ID: 992638887

View in Genome Browser
Species Human (GRCh38)
Location 5:78751632-78751654
Sequence TTCACCCGACTTCAAAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992638887 Original CRISPR TTCACCCGACTTCAAAGGGC AGG (reversed) Intronic
900904700 1:5546648-5546670 TTCACTCTTCTTCAAATGGCTGG - Intergenic
905263265 1:36733893-36733915 TTCACCTGACCTCAAAGTGTTGG + Intergenic
906147794 1:43570183-43570205 TTCATCAGGCTTCAAAAGGCTGG + Intronic
906892141 1:49728828-49728850 TTCAGGAGTCTTCAAAGGGCAGG + Intronic
921418493 1:214918805-214918827 TTCACCCCATTTTAAAGGGATGG + Intergenic
1073350276 10:102814595-102814617 GTCACCCGACTCAAAAGGGGTGG - Exonic
1078903368 11:15661955-15661977 TGCAAGCAACTTCAAAGGGCAGG - Intergenic
1084704055 11:70805516-70805538 GTCACCCGACATCTCAGGGCTGG + Intronic
1085042886 11:73337062-73337084 TTTACCCAGCTTCAAAGGGAGGG + Intronic
1087036363 11:93759758-93759780 TTCATCAGAGTTCAAGGGGCAGG - Exonic
1087673393 11:101130975-101130997 TTCACCGGGCATCAAATGGCAGG + Intergenic
1089047520 11:115516094-115516116 TTTACCCAACTTCAAAGACCAGG - Intergenic
1092193460 12:6535679-6535701 TTGACCCGACCCCAAAGGCCAGG + Intronic
1108838697 13:54584193-54584215 TTCACCTGGCTTCAAAAGTCAGG - Intergenic
1116855124 14:49945512-49945534 TTGACCTGAGTTTAAAGGGCTGG + Intergenic
1119964183 14:78895122-78895144 AATACCTGACTTCAAAGGGCGGG - Intronic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1126157213 15:45576801-45576823 TACACCCAACATCAAAGGGGTGG - Intergenic
1126634064 15:50765218-50765240 TTCGCCAGACTTCAATGGGCGGG + Intronic
1141321826 16:83018084-83018106 TTCACCACACTCCAAAGGCCAGG - Intronic
1147754635 17:42760636-42760658 TTCTCCCGACTCCAGAGGGCTGG + Intronic
1149306131 17:55348367-55348389 TTCATCTGACTTCAAAGCTCAGG + Intergenic
1163297300 19:16420760-16420782 CACAGCCGACTTCATAGGGCTGG - Intronic
936450055 2:112627100-112627122 TTCAAATAACTTCAAAGGGCAGG + Intergenic
939920135 2:148100066-148100088 TTCAACTGACTTCTAAGGGATGG - Intronic
944243664 2:197510202-197510224 TCCACCCGCCTCCAAAGTGCTGG + Intronic
945474850 2:210269267-210269289 TTCCCCCTACTTCAAAGGCTTGG + Intergenic
945865734 2:215172885-215172907 CTCAGCCGACTTCAAAGACCAGG + Intergenic
1168841399 20:912282-912304 TTGACCCCACATCAAAGGTCAGG + Intronic
1170788972 20:19491985-19492007 TTCACCCCTCTTCAAAGAGAAGG + Intronic
1172808802 20:37632576-37632598 ATCCCCCCACTTCAAAGGGGAGG - Intergenic
1174644774 20:52076323-52076345 TTCACCCTAATGCTAAGGGCAGG - Intronic
1181312013 22:21950006-21950028 TTATCCCCACTTCACAGGGCAGG + Intronic
953198742 3:40757452-40757474 TTCACCAGGCTTAAAAAGGCAGG - Intergenic
960096016 3:113690700-113690722 TGCACCGGACTTTAAAGGGTTGG - Intronic
973863669 4:55090576-55090598 TTCCCCTGATTTCAAAGTGCTGG + Intronic
976115646 4:81722988-81723010 CTCCCCCACCTTCAAAGGGCAGG + Intronic
977440921 4:97066472-97066494 TTCACCTGACCTGAATGGGCAGG + Intergenic
979779981 4:124638721-124638743 TACACACTTCTTCAAAGGGCTGG - Intergenic
980571657 4:134627580-134627602 TCCTCCCTGCTTCAAAGGGCAGG - Intergenic
983871256 4:172827260-172827282 TTCACCCTGCTTCATAGTGCAGG + Intronic
987393826 5:17402300-17402322 CTCACCCGCATTCAAAGAGCTGG - Intergenic
990946319 5:61253428-61253450 TTCACCCCAGGTCACAGGGCTGG + Intergenic
992638887 5:78751632-78751654 TTCACCCGACTTCAAAGGGCAGG - Intronic
993080833 5:83298171-83298193 TTCAACAAACTTCAAAGGACTGG - Intronic
994135405 5:96280892-96280914 TTCACCTGGCTTCAAAGTACAGG - Intergenic
997232957 5:132257366-132257388 TAAAAGCGACTTCAAAGGGCCGG + Intronic
1001648666 5:173300102-173300124 TTCACTCGACTAAAAAGGTCAGG - Intergenic
1001798983 5:174527008-174527030 TGCACCAGACTTCCAAGAGCTGG + Intergenic
1016187308 6:141212485-141212507 TCCTCCCCACTGCAAAGGGCAGG + Intergenic
1022866211 7:34423822-34423844 TTCACCCGACTCCCAAGGTGTGG - Intergenic
1023897186 7:44443717-44443739 TTCACAGGACTTCTAAGAGCTGG + Intronic
1028925362 7:96351560-96351582 TTCATCAGAATTCCAAGGGCAGG + Intergenic
1035322660 7:158043479-158043501 GTCACCTGACTTTAAAGGGTTGG + Intronic
1038324598 8:26563103-26563125 CCCACCCGAATTCAAAGGGAGGG + Intronic
1038977932 8:32721975-32721997 TTAACTGGACTTCAAAGAGCAGG + Intronic
1044248680 8:89981410-89981432 ATCCCCCGACTTCAAAGTTCGGG + Exonic
1044968722 8:97598902-97598924 TTCTGCCGATTTAAAAGGGCTGG + Intergenic
1188872613 X:35392085-35392107 TTCATCCAAGTTCAAATGGCTGG - Intergenic
1190800000 X:53778990-53779012 TTCACCCCAGTTAAAAAGGCAGG - Intergenic