ID: 992639372

View in Genome Browser
Species Human (GRCh38)
Location 5:78755597-78755619
Sequence CATCTGTTGAAGAGCACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992639372 Original CRISPR CATCTGTTGAAGAGCACAAA TGG (reversed) Intronic
902887042 1:19412874-19412896 CATCTGTTGAACAGGATAACTGG - Intronic
904241336 1:29148038-29148060 CATCAATTCAAGAGCAAAAATGG + Exonic
906721915 1:48012920-48012942 CATCTGTTGAAATGATCAAATGG + Intergenic
906934449 1:50200170-50200192 CATCTGTTTAATAGCAAGAAAGG + Intronic
908983959 1:69994251-69994273 CATTTGCTGAAGAATACAAAAGG + Intronic
910972409 1:92869509-92869531 CAACTTTTGAAGAGAATAAAAGG + Intronic
912272623 1:108226570-108226592 CAGCTGTTGGAGAGAACAAATGG + Intronic
912295596 1:108467752-108467774 CAGCTGTTGGAGAGAACAAATGG - Intronic
912516394 1:110219130-110219152 CATCTGTAAAACAGCAGAAATGG + Intronic
914936747 1:151988377-151988399 CCTCTGCTGAAGAGCTCTAATGG + Intronic
915442161 1:155951984-155952006 CATCTGTTGAGAAGGAGAAAAGG + Exonic
916857118 1:168761407-168761429 CACCTGTGGCAGAGCACAGAAGG - Intergenic
918149606 1:181786913-181786935 CATCTTTGGAAGAGAAGAAAAGG + Intronic
918392749 1:184083574-184083596 CTTCTGTTGATGACCACAGATGG + Intergenic
921785569 1:219225404-219225426 CATTTTTTAAAGATCACAAAAGG - Intergenic
922679493 1:227579931-227579953 CAGCTGATGCAGAGCCCAAAGGG - Intronic
923166201 1:231365165-231365187 TCTCTGTTGAAGAGCATCAAGGG - Exonic
923409553 1:233693502-233693524 CCTCACTTGAAGAGAACAAAAGG - Intergenic
1064798288 10:19039086-19039108 CTGCTGTTGATGAGCACACAGGG - Intergenic
1064907933 10:20368259-20368281 CAGCAGTTAAAGAGGACAAAGGG - Intergenic
1065579630 10:27157138-27157160 CAGGTGGAGAAGAGCACAAAAGG - Intronic
1068088402 10:52402996-52403018 CCTCTGTTCAACAGCACACAAGG + Intergenic
1068756743 10:60663476-60663498 CATCTGCTTAAGAGCACGAAGGG + Intronic
1070763499 10:79041976-79041998 TATCTATTGAAGAGCAAAGAAGG + Intergenic
1079520650 11:21322411-21322433 CACATCTTGAAGAGGACAAATGG - Intronic
1082079598 11:48001999-48002021 CTTCTGTTGATGAGAACTAAGGG + Intronic
1082939648 11:58690737-58690759 CATCTATTGAAGAGCATAGTTGG - Intronic
1084232644 11:67764296-67764318 CATCTGTACAGGAGCTCAAATGG - Intergenic
1084567119 11:69937005-69937027 CAGTTACTGAAGAGCACAAATGG + Intergenic
1085598517 11:77832803-77832825 CTGCTGTTACAGAGCACAAATGG - Intronic
1086908356 11:92443271-92443293 CAGCTGTTGAGGAGCAGCAATGG + Intronic
1090118876 11:124003455-124003477 CATCTGTTGATGAGCACTTAGGG + Intergenic
1093227601 12:16504286-16504308 CAGCTCTTGAAAATCACAAAAGG + Intronic
1094085974 12:26591994-26592016 CATCTGTTGATGGGCACTTAAGG - Intronic
1094721277 12:33067125-33067147 CATCTGTTGAGATGAACAAATGG - Intergenic
1095373303 12:41495945-41495967 CAGCTCTGCAAGAGCACAAAGGG - Intronic
1096463247 12:51834422-51834444 CTTCTGTGGGAGAGGACAAAAGG + Intergenic
1097347184 12:58506368-58506390 CATCTGGGGTAGAGCACACATGG + Intergenic
1098743785 12:74208897-74208919 CATCTGTGAAAGAGAAAAAAAGG + Intergenic
1099749149 12:86749289-86749311 CATCTGTTGAAGTACTCAAGAGG - Intronic
1101016061 12:100501806-100501828 CATCTATTGATGTGGACAAATGG + Intronic
1109759394 13:66807489-66807511 CATCTTTTGAAGAACAAAAATGG - Intronic
1110557164 13:76872937-76872959 CATCTGTTGATGAACACTTAGGG - Intergenic
1111557155 13:89895485-89895507 AGACTATTGAAGAGCACAAAAGG - Intergenic
1112060021 13:95729446-95729468 CATCTGTAGATGAGCACATTTGG + Intronic
1112508267 13:99988443-99988465 CATCTGGGGAAGAACAAAAAGGG + Intergenic
1112994631 13:105558256-105558278 CAACTGTTAAGTAGCACAAATGG + Intergenic
1114995643 14:28348709-28348731 CAGCTGTTAAAGAGTACAAAGGG - Intergenic
1117310124 14:54512982-54513004 CATATGTTGAAGAACTGAAAAGG - Intronic
1118941111 14:70339097-70339119 CATCTGTTACAAAGCACAACAGG + Intronic
1119127838 14:72144695-72144717 CAACTGTAGAAGAGCAGGAATGG - Intronic
1121667188 14:95681459-95681481 GATGTGTTCCAGAGCACAAAGGG - Intergenic
1127319208 15:57826319-57826341 CATCTCTTGAAGCGACCAAATGG - Intergenic
1127998065 15:64166207-64166229 CATCTTTTTAAGAGTACAATGGG + Exonic
1129586945 15:76876653-76876675 CATCTGTTGATGTGAACACAAGG - Intronic
1130517307 15:84635864-84635886 TCTCTGTTGAAGAGCATCAAGGG + Intergenic
1130858395 15:87862787-87862809 CAGCTGTTAAAGAGCACTCAGGG + Intronic
1132010463 15:98271113-98271135 CATCCCTAGAAAAGCACAAAGGG + Intergenic
1132044530 15:98552213-98552235 CATCTGTTTAGGAGCTCAGAGGG - Intergenic
1133068835 16:3232045-3232067 CATCTATTGAACATCAAAAAGGG + Intronic
1139933618 16:70550630-70550652 CACCTGTGGAAGAGAAAAAAAGG - Intronic
1144793533 17:17875573-17875595 CCTCTGTTGAGGACCAGAAATGG - Intronic
1150993185 17:70284661-70284683 CATCTGTTGATGGGCACATGGGG + Intergenic
1151320915 17:73351969-73351991 CATGTCTTGGAGCGCACAAAGGG - Intronic
1153069993 18:1094672-1094694 CAACTATTGAAGAGCCAAAAAGG - Intergenic
1153430836 18:5015341-5015363 CATTTCTTGAAGAGCATTAAAGG - Intergenic
1156534281 18:37847811-37847833 CTTCTGGTAAAGTGCACAAAAGG - Intergenic
1158277756 18:55786999-55787021 CATCTGATGGGGAGCACAATGGG - Intergenic
1159268000 18:66109939-66109961 TCTCTGTTGTAGTGCACAAAGGG + Intergenic
1160431758 18:78818077-78818099 CATTTCATGAAGAGCACGAAAGG - Intergenic
1163751371 19:19080210-19080232 CATCTGGTGAAGAGCAGAGTGGG + Intronic
926453155 2:13031269-13031291 CGTCTGTTGAAGTTTACAAAAGG + Intergenic
926775234 2:16415797-16415819 CATTTGTTGAATGGCACAAATGG - Intergenic
927240692 2:20917481-20917503 CATCTGGTCAAAAACACAAATGG - Intergenic
929084270 2:38152743-38152765 CGTCTGTTGACGTGCACATAAGG - Intergenic
930103734 2:47623100-47623122 CATCTGTTGATGGACACCAAGGG + Intergenic
930790525 2:55322600-55322622 TATCTGGTGAAGACAACAAATGG - Exonic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
933225323 2:79741982-79742004 CATGGGTGGAAGAGCACAAAGGG - Intronic
935833426 2:107024132-107024154 CATCTGTGGTAGAGCGCACAGGG + Intergenic
937174262 2:119911399-119911421 CATCTATTGAAATGCTCAAATGG - Intronic
937235039 2:120425777-120425799 CATCTTTTGGAGAGAAGAAATGG - Intergenic
937750083 2:125466467-125466489 AATCTATTGAAAAGTACAAATGG - Intergenic
938760290 2:134419182-134419204 CTTCAGTTGAAGAGAAGAAAAGG + Intronic
940108456 2:150124505-150124527 CATCTGTGGAAGAGCTGTAATGG - Intergenic
941737822 2:168999143-168999165 CATTTGTTGAATAGCAAAGAAGG + Intronic
942285777 2:174414365-174414387 CATCTCTGGAAGAACACATAAGG - Intronic
942535835 2:176962475-176962497 CATTTGTTGAATTACACAAAGGG - Intergenic
942580084 2:177408803-177408825 CATCTGTTGAATAGCCACAAAGG - Intronic
945027655 2:205634442-205634464 CATATGTTACATAGCACAAAGGG + Intergenic
945334591 2:208577664-208577686 CATCTCTTGAAGAACATTAAAGG + Intronic
946522189 2:220478525-220478547 CATCTATAGATGAGAACAAAGGG - Intergenic
947219762 2:227781071-227781093 GATCTGTTAAAGAACAAAAAAGG + Intergenic
947887567 2:233585926-233585948 CCTCTGGTGAAGACCACAGAGGG - Intergenic
1171844816 20:30260894-30260916 CATTTGTTGAAGCCCATAAATGG + Intergenic
1173686348 20:44926182-44926204 CATCTTTTTAACAGGACAAACGG + Intronic
1176348938 21:5774557-5774579 AATCTGATGAAGGGCAGAAATGG + Intergenic
1176355752 21:5895141-5895163 AATCTGATGAAGGGCAGAAATGG + Intergenic
1176543259 21:8172627-8172649 AATCTGATGAAGGGCAGAAATGG + Intergenic
1176562210 21:8355672-8355694 AATCTGATGAAGGGCAGAAATGG + Intergenic
1177106538 21:16963217-16963239 CATCTGTTGAAGAGGTCATATGG + Intergenic
1179342613 21:40526672-40526694 CCTCTGTTGAAGTGCCCTAATGG - Intronic
1185238989 22:49731210-49731232 CAAGTGTTGACGAGCACAGAGGG - Intergenic
1203248128 22_KI270733v1_random:88846-88868 AATCTGATGAAGGGCAGAAATGG + Intergenic
949793175 3:7816021-7816043 CATCTGTTAATGAGGACAAAAGG - Intergenic
954771768 3:52976951-52976973 TATCAGTTCAGGAGCACAAATGG + Intronic
957334819 3:78814120-78814142 AAGCTGTTGAAGAGTAAAAAAGG - Intronic
959929641 3:111965401-111965423 GTTCTGTTGAAGAGAACACAGGG - Intronic
960387260 3:117035392-117035414 CAGCTTTTGGAGACCACAAAAGG + Intronic
960826128 3:121786614-121786636 TCTCTGTTTAAGAGCAAAAAGGG - Intronic
964428249 3:156575935-156575957 CATCCATTCAAGAGCAGAAAGGG - Intergenic
965152834 3:165004537-165004559 CATCTGTTGATGGACACTAAAGG - Intronic
969236618 4:5869915-5869937 CATCTGAGGAAGTGCACAGAAGG + Intronic
969662281 4:8537285-8537307 AATCGGTTGCAGAGGACAAAGGG + Intergenic
974854866 4:67448681-67448703 CAACTTTTCAACAGCACAAAAGG + Intergenic
975025839 4:69547543-69547565 CATCTGCTGAAGGCCATAAAAGG - Intergenic
976781976 4:88770311-88770333 AATCTGTTGAAGATTACCAATGG - Intronic
976785915 4:88820940-88820962 ATTCTGTTTAAGAGCACCAAGGG - Intronic
978019639 4:103791608-103791630 CATCTGTTGAAAAGGAACAAAGG - Intergenic
978707825 4:111736842-111736864 CATCTGTTGAAAAGCTTAACAGG + Intergenic
980432283 4:132717828-132717850 AATGTGTTGCAGAGAACAAAGGG - Intergenic
984250866 4:177332794-177332816 CACCTGTGGCAGAGCACAAGAGG - Intronic
984394465 4:179177055-179177077 CAACTGTTGATGAACACAAGCGG + Intergenic
988666192 5:33330501-33330523 CATCTGTGGAATTGGACAAAAGG + Intergenic
992639372 5:78755597-78755619 CATCTGTTGAAGAGCACAAATGG - Intronic
993307928 5:86293418-86293440 CAGCTGTTGGAGAGAACAAATGG - Intergenic
994123896 5:96149139-96149161 GTTCTGCTGAAGAGCACAGAAGG + Intergenic
995028908 5:107457130-107457152 CATCTGTTAAAAATGACAAAAGG - Intronic
996801735 5:127411020-127411042 CATCTGTGGAAGAAAAAAAAAGG + Intronic
996967956 5:129328191-129328213 CATATTTTGTAAAGCACAAATGG - Intergenic
997132396 5:131290224-131290246 CAATTTTAGAAGAGCACAAAAGG + Intronic
997217283 5:132123352-132123374 CATCTGTGGCAGAACACAAAAGG + Intergenic
998484196 5:142487341-142487363 CATCTCTTGAAGATGAGAAAAGG + Intergenic
999063657 5:148661445-148661467 TATCTGTTGGAGACCCCAAAGGG - Intronic
999649370 5:153750351-153750373 CATTTGAAGAAGAGGACAAAGGG + Intronic
1001400553 5:171443973-171443995 GATCTGATGAAGAGGAGAAAAGG - Intronic
1002332173 5:178450792-178450814 CATCTGTAAAACAGGACAAATGG - Intronic
1004013769 6:11713461-11713483 CATTTTTTAAAGAACACAAATGG - Intronic
1012016438 6:93857926-93857948 CACGTGTTGAAGAGAAGAAAAGG - Intergenic
1013407542 6:109856823-109856845 CATCTATACAAGAGCTCAAATGG + Intergenic
1014243571 6:119043277-119043299 CACCTGTGGCAGAGCACAGAAGG + Intronic
1016741153 6:147530452-147530474 TATATGCTGAGGAGCACAAAGGG + Intronic
1017299736 6:152842921-152842943 CATCTGTTGATGGGCATAATAGG - Intergenic
1017353487 6:153473227-153473249 AATAGGTTGAAGGGCACAAAGGG + Intergenic
1018439163 6:163793322-163793344 CATCTTTTGAACACAACAAAAGG - Intergenic
1019825480 7:3280712-3280734 CATCTGTTAGAGAGGCCAAAAGG - Intergenic
1020688768 7:11328678-11328700 CATCTGTTTGAAATCACAAAAGG + Intergenic
1020951737 7:14687795-14687817 CATCCTTTGAAGAGCACATATGG + Intronic
1022657070 7:32329394-32329416 TCTCTGTTGAAGAGTACACAGGG - Intergenic
1024620352 7:51151794-51151816 CATTTCTTCAAGAGCAGAAAGGG + Intronic
1027006732 7:74700445-74700467 CAACTGTTGATGGGTACAAAGGG - Intronic
1027007869 7:74711318-74711340 CATCCTTTTAAGAACACAAATGG - Intronic
1028690515 7:93644493-93644515 CATCTATTCAGGAGCTCAAATGG - Intronic
1030153321 7:106427305-106427327 CATTTGCTGAAGAGAAAAAAAGG - Intergenic
1030294916 7:107913964-107913986 CATCTGTTGAAGTGATCATATGG + Intronic
1031329988 7:120452728-120452750 CAGCTAGTGAAGAGCACAGAGGG + Intronic
1032965966 7:137098137-137098159 CATATGTAGAAGAGCAAAACTGG + Intergenic
1033531821 7:142271810-142271832 CAACCGTTGAAGAAAACAAAAGG - Intergenic
1033813730 7:145047850-145047872 CATCTGTTGATGGACACTAAGGG + Intergenic
1036638972 8:10570307-10570329 CATCTGTGGAATTGCACACAGGG + Intergenic
1037529855 8:19762251-19762273 AATCTATAGAAGAGAACAAAAGG + Intergenic
1039515902 8:38133344-38133366 TATCTGTTGTAGAGCTCAAGGGG + Intronic
1042155101 8:65836494-65836516 CATCTTTTGAAATTCACAAAAGG - Intronic
1042694304 8:71539464-71539486 CATCTGTTGCTGAGCAGAATGGG + Intronic
1043264785 8:78250944-78250966 AATCTGTTGAAGAGCTCTCATGG - Intergenic
1043347204 8:79312649-79312671 AATTTGTTTAAGATCACAAAGGG - Intergenic
1044134381 8:88567231-88567253 CATATATTGAAGGCCACAAAGGG + Intergenic
1044513772 8:93114775-93114797 CATCTGCTAAAATGCACAAAGGG + Intergenic
1044602738 8:94021946-94021968 TGTCTTTTGATGAGCACAAATGG - Intergenic
1047128123 8:121985862-121985884 CAGCTCTTTAAGAGCAGAAATGG + Intergenic
1049115158 8:140679902-140679924 CATCTTTAGGAAAGCACAAAAGG + Intronic
1051351106 9:16198649-16198671 CAGCTGTGGAAGAGCAGAAAAGG - Intergenic
1053058405 9:35008329-35008351 CATCTATACAAGAGCTCAAATGG - Intergenic
1053550218 9:39070261-39070283 CATCTGTTGATGAACACTTAGGG - Intergenic
1053814328 9:41890372-41890394 CATCTGTTGATGAACACTTAGGG - Intronic
1054616268 9:67297068-67297090 CATCTGTTGATGAACACTTAGGG + Intergenic
1055766380 9:79667910-79667932 CAACTGTGGAAGTGCATAAAAGG - Intronic
1056079928 9:83081567-83081589 CATCTGAGGAAGACCACATAAGG + Intergenic
1057507672 9:95649115-95649137 AATCAGGTGAAGAGCAAAAAAGG - Intergenic
1062442116 9:136575517-136575539 GATCTGTGGAAGATCACAAAAGG + Intergenic
1203464530 Un_GL000220v1:72097-72119 AATCTGCTGAAGGGCAGAAATGG + Intergenic
1185765120 X:2719153-2719175 CATCAGTTGCGGAGCACATATGG + Intronic
1188261040 X:28024585-28024607 CATCTGATTAATAGAACAAAGGG - Intergenic
1188933601 X:36145750-36145772 TATCTTTTGAAGACCACATATGG - Intergenic
1189634885 X:42996532-42996554 CATCTGTGGAAGAGAATAATAGG - Intergenic
1194054044 X:89109053-89109075 CATATGTTGCAAAGCAAAAATGG - Intergenic
1194893944 X:99415788-99415810 CATCTGTTGAAGATCTCTGATGG + Intergenic
1196497246 X:116335764-116335786 CATCTATACAAGAGCTCAAATGG - Intergenic
1200070396 X:153526224-153526246 CATCTGTCCATGAGCACAGAGGG + Intronic