGCTGG + Intergenic
949785775 3:7740108-7740130 TAGAGTATAAAGAGGGAAGCTGG + Intronic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
951214070 3:20007165-20007187 TAAAGTATACAGGAGGGCCCGGG - Intronic
952723919 3:36561985-36562007 TAAAGCACACAGAAGGACACAGG + Intergenic
952858843 3:37795496-37795518 TAAATTCTACAGAAGCAGGCAGG + Intronic
953221094 3:40972278-40972300 TAGAGTAGGGAGAAGGATGCAGG - Intergenic
953414917 3:42710057-42710079 TAAAGTATAAAGATGGAGACAGG - Intronic
953589629 3:44239093-44239115 TAAAGTATACAGAAGGATGTGGG - Intergenic
955280182 3:57587411-57587433 TAAATTATACAAAAGCATGTAGG + Intronic
956116073 3:65920224-65920246 GAAAAAATACAGCAGGATGCAGG - Intronic
958201225 3:90317837-90317859 AAAACTAGACAGAAGCATGCTGG - Intergenic
958203224 3:90350095-90350117 AAAACTATACAGAAGCATTCTGG - Intergenic
959541711 3:107547638-107547660 GAAAGTACACAGAAGAGTGCCGG - Intronic
961228069 3:125271991-125272013 TACAGTGTACTGAAGGAAGCTGG - Intronic
962082413 3:132154594-132154616 TAGAGTTTTCAGAAGCATGCTGG + Intronic
963962844 3:151328864-151328886 CAAAGTATTCAGCAGGATGCCGG + Exonic
964813031 3:160686031-160686053 TAAAGTGTATAGGAGGATGTGGG - Intergenic
965687740 3:171323280-171323302 TAAAGATGACAGAAGTATGCTGG + Intronic
965997511 3:174902766-174902788 TAAAGTATACTCAAGGAGGGCGG + Intronic
969062690 4:4450598-4450620 TAATAAATACAGAAGGAGGCTGG - Intronic
971610142 4:28713689-28713711 TAAAGTATACAGAGGTATCATGG + Intergenic
972729414 4:41778847-41778869 CAAAATATACAGAAATATGCTGG + Intergenic
973018142 4:45166982-45167004 TAAGTTATACAGAAGGTTGGAGG - Intergenic
973655600 4:53044533-53044555 TAAAGTATATAGAAGGAGAAAGG - Intronic
973671306 4:53220955-53220977 TAAAGTAAACATCACGATGCAGG - Intronic
974198440 4:58607597-58607619 TAAAACATACAGAAGGAAGAAGG - Intergenic
974937032 4:68420720-68420742 TAGAGTATACAGAGGCAGGCAGG - Intergenic
975016181 4:69423828-69423850 TAAATTTTACAGTAGGAAGCAGG - Intergenic
975962345 4:79927496-79927518 TAAAGTATACAGGAATATGTAGG - Intronic
976886364 4:89989647-89989669 TAAAGTCAACAGAAGAATGTTGG + Intergenic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
979426891 4:120578833-120578855 TACAGTAGACAGTAAGATGCGGG - Intergenic
982869046 4:160552853-160552875 AAAAATATACAGAAGTAGGCAGG + Intergenic
983099454 4:163607125-163607147 CAAAGTATACAGATGGCTTCAGG - Intronic
983327722 4:166279574-166279596 ATAAGAATGCAGAAGGATGCAGG + Intergenic
983519631 4:168694166-168694188 TAAACTATATAGAAGTATGTAGG + Intronic
987452355 5:18101731-18101753 AGAAGTAGACAGAAGAATGCTGG - Intergenic
987683388 5:21165976-21165998 TATAGTATAAAGAACGAGGCCGG + Intergenic
987845945 5:23286137-23286159 TAAAGTATTCAAATGGAGGCAGG + Intergenic
988226157 5:28413337-28413359 TAAAGCAGATAGAAGAATGCTGG + Intergenic
988247500 5:28706466-28706488 TAAAGTTTGGAGAAGGATGATGG - Intergenic
988439013 5:31210687-31210709 TAAAGTATATGGGAGGATGTAGG - Intronic
989943466 5:50184944-50184966 AAAAGTAGACAGAAGCATTCTGG - Intergenic
991084325 5:62634685-62634707 TAAAGTATATTGAAGTAGGCTGG - Intergenic
991477350 5:67036588-67036610 TAAAGTATATAGGAGGATATGGG - Intronic
992373051 5:76164887-76164909 TAAAGTATACAGGAGGATGTGGG - Intronic
992629097 5:78663772-78663794 TAAAGTATACAGAAGGATGCTGG + Intronic
994630027 5:102274092-102274114 TAAAGTTTATAGGAGGATGTAGG + Intronic
995757848 5:115528988-115529010 GAAAATATACAGAAAGAAGCAGG + Intronic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
996628350 5:125598076-125598098 TATTGGATACTGAAGGATGCAGG - Intergenic
998970724 5:147589148-147589170 TAAAGAATCCAGCAGGAGGCCGG + Exonic
999355191 5:150921891-150921913 TAATATATACAGAAGAATGAAGG + Intergenic
999373831 5:151072628-151072650 AACAGTATAGAGAAGGCTGCAGG - Intronic
999967322 5:156823332-156823354 TTAATTATAAAGGAGGATGCAGG - Intergenic
1002514640 5:179748376-179748398 TAAAGTATACAGTAGTCGGCTGG - Intronic
1002815052 6:671829-671851 TGAAGGATACTGAAGGAAGCTGG - Intronic
1004948801 6:20645202-20645224 TAAAGTCTACAGTAGGGTGCAGG - Intronic
1005590455 6:27320037-27320059 TAAAGTATAGAGAAAAATGATGG - Intergenic
1005616420 6:27577526-27577548 TAAAAGATACAGAAAGAGGCCGG + Intergenic
1007492345 6:42233214-42233236 TAAAGTATACAGAAGGGAAATGG - Intronic
1009698254 6:67139121-67139143 TAAAGTACCTAGAAGAATGCAGG + Intergenic
1011771587 6:90679227-90679249 TAAAGTACACAGAATTGTGCTGG + Intergenic
1012260571 6:97082994-97083016 GAAAGTACACAGTAGGTTGCGGG - Intronic
1013832641 6:114292805-114292827 TAAAGTATACAGGAGGATATTGG - Intronic
1013834953 6:114323758-114323780 TAAAGTATACAGAGTTATCCGGG + Intronic
1015885734 6:137916140-137916162 TAAAATAAATAGAAGGAGGCAGG + Intergenic
1016396083 6:143624857-143624879 TAAAGTATAGTCAAGGAGGCCGG + Intronic
1017594504 6:156014227-156014249 TAAAATACACAGAAGTAAGCAGG - Intergenic
1018278202 6:162155922-162155944 TAAAGAATGCAAAAGGATGGAGG + Intronic
1018508981 6:164504680-164504702 TAAATTATAGAGAGGCATGCTGG + Intergenic
1021011343 7:15471444-15471466 TAAAGTAGAAAGAAAGATCCTGG - Intronic
1021363353 7:19745101-19745123 TAAAGTATATAGAAGAGTGTAGG - Intronic
1021681983 7:23142240-23142262 TAAAATATAGAGAAGGATGTGGG - Intronic
1024221187 7:47288567-47288589 TGAAGTGCCCAGAAGGATGCAGG - Intronic
1024285809 7:47756615-47756637 TAAAGTATATAACAGGAGGCAGG - Intronic
1024997676 7:55285950-55285972 TAAAGGAAACAGAATGAGGCAGG + Intergenic
1025309112 7:57905212-57905234 AAAAGTACACAGAAGCATTCTGG - Intergenic
1027776377 7:82470432-82470454 TAAAGTGTATAGGAGGAGGCTGG - Intergenic
1028022230 7:85791422-85791444 TGGAGTATACAGAAGCAGGCAGG - Intergenic
1028515087 7:91669538-91669560 CAAAGTACACAGAAGGATCAGGG - Intergenic
1030933246 7:115551819-115551841 TAAAGTATACCAGAGGATGTGGG - Intergenic
1032320217 7:130879481-130879503 TAGCATATACAGAAGGATGCAGG - Intergenic
1033663851 7:143422962-143422984 TGCAGTGTGCAGAAGGATGCAGG + Intergenic
1034110062 7:148528177-148528199 TAAACTATACAGAAAGATATCGG + Intergenic
1034118376 7:148604735-148604757 TAAAATAAACAGAAGAAGGCAGG + Intronic
1034120028 7:148618769-148618791 TGAAAGATACAGAAGGAAGCAGG + Intergenic
1034595395 7:152185050-152185072 TAAAGTATACAGGAGGGGCCAGG - Intronic
1035410253 7:158634237-158634259 TAAAGCATACAGGAGGATGTGGG - Intronic
1036037676 8:5037872-5037894 TAAAGTATACACAAGGATGTAGG - Intergenic
1037872071 8:22507671-22507693 TAAAATATGCAGAATAATGCTGG - Intronic
1038248310 8:25879685-25879707 TAAAGTTGACAGAAGGAACCTGG - Intronic
1038704060 8:29877656-29877678 TAAACTATACTGAAGGCTGGAGG + Intergenic
1039200152 8:35082328-35082350 AAAAGTATCCAGAAGAATACTGG - Intergenic
1039865751 8:41499874-41499896 TAAATCATACAGAAGCAGGCAGG - Intronic
1041684139 8:60627046-60627068 TAAAGTATACAGCAGGATGTGGG + Intergenic
1043978867 8:86615097-86615119 TAAAGTATACAGGAGGATGTGGG + Intronic
1044472186 8:92583115-92583137 TAAAGGATACAAAAGTTTGCAGG + Intergenic
1045338575 8:101231599-101231621 ATAATTATATAGAAGGATGCAGG + Intergenic
1046420613 8:113979093-113979115 GAAAGTAAACAGAAGGAAGTAGG - Intergenic
1047559524 8:125971593-125971615 TAAATTATGCAGCAGGATTCAGG + Intergenic
1048751191 8:137678366-137678388 TAAAATATACAGGAGGATATGGG + Intergenic
1056719828 9:89062159-89062181 TAATATATACATAAGGTTGCAGG + Intronic
1056952749 9:91057644-91057666 TACAGAATATAGAAGGATGAAGG - Intergenic
1057370198 9:94464535-94464557 TAGAGTATCCAGAAGGAAGAAGG + Intergenic
1061237171 9:129350012-129350034 TGATCAATACAGAAGGATGCAGG + Intergenic
1203381228 Un_KI270435v1:46562-46584 TAAACTAGACAGAAGCATTCTGG + Intergenic
1203357478 Un_KI270442v1:171857-171879 AAAACTATACAGAAGCATTCTGG + Intergenic
1203374891 Un_KI270442v1:361370-361392 AAAACTACACAGAAGGATTCTGG + Intergenic
1186213072 X:7270606-7270628 CAGAGTATACATAAAGATGCTGG + Intronic
1188728864 X:33620995-33621017 TAAACCATACAGACTGATGCAGG + Intergenic
1192498163 X:71630185-71630207 AAAAGGATAGAGAGGGATGCAGG - Intergenic
1195462693 X:105145432-105145454 TTGAGTACACAGAAGGAGGCAGG + Intronic
1196693755 X:118589110-118589132 TAAATCAGACAGATGGATGCTGG + Intronic
1198733771 X:139763602-139763624 TAAAGTATGCAGGAGGATTTTGG - Intronic
1198973034 X:142302834-142302856 TAATGTATAGAAAAGCATGCAGG - Intergenic
1200842793 Y:7800568-7800590 TGAAGTATACACAAGGGTTCAGG + Intergenic
1200956194 Y:8948644-8948666 TAGAGTCTACAGAAGCAGGCAGG + Intergenic
1201363287 Y:13176312-13176334 TAAAAAATACAGAAGCAGGCTGG - Intergenic
1201794153 Y:17876549-17876571 TACAGTCAACAGAAAGATGCTGG + Intergenic
1201807401 Y:18029436-18029458 TACAGTCAACAGAAAGATGCTGG - Intergenic
1201855964 Y:18542513-18542535 TAAACTACACAGGAGGATGTGGG + Intergenic
1201877357 Y:18777872-18777894 TAAACTACACAGGAGGATGTGGG - Intronic
1202333592 Y:23781140-23781162 TGATGTATACAGAAGCAGGCAGG + Intergenic
1202355535 Y:24044362-24044384 TACAGTCAACAGAAAGATGCTGG + Intergenic
1202515243 Y:25625747-25625769 TACAGTCAACAGAAAGATGCTGG - Intergenic
1202537177 Y:25888923-25888945 TGATGTATACAGAAGCAGGCAGG - Intergenic