ID: 992641842

View in Genome Browser
Species Human (GRCh38)
Location 5:78774465-78774487
Sequence CTCCCATGGCACCAGGGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992641837_992641842 -8 Left 992641837 5:78774450-78774472 CCATCCTGGCGGTGGCTCCCATG No data
Right 992641842 5:78774465-78774487 CTCCCATGGCACCAGGGCAAAGG No data
992641832_992641842 8 Left 992641832 5:78774434-78774456 CCGCTCTCCTCTTCTGCCATCCT No data
Right 992641842 5:78774465-78774487 CTCCCATGGCACCAGGGCAAAGG No data
992641831_992641842 19 Left 992641831 5:78774423-78774445 CCAGGGAGTTGCCGCTCTCCTCT No data
Right 992641842 5:78774465-78774487 CTCCCATGGCACCAGGGCAAAGG No data
992641830_992641842 20 Left 992641830 5:78774422-78774444 CCCAGGGAGTTGCCGCTCTCCTC No data
Right 992641842 5:78774465-78774487 CTCCCATGGCACCAGGGCAAAGG No data
992641835_992641842 1 Left 992641835 5:78774441-78774463 CCTCTTCTGCCATCCTGGCGGTG No data
Right 992641842 5:78774465-78774487 CTCCCATGGCACCAGGGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992641842 Original CRISPR CTCCCATGGCACCAGGGCAA AGG Intergenic
No off target data available for this crispr