ID: 992645668

View in Genome Browser
Species Human (GRCh38)
Location 5:78808804-78808826
Sequence GATGCTGGAGGGACACAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 534}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992645656_992645668 8 Left 992645656 5:78808773-78808795 CCTCCACTGGTGCCCCCACCCTG 0: 1
1: 0
2: 5
3: 51
4: 490
Right 992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG 0: 1
1: 0
2: 6
3: 61
4: 534
992645661_992645668 -7 Left 992645661 5:78808788-78808810 CCACCCTGTTTGCAGTGATGCTG 0: 1
1: 0
2: 2
3: 31
4: 356
Right 992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG 0: 1
1: 0
2: 6
3: 61
4: 534
992645663_992645668 -10 Left 992645663 5:78808791-78808813 CCCTGTTTGCAGTGATGCTGGAG 0: 1
1: 0
2: 0
3: 25
4: 197
Right 992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG 0: 1
1: 0
2: 6
3: 61
4: 534
992645660_992645668 -6 Left 992645660 5:78808787-78808809 CCCACCCTGTTTGCAGTGATGCT 0: 1
1: 0
2: 1
3: 12
4: 152
Right 992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG 0: 1
1: 0
2: 6
3: 61
4: 534
992645657_992645668 5 Left 992645657 5:78808776-78808798 CCACTGGTGCCCCCACCCTGTTT 0: 1
1: 0
2: 0
3: 29
4: 255
Right 992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG 0: 1
1: 0
2: 6
3: 61
4: 534
992645658_992645668 -4 Left 992645658 5:78808785-78808807 CCCCCACCCTGTTTGCAGTGATG 0: 1
1: 0
2: 0
3: 18
4: 288
Right 992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG 0: 1
1: 0
2: 6
3: 61
4: 534
992645659_992645668 -5 Left 992645659 5:78808786-78808808 CCCCACCCTGTTTGCAGTGATGC 0: 1
1: 0
2: 1
3: 11
4: 162
Right 992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG 0: 1
1: 0
2: 6
3: 61
4: 534
992645655_992645668 12 Left 992645655 5:78808769-78808791 CCTGCCTCCACTGGTGCCCCCAC 0: 1
1: 0
2: 2
3: 72
4: 522
Right 992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG 0: 1
1: 0
2: 6
3: 61
4: 534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992645668 Original CRISPR GATGCTGGAGGGACACAGGA TGG Intronic
900532032 1:3159169-3159191 GAGGCTGGAGGTACACAGGGCGG + Intronic
900549588 1:3247571-3247593 GAAGCTGAAGGGGCGCAGGAAGG - Intronic
900587380 1:3439797-3439819 GAGGCAGGAGGGCCCCAGGAAGG - Intergenic
900741613 1:4333609-4333631 GTTGTTGGAGGGGCCCAGGAAGG + Intergenic
900932857 1:5747725-5747747 GATGGAGGAGGGAGAAAGGAAGG + Intergenic
900932910 1:5747876-5747898 GAGGCAGGAGGGAGAAAGGAAGG + Intergenic
900993140 1:6107010-6107032 GATGATGGAGGGATAATGGAGGG + Intronic
901574857 1:10192605-10192627 GCTGGAGGAGAGACACAGGAAGG - Intergenic
902188928 1:14746990-14747012 GAGGCTGGGGGGACAAGGGATGG - Intronic
903186685 1:21633255-21633277 GAGGCTGGAGGGAGTCAGCAGGG - Intronic
904493074 1:30872014-30872036 AATGCTGGAGGGAAACAGGCAGG - Intronic
904539927 1:31225892-31225914 CATGCTGGTGGGACACTGGGTGG + Intronic
906049081 1:42855778-42855800 GGTGCTGGGGGAACACAGGTGGG + Intergenic
906323402 1:44830027-44830049 GAGCCTGGAGGGGAACAGGAGGG + Exonic
907048517 1:51314565-51314587 GATCCTTGAGGGTCAAAGGAAGG + Intronic
907326922 1:53644263-53644285 GAGGCTGGAGGTGGACAGGATGG - Intronic
907987995 1:59552077-59552099 CAGGCTGGAGGGACTAAGGAGGG + Intronic
908394962 1:63716961-63716983 GAATTTGGAGGGACCCAGGAAGG + Intergenic
909275367 1:73678381-73678403 GATGCTGGAAGTACACACAAAGG + Intergenic
909289513 1:73864603-73864625 GAGGCTGGAGGGTGACAGGAGGG + Intergenic
910257896 1:85267079-85267101 GATACTGGAGGAACACTTGATGG - Exonic
910449608 1:87331884-87331906 GCTGCTGGAAGGAAACAGCAGGG - Intronic
912308548 1:108595749-108595771 CATGCTGGAGGGAGAGAGGAAGG + Intronic
912331984 1:108828341-108828363 GCTGCAGGTGGGCCACAGGAAGG - Intronic
912450537 1:109765140-109765162 GAAGCTGAAGGGCCACAAGATGG - Intronic
912684160 1:111748930-111748952 GATGCGGGAGGATCAAAGGAGGG + Intronic
913015871 1:114733878-114733900 GGTGGTGGGGGGACAGAGGAAGG + Intronic
913198601 1:116477915-116477937 GGTGGTGGATGGACACAGGGAGG - Intergenic
915602195 1:156929456-156929478 GGTGCTGGACGGACAGGGGAGGG + Intronic
915701695 1:157802593-157802615 GGTGATGGAGGGAGACAGGCTGG - Exonic
915922507 1:159987286-159987308 GATGTTGGAGAGAGACTGGAAGG + Intergenic
916402645 1:164465796-164465818 GGAGATGGAGGGACAGAGGAAGG + Intergenic
916448459 1:164895510-164895532 GAGGCTGCAGGGACAAGGGAGGG + Intronic
919902840 1:202056901-202056923 GGTGCTTGAGGAACACAGAAGGG - Intergenic
921107926 1:212001611-212001633 GATTCTGCAGGAAAACAGGAGGG - Intronic
921412219 1:214847914-214847936 GACTCTGGAGGGAGAAAGGAGGG + Intergenic
922206779 1:223455074-223455096 AATGCTGGCTGGTCACAGGAAGG + Intergenic
922914326 1:229243340-229243362 GAGGAAGGAGGGAGACAGGAGGG + Intergenic
923034925 1:230279104-230279126 GGTGCTGCTGGGACCCAGGAAGG - Intronic
1062811255 10:467803-467825 GGTGCTGGAGGACTACAGGAGGG + Intronic
1062847496 10:718483-718505 GTTACTGGATGGACACAGAAGGG - Intergenic
1063123984 10:3124177-3124199 GCTACTGGTGGGACACAGGGCGG - Intronic
1063161325 10:3420919-3420941 GATGCAGGTGGGACGCAGGTAGG + Intergenic
1063161344 10:3421007-3421029 GGTGCGGGTGGGACACAGCAGGG + Intergenic
1064534183 10:16341866-16341888 GATGCTGAAGTGACAGAGGTGGG - Intergenic
1065075472 10:22074477-22074499 GAGGGTTGAGGGACAGAGGAAGG - Intergenic
1066309981 10:34186694-34186716 GAGGCTGACGGGTCACAGGATGG - Intronic
1067081575 10:43215477-43215499 GATCCTGGTGGGCCTCAGGAGGG + Intronic
1067142949 10:43671437-43671459 GATGCTGGAGAGACAGAGAAGGG - Intergenic
1067191359 10:44070801-44070823 GATGCTGCACAGACACAGGGAGG + Intergenic
1067380975 10:45773035-45773057 GAGGCAGGAGGGACAGAGGCTGG + Intronic
1067740305 10:48890506-48890528 GATTCTTGGGGGAAACAGGAGGG - Intronic
1067888674 10:50113674-50113696 GAGGCAGGAGGGACAGAGGCTGG + Intronic
1069959767 10:72072825-72072847 GGGTGTGGAGGGACACAGGAGGG + Intronic
1070363570 10:75714360-75714382 GACGCTGGATGTGCACAGGAGGG - Intronic
1070685193 10:78475409-78475431 GATGCTGGATGGTCACTTGACGG + Intergenic
1071397462 10:85237999-85238021 GACTCTGGAGGTACACAGGGAGG + Intergenic
1071489716 10:86128086-86128108 GCTGCTGGTGGCACAGAGGAAGG - Intronic
1072296021 10:94010125-94010147 GATGCAAGTGTGACACAGGATGG - Intronic
1072317818 10:94220927-94220949 GAAGCTGGAGGGAGGCAGCACGG - Intronic
1073472289 10:103730402-103730424 GGGGCTGGAAGGACACAGGTGGG - Intronic
1073626834 10:105106726-105106748 GATGAGGGAGTGAAACAGGAAGG + Intronic
1074300481 10:112228672-112228694 GAGGCTGCAGTGACACATGATGG + Intergenic
1074997691 10:118772035-118772057 GAAGCTGAAGGGATACAAGAAGG + Intergenic
1075191507 10:120313654-120313676 GATGAGGGAAGAACACAGGAAGG - Intergenic
1075409252 10:122215253-122215275 GGTGCTGGAGTGACAGAGGTGGG + Intronic
1075503028 10:122995495-122995517 GATGCATGAAGCACACAGGAAGG + Intronic
1075670835 10:124263116-124263138 GATTCTGGAGAGACACAGGCAGG - Intergenic
1075798285 10:125136176-125136198 GGGGCTGGAGGGACCCAGGCAGG + Intronic
1077159344 11:1105635-1105657 GAGGCAGGAGGGAGGCAGGAGGG - Intergenic
1077216492 11:1397296-1397318 GAGGCTGCAGGGACAAAGCACGG + Intronic
1077306195 11:1869703-1869725 GATGCTGGAGGAACGCAGTGAGG + Intronic
1077312973 11:1900122-1900144 GAAGCTTCAAGGACACAGGAAGG + Intergenic
1077560493 11:3257424-3257446 GATGCAGGTGGGACTCAGGCAGG - Intergenic
1077560550 11:3257677-3257699 GATGCAGGTGGGACTCAGGTAGG - Intergenic
1077560570 11:3257776-3257798 GATGCAGGTGGGACTCAGGTGGG - Intergenic
1077560579 11:3257820-3257842 GATGCAGGTGGGACTCAGGTGGG - Intergenic
1077566389 11:3303241-3303263 GATGCAGGTGGGACTCAGGCAGG - Intergenic
1077566449 11:3303516-3303538 GATGCAGGTGGGACTCAGGTAGG - Intergenic
1078730503 11:13969831-13969853 AATGCTGGAGGGAAACTAGAAGG - Intronic
1080623587 11:34008224-34008246 GAAGCTGGTGGGACACTGGTGGG + Intergenic
1081532441 11:43971643-43971665 GAGGCTGGAAAGACATAGGAGGG + Intergenic
1083506883 11:63166209-63166231 GATGCTGGAGGTGCAAAGTAAGG + Exonic
1083728146 11:64639070-64639092 GATGCTGCAGGCACACAGGCAGG - Intronic
1083997279 11:66278592-66278614 GGAGCTGGAGGGACCCAGGGCGG + Intronic
1084553731 11:69863988-69864010 GAAGCCGGAGGGAGCCAGGATGG - Intergenic
1085272924 11:75281018-75281040 GGTGAGGGAGGGAGACAGGATGG - Intronic
1085300046 11:75452637-75452659 GCTGCTGGAGGGACAGAGGCTGG + Intronic
1085412884 11:76301994-76302016 GAAGCTGGAGGGAGAGAAGAGGG - Intergenic
1086144977 11:83541710-83541732 CATGCTGGAGGGAGACAGTGAGG - Exonic
1086428921 11:86716589-86716611 GAGGGTGGAGGGACCCAGAAAGG + Intergenic
1087070536 11:94075368-94075390 AATGCTGATGGGACACAGGTAGG + Exonic
1088888320 11:114024959-114024981 TATGCTGGATGGACCCAGGAGGG + Intergenic
1089368020 11:117932734-117932756 CAGCCTGGAGGGACCCAGGACGG - Intergenic
1090664130 11:128903770-128903792 CATGCTGGAGGGGAGCAGGAGGG + Intronic
1090777350 11:129977141-129977163 TCTGCTGGAGGGACTCAGGCTGG - Intronic
1090781149 11:130007796-130007818 GAAGCTGGAAGGAGATAGGAAGG + Intergenic
1091057895 11:132436020-132436042 GAAGCTTGAGGGACTCAGGAGGG - Intronic
1091206447 11:133824491-133824513 GATGCAGGAAGGACTCAGGAAGG - Intergenic
1092093478 12:5823032-5823054 GTTGTGGGAGGGACACAGGGTGG - Intronic
1092229601 12:6769223-6769245 GGAGGCGGAGGGACACAGGAGGG + Intronic
1092238064 12:6822016-6822038 GAACCTGGAGGGGGACAGGAGGG + Intronic
1092542273 12:9427365-9427387 GAAGATGGAGTGACACAGCAAGG + Intergenic
1092600276 12:10053490-10053512 GATATTGGAGGGACAGAGCATGG - Intronic
1096107199 12:49003287-49003309 GATTCTGGGGAGACAGAGGAAGG + Exonic
1096192112 12:49626440-49626462 TATCCTGAAGGGACACAGGTAGG + Intronic
1097107259 12:56633153-56633175 GGTGCTGCAGGAACACAGGGAGG - Intronic
1097129727 12:56803136-56803158 CCTGCTTGAGGGACGCAGGAGGG - Intergenic
1097610695 12:61816166-61816188 GATGGTGGAGGGTGAGAGGAGGG - Intronic
1097855645 12:64459035-64459057 GATTCTGGAGTGAGAGAGGAGGG + Intronic
1098405378 12:70120680-70120702 GATGCTGCAGACACAGAGGAGGG - Intergenic
1101748717 12:107564957-107564979 TATGCTGGAAGGATACAGGAGGG + Intronic
1102029005 12:109729354-109729376 CATGCTGGGGGGTCTCAGGACGG + Intronic
1103011293 12:117460444-117460466 GATACTGGAGGGACCCAGGAGGG + Exonic
1103058916 12:117843215-117843237 GATGAAGGAGGGAGAGAGGAAGG + Intronic
1103465444 12:121138783-121138805 GCTCCTGGTGGGACTCAGGAAGG - Intronic
1103979550 12:124727565-124727587 GCTGCTGGGAGGACACAGGCAGG - Intergenic
1104035330 12:125093473-125093495 CATCCTGGAAGGACTCAGGAGGG + Intronic
1104290052 12:127458191-127458213 GATTCAGGAGGGACACATGCAGG + Intergenic
1104398185 12:128453432-128453454 AAAGCTGGTGAGACACAGGAAGG - Intronic
1106234942 13:27853621-27853643 GGTGCTGGAGGGGCACAGCAAGG - Intergenic
1106419321 13:29572424-29572446 GATGCTGGAAAGACAGAGGGTGG + Intronic
1107762725 13:43697738-43697760 TTTGCTGGAAGGATACAGGATGG + Intronic
1108419316 13:50232794-50232816 GTTGTTGGAGGGACCCAGGGGGG + Intronic
1108901899 13:55421807-55421829 GAAGGTGGACGGAAACAGGAAGG - Intergenic
1109591221 13:64485472-64485494 GATCATGTAGGGCCACAGGAAGG + Intergenic
1109713482 13:66189116-66189138 GATGCTGGAGATACATTGGAGGG + Intergenic
1109760014 13:66815760-66815782 GAGGCTGGAGGGACAGAGAAGGG + Intronic
1110134106 13:72044067-72044089 GATGCTGGAGTGAGAGAAGAGGG - Intergenic
1110680829 13:78309762-78309784 GATGCTAGAGGGACAGTGGTAGG + Intergenic
1110910364 13:80953625-80953647 GATGGTGGAGGGTGAGAGGAAGG + Intergenic
1111550108 13:89798020-89798042 GATGCTGGAGGGGTATGGGATGG - Intergenic
1111907927 13:94277065-94277087 GAGGCTGTGGGGACATAGGAAGG - Intronic
1112254747 13:97819651-97819673 GGTGCTGGAGGGACCCTGCAAGG + Intergenic
1112596645 13:100813770-100813792 GATGGTGGGGTGACAGAGGAGGG + Intergenic
1113672116 13:112182550-112182572 GATGCTGAAGAGACCCCGGAGGG + Intergenic
1114457462 14:22865492-22865514 GAAGCTGGAGGAACAAAGGGAGG + Intergenic
1116361484 14:44004110-44004132 GAGGGTGGAGGGACGGAGGAAGG + Intergenic
1116782978 14:49256898-49256920 GATGCTGGAGGGTGAAAGGAGGG + Intergenic
1118449771 14:65889574-65889596 GAAGATGGAGGGACACAGAGAGG - Intergenic
1118680434 14:68236057-68236079 GAGGGTGGAGGGAGGCAGGAGGG + Intronic
1119567091 14:75637922-75637944 ACTGCTGGAGGGGCACAGGAGGG + Intronic
1120856762 14:89219254-89219276 GAAGCAGGAGGGAGACAGAAGGG - Intronic
1121553003 14:94816261-94816283 GAAGCTGGAGGAAGCCAGGAAGG + Intergenic
1121828400 14:97029223-97029245 GAAGAGGGAGGGACAAAGGAAGG - Intergenic
1122152611 14:99732984-99733006 GTCCCTGGAGGGACAGAGGAGGG - Intergenic
1122596660 14:102898495-102898517 GGTGCAGGCGGGCCACAGGATGG - Intronic
1122825694 14:104369414-104369436 GTTGCAGTGGGGACACAGGATGG + Intergenic
1123058609 14:105584256-105584278 GATGGTGGTGGGCCACAGGTTGG + Intergenic
1123082940 14:105704490-105704512 GATGGTGGTGGGCCACAGGTTGG + Intergenic
1123790062 15:23711138-23711160 TATGCTGGAGGGACAGTGGAGGG - Intergenic
1123883122 15:24694174-24694196 GAGCATGCAGGGACACAGGAAGG + Intergenic
1123885698 15:24725754-24725776 GAGCATGCAGGGACACAGGAAGG - Intergenic
1124368843 15:29091870-29091892 GATGCTGGAGGGACTCAGGGAGG + Intronic
1125373016 15:38998853-38998875 GATGCTGGATGGCCACAACAAGG + Intergenic
1125759835 15:42088851-42088873 GATCCTGCAGGGCCACAGCATGG + Intronic
1127976448 15:64000732-64000754 GGTGCTGGAGAGCCACATGAGGG + Intronic
1128133269 15:65244954-65244976 GATGCTGGGGGGATACAAGAAGG + Intronic
1128602151 15:69004986-69005008 GAAGCTTTAGGGACTCAGGAAGG + Intronic
1129048253 15:72756277-72756299 CATGATGGAGGGACAAAGCAAGG - Exonic
1129048493 15:72758091-72758113 CATGATGGAGGGACAAAGCAAGG - Intronic
1129172361 15:73816087-73816109 GTTGCTGGTGGGACAAAGCATGG + Intergenic
1129260726 15:74365805-74365827 GATGCTGCAGGGCCGCAGGCCGG + Intronic
1129323563 15:74787899-74787921 CGTGCTGCAGGGAGACAGGAGGG + Intronic
1129942387 15:79509806-79509828 GAAGTTGGAGGAAGACAGGAGGG - Intergenic
1130105623 15:80926655-80926677 GATGCTTGAGAGACAGAGAAGGG + Intronic
1130908069 15:88253810-88253832 GGTACTGGAGGGCCTCAGGAGGG - Intronic
1131296546 15:91154449-91154471 GAGCAGGGAGGGACACAGGATGG + Intronic
1131548996 15:93340155-93340177 GATGGGGTAGGGACAGAGGATGG - Intergenic
1131653389 15:94427476-94427498 GGGGCTGGAGGGAGACAGCAAGG + Intronic
1132056246 15:98651434-98651456 GTGGCTGGGGGGACAAAGGAGGG + Intronic
1132144825 15:99423433-99423455 GAGGCTGAAGGGCCATAGGAAGG + Intergenic
1132642648 16:984777-984799 GAAGCTGGAGGGACGCCGGCCGG + Exonic
1133054626 16:3139407-3139429 GATGCTGAAGGGACACAGCTGGG + Intronic
1133165938 16:3947228-3947250 GTTTCTGGAGGGCCACAGGTTGG + Intergenic
1133201486 16:4206970-4206992 GAAGGTGGAGCGCCACAGGAAGG - Intronic
1133839252 16:9394008-9394030 GATGGGGAAGGGAGACAGGAAGG - Intergenic
1133981985 16:10639852-10639874 GATGCAGAGGGGACACAGAAGGG - Intronic
1134119617 16:11574592-11574614 GAGGCGGGAAGGACCCAGGATGG - Intronic
1134225319 16:12385534-12385556 GAGGCTGCAGGGACACAGTCCGG - Intronic
1134471413 16:14529788-14529810 CATGCTTGAGGGGAACAGGAAGG - Intronic
1134861291 16:17562639-17562661 GGTGCTGAAGGAACACCGGAGGG - Intergenic
1134905007 16:17972488-17972510 GAGGCTGGAGGCACAAAGGCAGG + Intergenic
1135007496 16:18839588-18839610 AAGTCTGGAGGGACAGAGGAAGG + Intronic
1135534627 16:23283807-23283829 AGGGCTGGAGGGACACAGGGAGG + Intronic
1135657803 16:24266887-24266909 GAAGCTGGAGAGAGAGAGGATGG + Intronic
1135746892 16:25024930-25024952 GAGGATGGTGGGATACAGGAAGG - Intergenic
1136121301 16:28136966-28136988 GACACTGGAGGGAGACTGGAAGG + Intronic
1136233783 16:28902707-28902729 GATGCAGGAGGGTACCAGGAGGG + Intronic
1136751224 16:32637800-32637822 GGTGCTGGAGGGGCATGGGAGGG + Intergenic
1137621017 16:49876656-49876678 GAGGGGGCAGGGACACAGGAGGG + Intergenic
1137632700 16:49958114-49958136 GCTGAAGGAGGGACCCAGGAAGG + Intergenic
1138504780 16:57472823-57472845 GGGCCTGGAGTGACACAGGAAGG - Exonic
1138729001 16:59174015-59174037 GATGTTGGAGGGTCACAAAAGGG + Intergenic
1139235273 16:65331676-65331698 GAGGGTGGAGGGTCAGAGGAGGG - Intergenic
1139423754 16:66866225-66866247 CATGCTGGTGGGACACTCGAAGG + Intronic
1140209234 16:72958072-72958094 GACCCTGGAGGCACACATGAAGG - Exonic
1140327099 16:74015033-74015055 GTTGCAGGAGGGACCCAGTAAGG + Intergenic
1140353367 16:74283583-74283605 GTTTCTGGCTGGACACAGGATGG + Intergenic
1140783189 16:78315031-78315053 GATGGTGGATGGAGACAGAAAGG - Intronic
1141483026 16:84319409-84319431 GCTGCAGGAGGGACACACGCTGG - Exonic
1141494140 16:84395281-84395303 CATGCTGCAGTGACACTGGAGGG - Intronic
1141631333 16:85289658-85289680 GGTGGTGGTGGGATACAGGAGGG + Intergenic
1141679737 16:85537083-85537105 GATGCAGAAGCGAGACAGGAGGG + Intergenic
1141784600 16:86190701-86190723 GATCCTGGAAGGTCACAGGAAGG - Intergenic
1141862740 16:86729144-86729166 GACGCTGAAGGGACAAAGGTGGG - Intergenic
1142186584 16:88697722-88697744 CCTGCTGGAGGGAGGCAGGAAGG - Intronic
1203053358 16_KI270728v1_random:897055-897077 GGTGCTGGAGGGGCATGGGAGGG + Intergenic
1142854606 17:2722834-2722856 GATGCAGGACCCACACAGGAGGG + Intergenic
1143106554 17:4533224-4533246 GAGGCTGTGGGGACAGAGGATGG - Exonic
1143210645 17:5184772-5184794 GATGCTGGAGGGACAATGCGTGG - Intronic
1143769316 17:9157906-9157928 GATGCAGGAGATAAACAGGAAGG + Intronic
1145095775 17:20024777-20024799 GAAGCTGGAAGGATAAAGGAGGG - Intronic
1145268358 17:21391385-21391407 CAGGCTGGAGGGGTACAGGAAGG - Intronic
1146688384 17:34856796-34856818 GAGGGTGGAAGGACTCAGGATGG + Intergenic
1148159399 17:45441499-45441521 CAGGCTGGGGGGACACAGGTTGG + Intronic
1148674653 17:49438425-49438447 GCTGCTGGAGGGACGCTGCAGGG + Intronic
1149058341 17:52391236-52391258 GGAGCTGGAGGTACAAAGGAAGG - Intergenic
1149181963 17:53950563-53950585 GAGGCTGTTGGGACACAAGACGG - Intergenic
1149808830 17:59646454-59646476 GGTGCTGGGGGGACAAAGAAGGG - Intronic
1150025423 17:61669077-61669099 AATGCTGGAAGGACGCAGGATGG + Intergenic
1150211537 17:63444650-63444672 GGGGCTGGAAGAACACAGGATGG + Intronic
1150216931 17:63476477-63476499 GGTGCTGGAGGGGCTCAGGGCGG - Intergenic
1152132950 17:78488271-78488293 GATGCCGGATGCACCCAGGATGG - Intronic
1152469427 17:80482643-80482665 CATGCGTGAGGGCCACAGGACGG + Intergenic
1152659204 17:81534665-81534687 GCTGCTGGATGGGCACAGGCAGG - Intronic
1152925312 17:83084944-83084966 GACGCACGAGGCACACAGGAAGG + Exonic
1153966675 18:10189059-10189081 GAAGATAGAGGGACAGAGGATGG - Intergenic
1155141710 18:23050146-23050168 AATCCTGGAGGCAGACAGGAAGG + Intergenic
1156067866 18:33166921-33166943 GAGGGTGGAGGGAGGCAGGAGGG - Intronic
1156518614 18:37702159-37702181 GAGGCTGGTGGCAGACAGGAAGG + Intergenic
1156674483 18:39511484-39511506 CAAGCTGTAGGGAGACAGGAAGG + Intergenic
1156703157 18:39848746-39848768 GGTGCTGCAGGGTCTCAGGAGGG + Intergenic
1156933039 18:42668462-42668484 GGTGCTGTAGTGACCCAGGAAGG + Intergenic
1157578380 18:48758905-48758927 GATGAAGGCGGGAAACAGGAAGG - Intronic
1158069764 18:53456941-53456963 GAGGTTGGAGGGACAAAAGAAGG + Intronic
1158601609 18:58860712-58860734 GTTCCTGGAGGGACAGTGGAAGG - Intergenic
1158847303 18:61458172-61458194 GAGGATGGAGGGACACAGGAAGG - Intronic
1160044859 18:75377066-75377088 GAGGCTGGAGGGACAAAGGAAGG - Intergenic
1160317319 18:77859768-77859790 GAGGCTGGAGGGAGGCAGGTAGG + Intergenic
1160344954 18:78124709-78124731 GATTCTGGAAGGACGCAGGGTGG + Intergenic
1160589291 18:79933713-79933735 GAAGCAGGAGGGAGACAGGAAGG - Intronic
1160671827 19:368795-368817 GAGGCTGGAGGGAGCCAGGGAGG - Intronic
1161052827 19:2173884-2173906 GACACTGGAGGGGCTCAGGAGGG - Intronic
1162019194 19:7860976-7860998 GATGGGGGAGGGGGACAGGAAGG + Intronic
1162133206 19:8539979-8540001 GAAGCTGGATGGAGACAAGAAGG - Exonic
1162535050 19:11258307-11258329 CATGCGGGAGGGAGCCAGGAAGG + Intronic
1163720652 19:18896627-18896649 AATGCGGGAGGGCCACGGGATGG - Intronic
1164650451 19:29887424-29887446 AACACTGGAGGGACACAGGCAGG - Intergenic
1164716397 19:30393730-30393752 GAGGCTAGAGGCACAGAGGAAGG + Intronic
1165110237 19:33498051-33498073 GCTGCGGGAGGGACACAGCGGGG - Intronic
1165263135 19:34637532-34637554 GAAGCTCGAGGGACTCACGATGG - Intronic
1165438819 19:35812313-35812335 GAGGCTGGGAGGACGCAGGAAGG - Intronic
1165832693 19:38737113-38737135 GAGGCTGGAGGGAACCCGGAGGG - Intronic
1166275746 19:41752661-41752683 GAGGCAGGAGAGACACAGGAAGG - Intronic
1166633209 19:44426014-44426036 TATCCTGGAGGAACACATGATGG + Intronic
1166959949 19:46491398-46491420 TATGGTGGGGGGACACAGGATGG + Exonic
1167609908 19:50502028-50502050 GAGGCTGGCGGGGCACGGGAGGG - Intergenic
1167634159 19:50644248-50644270 GATGCTGGAAGGATAGATGAAGG + Intronic
1167958510 19:53087226-53087248 GGGGCTGGGAGGACACAGGAAGG + Intronic
1168354944 19:55695078-55695100 CATGCTGGATGGACACAGGTGGG + Intronic
925046016 2:773690-773712 CCTGCTGGGGGGAAACAGGATGG - Intergenic
925170688 2:1748558-1748580 GCTGATGAAGGAACACAGGATGG - Intergenic
925340276 2:3131169-3131191 AAAGCTGGAGGGACCCTGGAGGG + Intergenic
925856452 2:8134073-8134095 GAAGCTGGCGGGAGGCAGGAGGG - Intergenic
925944285 2:8846404-8846426 GCTGATGGAGGGAAACAGGAAGG + Intergenic
926092763 2:10061326-10061348 GAGGATGGTGGGAAACAGGAAGG - Intronic
926214353 2:10895001-10895023 GAAGCTGGAAGGTCACAGGAAGG - Intergenic
927878727 2:26675790-26675812 CAGGCTGGAGTGACACAGCATGG - Intergenic
927884851 2:26712111-26712133 GAAGCTGGAGGGCTTCAGGATGG + Intronic
928515304 2:32039420-32039442 GATGCTGGAGGGACAAACGCAGG - Exonic
929043973 2:37772968-37772990 ACTGCTGGAGGGACACAGGTGGG + Intergenic
929151254 2:38751054-38751076 GGTGCTGAAGGGAGACGGGATGG - Intronic
931898011 2:66755226-66755248 GATGCTAGAGGCACAGAGGCAGG + Intergenic
932048098 2:68370345-68370367 GATGCTGGGTGTACACAAGAAGG + Intronic
932246316 2:70199663-70199685 GCTGCAGGTGGGACACATGAGGG - Intronic
932278339 2:70468435-70468457 GATGCTGAATTGAGACAGGAAGG + Intronic
932312329 2:70753648-70753670 GAAGCTGGAGGCACCCAGAAAGG + Intronic
932318329 2:70801298-70801320 CATGGTGGAGGCACACAGGAAGG + Intergenic
933455345 2:82512577-82512599 GAGGTTGGAGGAACAGAGGAGGG + Intergenic
934517272 2:94996610-94996632 GCTCCTGGAGGGCCTCAGGATGG + Intergenic
934650240 2:96086345-96086367 GATGCTGCAGGAACCCAGGGTGG + Intergenic
934663278 2:96154358-96154380 GAGGCACGAGGGACACAGGATGG + Intergenic
935103710 2:100020310-100020332 GAGCCTGGAGTGTCACAGGAGGG - Intronic
935213280 2:100956355-100956377 GAGGCTGGAGGGAGGAAGGAAGG - Intronic
935338914 2:102042496-102042518 TATGCTGTGGGAACACAGGAGGG + Intergenic
935812377 2:106811384-106811406 GATACTGCAGGCAGACAGGACGG + Intronic
936257168 2:110926915-110926937 GATGCTGGAAGGCCCCAGGAGGG - Intronic
936275975 2:111097658-111097680 TATGTTCCAGGGACACAGGAAGG + Intronic
936397116 2:112139122-112139144 GAGGCGGGAGGGACACTGGCTGG - Intronic
937673454 2:124563600-124563622 GGTGCTGTAGGCACACAAGAGGG + Intronic
937860376 2:126703468-126703490 GTGGTGGGAGGGACACAGGAGGG + Intergenic
938248704 2:129797655-129797677 AATTCAGGAGGGACACAGCAGGG + Intergenic
939152757 2:138493023-138493045 GAAGCAGGAGAGACACAGGTTGG + Intergenic
940628661 2:156209582-156209604 GAGGGTGGAGGGTGACAGGAAGG - Intergenic
941004538 2:160234536-160234558 GTTTCTGGAGGGCCAAAGGACGG + Intronic
941634817 2:167925070-167925092 GGTTCTGGAGGGAAACAGAATGG - Intergenic
942376631 2:175344143-175344165 GCTGCCTGAAGGACACAGGATGG - Intergenic
944118305 2:196212341-196212363 GAGGGTGGAGGGTCAGAGGAGGG - Intronic
946025473 2:216669461-216669483 GTTGCTTGAGGGACACTGGGTGG + Intergenic
946149538 2:217754981-217755003 GATGCTGGTGAGAGAGAGGATGG - Intronic
946334817 2:219029645-219029667 AGTGCTGCAGGGACACAGCAGGG + Exonic
946782829 2:223209151-223209173 AATGCTTGTGAGACACAGGAAGG + Intergenic
946877086 2:224140101-224140123 GAGGCTGGAGGGTGAGAGGAGGG - Intergenic
947434739 2:230063402-230063424 GAGGCTGGAAGGAGAGAGGAGGG - Intronic
947820592 2:233066475-233066497 GATGCTGGGTTGACACAGGAAGG - Intronic
947878845 2:233486932-233486954 GCTGCTGGAGAGAAACAGGAGGG + Intronic
948385325 2:237577289-237577311 GATGCTGGTGGGCAACAAGACGG - Exonic
948751008 2:240133068-240133090 GAAGCAGCAGGGACTCAGGATGG + Intronic
948796723 2:240407020-240407042 GCTGCTGGAGGGACTGAGGCAGG + Intergenic
948963749 2:241360010-241360032 GCAGCTGGAGGGAGACAGGGAGG - Intronic
949069601 2:242016095-242016117 GATGCAGGAGGGAGGCAGGAGGG + Intergenic
1170035281 20:11982971-11982993 GTTGCTGGGGGGTCAGAGGAGGG + Intergenic
1170272788 20:14547230-14547252 CATGCAGGAGGGACACGTGAAGG + Intronic
1170584218 20:17722146-17722168 GTTGCTGGAGAGCCCCAGGAGGG + Intronic
1170585808 20:17733000-17733022 GATGCCACAGGGAGACAGGAGGG + Intronic
1170812842 20:19687982-19688004 GCTTCAGGAAGGACACAGGAGGG - Intronic
1170862419 20:20119783-20119805 GATGGTGGAGGGTAAAAGGAGGG - Intronic
1171490725 20:25515174-25515196 TATCCTGCAGAGACACAGGATGG + Intronic
1172162135 20:32876071-32876093 GGTGCTGGAGGGAGGCTGGAGGG + Intronic
1172486629 20:35302275-35302297 GATGCTGGAGGGACTCACCCAGG + Intergenic
1172555924 20:35841246-35841268 GAGGCTGGAGGGACACGAGCTGG + Intronic
1172846208 20:37931217-37931239 GATGCTGGAGTAACTCAGGAGGG + Intronic
1173111363 20:40193435-40193457 GAGGATAGAGGGAGACAGGAAGG - Intergenic
1173295285 20:41750009-41750031 GATGCTTGGGGGACAATGGATGG + Intergenic
1175011061 20:55736531-55736553 GAGGGTGGAGGGAGGCAGGAGGG + Intergenic
1175520183 20:59597784-59597806 GTTGCTGCAGGGTCACAGGCTGG + Intronic
1175636273 20:60586892-60586914 GATTCTGGAGGGGAGCAGGAAGG + Intergenic
1175984107 20:62755577-62755599 GATGATGGAGGGAGGGAGGATGG - Intronic
1175984143 20:62755678-62755700 GATGATGGAGGGAGGGAGGATGG - Intronic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1176266028 20:64209812-64209834 GATGCTAAGGGGACACAGGTGGG + Intronic
1176284501 21:5012367-5012389 GCTGCTGGAGGGACAGGGGCAGG + Intergenic
1176424117 21:6537255-6537277 GAAGCAGGAGGGAAGCAGGAGGG + Intergenic
1177843893 21:26266116-26266138 GATGATGGGGAGACACAGGGTGG + Intergenic
1178337780 21:31759337-31759359 GAGGCGGGAGGGAAAAAGGAGGG - Intergenic
1179699610 21:43145570-43145592 GAAGCAGGAGGGAAGCAGGAGGG + Intergenic
1179872680 21:44251108-44251130 GCTGCTGGAGGGACAGGGGCAGG - Intronic
1179924989 21:44529398-44529420 GATGATGGTGGGACAGAGGCGGG + Intronic
1180076640 21:45466592-45466614 GATGCTGGATGGGCAGAGAATGG - Intronic
1180911496 22:19454032-19454054 GGTGGTGGCGGGACAGAGGAAGG - Intronic
1180921347 22:19523116-19523138 GATGCTGGAGTGAGACCGGGAGG + Exonic
1181528446 22:23502771-23502793 GAGGATGGAGGGACAGGGGATGG - Intergenic
1181528465 22:23502823-23502845 GAGGATGGAGGGACAGGGGATGG - Intergenic
1181603045 22:23963683-23963705 GATGATGGTGGGAACCAGGATGG + Intergenic
1181605469 22:23977624-23977646 GATGATGGTGGGAACCAGGATGG - Intronic
1181846106 22:25710068-25710090 GATGCTGGGGAGACACAGCCAGG - Intronic
1182860573 22:33556083-33556105 GAAGTTGGAGGGAGTCAGGAGGG - Intronic
1182868372 22:33624811-33624833 GAAGCAGGAAGGACACATGAAGG + Intronic
1183160688 22:36110986-36111008 GAGGCTGCAGTGAGACAGGATGG - Intergenic
1183281518 22:36935124-36935146 AGTGCTGGGAGGACACAGGAGGG - Intronic
1184263400 22:43332752-43332774 CATGCTGGGAGGACCCAGGAAGG - Intronic
1184689479 22:46110885-46110907 GATGATGCTGGGACAGAGGAGGG + Intronic
1184712400 22:46260130-46260152 GTTGCAGCAGGGACACAGGGAGG + Exonic
1184741789 22:46432806-46432828 GCTGGGGGAGGGACACAGAAAGG - Intronic
1184899357 22:47434663-47434685 GAAGGTGGAGGGACAGAGCATGG - Intergenic
1184972675 22:48037711-48037733 GATGCTCCAGGGAGGCAGGAAGG + Intergenic
1184987572 22:48146030-48146052 GAGGCAGGAGGGAGGCAGGAAGG - Intergenic
1185243101 22:49756850-49756872 GAAGGTGGAGGGACACAGCAGGG - Intergenic
1185340444 22:50288552-50288574 AGTGCTAGAGAGACACAGGATGG + Intronic
1203296096 22_KI270736v1_random:44363-44385 ACTGCTGGAGGGACACAGGTGGG + Intergenic
949892068 3:8740689-8740711 GAGGCTGGAGGGAACTAGGATGG + Intronic
950191154 3:10977120-10977142 GATGCTGGAGAGATAGAGGGTGG - Intergenic
950623725 3:14228710-14228732 GAGACTGGAGGAACACAGGGTGG + Intergenic
951970117 3:28434554-28434576 GATGGAGGAAGGAGACAGGATGG + Intronic
952888963 3:38028792-38028814 GCTGCTGGAGGGACAGCGAAAGG + Intronic
953886794 3:46718541-46718563 GATGGTTCAGTGACACAGGAGGG + Intronic
954847522 3:53572773-53572795 GAGACTGGAGGCACAAAGGATGG - Intronic
954929725 3:54271004-54271026 GATGTTGGAAGGAGGCAGGAGGG + Intronic
956958976 3:74375579-74375601 GAGGCAGGAGGGTCACAGTAAGG + Intronic
957085107 3:75670604-75670626 GAGGCTGGTGGGACACGGGTTGG - Intergenic
957734674 3:84190036-84190058 GCTGCTGCAGGGAGACATGATGG + Intergenic
957817704 3:85323600-85323622 GGTGCTGGAGGAAGACAGAAGGG - Intronic
957971065 3:87382948-87382970 GATGTTGGAGGGACAGACAATGG - Intergenic
958181775 3:90070008-90070030 GAAGGTTGAGGGACACAGGAGGG + Intergenic
960088344 3:113614218-113614240 GAGACTGCAGGGACAAAGGAAGG - Intronic
960257494 3:115526547-115526569 GAGGGTGGAGGGTGACAGGAGGG - Intergenic
960486613 3:118260012-118260034 GATGTGGGAGGGGCACAGGGTGG + Intergenic
960960204 3:123065367-123065389 GATGGTGGGGGGACAGGGGATGG + Intergenic
961458978 3:127038328-127038350 GAGGCTGGTGGGAGACAGGTGGG - Intergenic
961477261 3:127156736-127156758 GCTGGTGGAGGGCCACAGGAGGG - Intergenic
961575760 3:127834937-127834959 GAGGCTGGAGACACACAGGGAGG + Intergenic
961645201 3:128389126-128389148 GAGGCTGGAGGGAGGCAGGCAGG + Intronic
961813304 3:129534086-129534108 AATGCTGGATGGATGCAGGAAGG + Exonic
963580394 3:147119390-147119412 GATGATGGCGGGAAACAGAATGG - Intergenic
964739611 3:159951611-159951633 GCTGCTGGACAGACTCAGGATGG - Intergenic
965873737 3:173291583-173291605 GATTCTGGAGTGCAACAGGAAGG + Intergenic
968021436 3:195394172-195394194 GGTGCTGGAGGGGCACGGGAGGG - Intronic
968288841 3:197523738-197523760 GAGGTGGGAGGGGCACAGGAGGG + Intronic
968478426 4:823607-823629 GGTGCTGGGGGAACACAGGATGG + Intronic
969522342 4:7685809-7685831 GCTGCAGGAGGGACACAGTCAGG - Intronic
969541017 4:7788906-7788928 GCTGCAGCAGGGACAAAGGATGG + Intronic
969584235 4:8082839-8082861 GACTCTGCAGAGACACAGGAAGG - Intronic
970228326 4:13882506-13882528 GAGGCTGCAGGGACATTGGACGG + Intergenic
970276742 4:14409006-14409028 GATCCTGTAAAGACACAGGAAGG - Intergenic
971142904 4:23944398-23944420 GAAGCTGGAGGGAGACAAGAAGG - Intergenic
972385612 4:38562832-38562854 TAGGCTGGAGGGACAAAGGGAGG + Intergenic
973163394 4:47046990-47047012 GAGGCTGGAGGGTGGCAGGAGGG + Intronic
973362555 4:49178450-49178472 GAAGCTGGTGGGAGCCAGGAAGG - Intergenic
973872066 4:55176463-55176485 GATGCTGGCAGGACATAGGATGG + Intergenic
974210574 4:58769225-58769247 GATTTTGGAGGTACACATGAAGG + Intergenic
974518357 4:62945770-62945792 GATACAAGAGGGTCACAGGAAGG - Intergenic
975359516 4:73451558-73451580 GAGGCTGCAGGGATGCAGGATGG + Intronic
975700571 4:77062221-77062243 GATGCTGTGGGAACATAGGAAGG - Intronic
976422234 4:84859062-84859084 GATGTGGGAGGGACAGAGAAAGG + Intronic
977257803 4:94758871-94758893 GAGGATGAAGGGACAGAGGAGGG - Intronic
978219350 4:106252220-106252242 AATGCTGGAGGGAGACATGAAGG - Intronic
978549507 4:109910283-109910305 GATCCTGAAGGGACACAGCTGGG - Intergenic
978748923 4:112225248-112225270 GGTGCTGCAGGGACACTGCAAGG + Intergenic
979903297 4:126251238-126251260 TATGAGGGATGGACACAGGAAGG - Intergenic
980875643 4:138659421-138659443 GAAGCAGGAGGGAGACAGGCGGG + Intergenic
981538475 4:145824512-145824534 GAGGCTGGAGGGACAAAAGGAGG + Intronic
982529803 4:156525291-156525313 GATGCAGGAGGAAAACAGAAAGG + Intergenic
982813905 4:159861686-159861708 TGGGCAGGAGGGACACAGGATGG - Intergenic
983887746 4:172999385-172999407 GGTGCTGGAAGGACACTGGAAGG - Intronic
984870677 4:184322332-184322354 GAGGGTGGAGGGAGAGAGGAGGG - Intergenic
985261713 4:188120441-188120463 GATTCTGGAGAGACACACGGCGG + Intergenic
985268823 4:188175549-188175571 GAGGCAGGAGGAACACAGGAGGG + Intergenic
985670577 5:1204578-1204600 GTTTCTGGACGGACACAGGTGGG - Intronic
985903494 5:2814875-2814897 GATGCGGGAGAAACACAGGCAGG + Intergenic
986219423 5:5754190-5754212 GTCGCTGCAGGGACACACGATGG + Intergenic
986285297 5:6354490-6354512 GAGGCTGGAGGGAGACAGGCTGG + Intergenic
986888319 5:12267833-12267855 GAGGCTGGAGGGTGAGAGGAAGG - Intergenic
986890529 5:12299465-12299487 GATGCTGCATGGGCTCAGGAAGG - Intergenic
987251958 5:16109239-16109261 GCTCCTGGATGGACTCAGGATGG + Intronic
987396030 5:17424633-17424655 GATGCTGAAGGGAGAAAAGACGG + Intergenic
988318102 5:29657811-29657833 GAGGGTGGAGGGAGAGAGGAGGG + Intergenic
988659316 5:33247165-33247187 AATGCTGGCGGTACACAAGAAGG + Intergenic
989637255 5:43549367-43549389 GTTGTGGGAGGGACCCAGGAGGG + Intronic
990629147 5:57648958-57648980 GATGATGGAGGGTGAGAGGAGGG - Intergenic
991418933 5:66421159-66421181 TCTGCTGGAGGGACAGAGGGAGG + Intergenic
991542919 5:67749322-67749344 AGTGCTGGATGGACACAAGATGG - Intergenic
992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG + Intronic
992765533 5:79995595-79995617 GATGCTGGAGAGAAGAAGGATGG + Intronic
992856467 5:80866683-80866705 TATACTGGAAGGACAGAGGAAGG - Intronic
992966145 5:82002642-82002664 GAAGGTGGAGGGAGAGAGGAGGG + Intronic
994156442 5:96508699-96508721 GAAGTTGGAGGGTCTCAGGAAGG + Intergenic
996266003 5:121541119-121541141 GATGCTGGAGAGCCTCAGGAAGG + Intergenic
997524614 5:134544318-134544340 GATGCAGGTGCTACACAGGAAGG + Intronic
999132676 5:149296477-149296499 GTGGCTGCAGGGCCACAGGAGGG + Intronic
1000035431 5:157444102-157444124 GAGGCAGGAGGGACACAGAAAGG + Intronic
1000179502 5:158794254-158794276 GGCACTGGAGGGACAGAGGAGGG + Intronic
1000631875 5:163599884-163599906 CCTGCAGGAGAGACACAGGAGGG - Intergenic
1001132516 5:169076173-169076195 GTTGCTGGGGGATCACAGGAAGG + Intronic
1001558078 5:172649791-172649813 GAGGCTGGGTGGACACAGGGAGG - Intronic
1001657810 5:173366208-173366230 GAGGCTGGAGGGTGAAAGGAGGG - Intergenic
1001998157 5:176178661-176178683 GATGTTGGAAGGACTCAGGAAGG - Intergenic
1002071086 5:176679395-176679417 GGTGGAGGAGGGACCCAGGAAGG + Intergenic
1002116719 5:176967836-176967858 GAGGCTGCAGGGACCCAAGATGG + Intronic
1002133884 5:177096691-177096713 GCTGCGGGAGGGACATCGGATGG + Exonic
1002567171 5:180118701-180118723 GGTGCTGGAAGGAGACAGGGAGG + Exonic
1002641940 5:180634728-180634750 GATGATGGATGGAAACGGGATGG + Intronic
1002757933 6:179360-179382 GGTGCTGGAGGGGCATGGGAGGG + Intergenic
1004160341 6:13207297-13207319 GGTGTTGGAGGGAAACAAGAGGG + Intronic
1004802821 6:19169572-19169594 GAGGCTGGAGAGATAAAGGAAGG - Intergenic
1005511183 6:26512970-26512992 GGAGCTGGAGGGAAAAAGGAAGG - Intergenic
1005532205 6:26719268-26719290 GATGGTGGAGGAACACAATAGGG - Intergenic
1005536326 6:26759554-26759576 GATGGTGGAGGAACACAATAGGG + Intergenic
1005538590 6:26782397-26782419 GATGGTGGAGGAACACAATAGGG + Intergenic
1005582624 6:27248978-27249000 GATGCTGGTGGGGACCAGGAAGG + Intronic
1005661092 6:28000495-28000517 GATGCTGGTGAGACCCAGTAAGG + Intergenic
1006025347 6:31143246-31143268 CATGCTGGTAGGAGACAGGAGGG - Exonic
1006175297 6:32117691-32117713 GTTGCTGGAGTGAAGCAGGAAGG + Exonic
1006796484 6:36735543-36735565 GAAGCTGGTGGGACCCGGGAAGG + Intergenic
1006808327 6:36803334-36803356 GATGATGGGCGCACACAGGAGGG - Intronic
1007079062 6:39085985-39086007 GCTGCTGGTGGGACACTTGAGGG - Exonic
1007292202 6:40796532-40796554 AATGGTGGAGGGTCAGAGGAGGG - Intergenic
1007484112 6:42168779-42168801 GAAGCTGGAGGAAGACTGGAGGG - Intronic
1007824778 6:44592269-44592291 GATGCAGCAGGGAGACAGGAAGG + Intergenic
1009007225 6:57801953-57801975 GATGGTGGAGGAACACAATAGGG + Intergenic
1009009442 6:57824632-57824654 GATGGTGGAGGAACACAATAGGG + Intergenic
1010329673 6:74608531-74608553 GAGGCTGGAGGGTGAGAGGAGGG - Intergenic
1012537815 6:100320389-100320411 GATGATGGAGGGAAAGAGGAAGG - Intergenic
1013170494 6:107633927-107633949 GTGGCTGGACGGAGACAGGAGGG - Exonic
1013958410 6:115867899-115867921 TATGCTAGAGTGACAAAGGAGGG - Intergenic
1013961735 6:115909030-115909052 GCAGCTGGAGAGAGACAGGAAGG + Intergenic
1015499952 6:133921413-133921435 GGCGCTGGAGGGACACTGTAAGG - Intergenic
1016705318 6:147100229-147100251 GATTCTGGAGAGACACTGGTGGG - Intergenic
1017381141 6:153831573-153831595 GGTGCTGGAGGGAGACAGAGAGG + Intergenic
1017896766 6:158686823-158686845 GATGCTGGCCAGACACAGGTCGG + Intronic
1018836337 6:167487028-167487050 GATGCTGCATGGAGACAGGTCGG + Intergenic
1019187725 6:170230593-170230615 GGGGCTGGAGGGACCCAGGCGGG + Intergenic
1019558252 7:1643083-1643105 GCTGGGGCAGGGACACAGGAGGG - Intergenic
1019732978 7:2637723-2637745 GGTGTGGGAGGGTCACAGGAGGG + Intronic
1021785281 7:24145228-24145250 GATGCTGTAGTGGCACAGGTAGG + Intergenic
1022091473 7:27110467-27110489 GGCGCTGGAGGGAGACTGGAGGG + Exonic
1022993207 7:35728619-35728641 GGAGCTGGAGGGACAGAGGGAGG + Intergenic
1023557280 7:41436510-41436532 GATCCTGTAGGGACAGGGGAGGG + Intergenic
1023982931 7:45080180-45080202 GGTGATGAAGGGACACAAGAGGG + Intergenic
1024268259 7:47622808-47622830 AAAGCTGGAGAGACAGAGGAAGG - Intergenic
1024355348 7:48408836-48408858 GATGGTGGAGGGAGCCGGGAGGG - Intronic
1024579111 7:50787699-50787721 GGTGATGGAGCGACGCAGGAGGG - Intronic
1025097528 7:56107937-56107959 GCTGTTGCTGGGACACAGGAAGG - Intergenic
1026535197 7:71233303-71233325 GGTGTTGGAGGGAGAGAGGATGG + Intronic
1026941377 7:74289717-74289739 GATGCTGGAAGGACGAAGGTAGG + Exonic
1027422966 7:78035090-78035112 GGTGCTGGAGACACACTGGAGGG + Intronic
1028210169 7:88064101-88064123 GAGGATGGAAGGCCACAGGAGGG + Intronic
1028971759 7:96867222-96867244 AGTGTTGGAGGGGCACAGGAAGG - Intergenic
1029420032 7:100467597-100467619 GCCACTGGAGAGACACAGGAAGG + Exonic
1029812775 7:103066010-103066032 AGTGCTGGAGGGACCCTGGAGGG - Intronic
1029860299 7:103564435-103564457 GAGACTGTAGGGACACAGGGAGG + Intronic
1031162326 7:118183359-118183381 GATGCAGGAAGGATGCAGGAAGG - Intergenic
1031294416 7:119983708-119983730 CATGGTGTGGGGACACAGGAGGG - Intergenic
1032154240 7:129455152-129455174 GATTCTGGACACACACAGGAAGG - Intronic
1032209602 7:129901428-129901450 GATGCTGGTGGGATAGAGGTCGG + Intronic
1032906987 7:136379803-136379825 GAGGCTGGAAGGAAAGAGGATGG - Intergenic
1033150856 7:138913937-138913959 GAGGGAGGAGGGAGACAGGAAGG + Intronic
1033416846 7:141169188-141169210 GATGGTGGAGGGTGAAAGGAGGG - Intronic
1033683941 7:143621952-143621974 GAAGCAGGAGGGAGAGAGGAAGG + Intronic
1033687117 7:143701141-143701163 GAAGCAGGAGGGAGAGAGGAAGG + Intronic
1033700671 7:143835686-143835708 GAAGCAGGAGGGAGAGAGGAAGG - Intergenic
1034228706 7:149502153-149502175 GATGTGGGAGTGATACAGGAGGG - Intergenic
1034273862 7:149815671-149815693 GATCCCTGAGGGGCACAGGAGGG - Intergenic
1034408296 7:150921288-150921310 GATGCTGGAGGGACATTCGCAGG - Intergenic
1034964555 7:155383141-155383163 GAGGCTGGAGGGTCTCAGAAAGG - Intronic
1035044315 7:155953836-155953858 GACGCTGCAGTGGCACAGGAGGG - Intergenic
1035520721 8:273690-273712 GAAGTGGGAGGCACACAGGAGGG + Intergenic
1035599027 8:884269-884291 GAGGCTGCAGAGAAACAGGAAGG - Intergenic
1036756587 8:11475222-11475244 CAGGCTGGAGGGGCACAGGGAGG - Intergenic
1037154068 8:15677799-15677821 GATGCTGGAGGCACTAAGAAGGG + Intronic
1038045755 8:23764368-23764390 GATGCAGGAGGGAGGCTGGACGG + Intergenic
1038309981 8:26439057-26439079 GCTACTGGAGGGTCACATGAGGG - Intronic
1038419921 8:27427312-27427334 GGGGCTGGAGGGATTCAGGATGG - Intronic
1039265813 8:35822781-35822803 GAGGGTGGAGGGTGACAGGAGGG + Intergenic
1039415944 8:37394195-37394217 CATGCTGGGAGGACCCAGGAGGG - Intergenic
1039518266 8:38150909-38150931 GAAGCTTGAGGGGCTCAGGAAGG - Exonic
1041180625 8:55244209-55244231 GAGGCTGGAGGGTGAGAGGAGGG - Intronic
1041503999 8:58573683-58573705 GGAGCAGGAGGCACACAGGAAGG + Intronic
1041996749 8:64070997-64071019 CATACAGGAGGGACACAGGATGG - Intergenic
1042629052 8:70796203-70796225 GAAGGTGGAGGGACAGAGGATGG - Intergenic
1043441201 8:80278498-80278520 GATGCTTAAGGGACAGAGGAAGG - Intergenic
1044773038 8:95657735-95657757 GAGGGTGGAGGGAAACAGGTTGG + Intergenic
1044845090 8:96372535-96372557 AATGCTGGGGTGACACAGCAGGG - Intergenic
1044954374 8:97464314-97464336 CAGGGTGGAGGGTCACAGGAGGG + Intergenic
1045214034 8:100129422-100129444 GTTGTGGGAGGGACCCAGGAGGG - Intronic
1045355707 8:101387117-101387139 GAAGCTGGAGCAGCACAGGACGG + Intergenic
1045544011 8:103112068-103112090 GAGGCTGGGGGGACAGAGCAAGG + Intergenic
1046202433 8:110944953-110944975 AATGAGGGAGGGACACAGGGAGG - Intergenic
1046320904 8:112573521-112573543 GATACTGAAGGGACAGATGAAGG - Exonic
1046806227 8:118481640-118481662 GATGGTCTGGGGACACAGGAGGG + Intronic
1047306830 8:123659332-123659354 GATGATGGATGGACAATGGATGG - Intergenic
1047433034 8:124809152-124809174 GATTGAAGAGGGACACAGGAGGG - Intergenic
1048035648 8:130674800-130674822 GATGCTGGTAGGACACAGGAAGG - Intergenic
1048274447 8:133055658-133055680 GATGCTAGAGGGATATAGGCAGG + Intronic
1048525859 8:135201821-135201843 GATGCTGGGGAGATACAGGATGG + Intergenic
1048531596 8:135255002-135255024 GCTTCTGGAGGGTCACAGGAGGG - Intergenic
1048542733 8:135357405-135357427 GTTGCTGGAAGGACTTAGGAAGG + Intergenic
1048840520 8:138561962-138561984 GATCATGGAAGGACACAGGGAGG + Intergenic
1049024529 8:139979554-139979576 GATGCTGGCGGGTGAGAGGAGGG + Intronic
1049350596 8:142162465-142162487 GAGGATGGATGGACAGAGGATGG + Intergenic
1049788773 8:144463453-144463475 CAGGCCGGAGGTACACAGGAGGG + Intronic
1050335186 9:4583611-4583633 GAAGCTGGTAAGACACAGGACGG - Intronic
1051080194 9:13285215-13285237 GATGGTGGTAGGAGACAGGAGGG - Intergenic
1051083956 9:13325400-13325422 GATGCTGGAGAGACACTGGAAGG - Intergenic
1053062633 9:35043953-35043975 GATGCTGGTGGGACACATTCAGG - Exonic
1054337126 9:63817278-63817300 GAGGCTGGCGGGACACGGGTTGG + Intergenic
1055040568 9:71867003-71867025 AATGCTGCAGGGAAAAAGGAAGG + Exonic
1055521357 9:77084304-77084326 GATGGGGGAAGGCCACAGGAAGG - Intergenic
1055612166 9:78033921-78033943 GATGTTGGGGGGATACAGGGGGG - Intergenic
1057077399 9:92145697-92145719 GATGCTGGAGGCAGAGAGTAAGG + Intergenic
1057507161 9:95644461-95644483 GATGGTGGAGTGCCACAGTAAGG + Intergenic
1057877245 9:98767437-98767459 GATGCTGTAGGGGCACAGGTGGG - Intronic
1058108911 9:101008044-101008066 GAGGCTGGAGAGTGACAGGAGGG + Intergenic
1058147433 9:101427536-101427558 GAGGCTGGATGGACACTGGTCGG + Exonic
1058904862 9:109474463-109474485 GGTGCTGGAGGAACACAAGGAGG + Intronic
1059937651 9:119327372-119327394 GATGCTGGACATACATAGGAGGG - Intronic
1060138768 9:121185147-121185169 GAGGCAGGAAGGACACAGGGCGG + Intronic
1060931371 9:127491512-127491534 GAGGCAGGAGGGTCAGAGGAAGG + Intronic
1061226845 9:129285319-129285341 GAAGCTGGAGGGACTGAGAAGGG + Intergenic
1062097257 9:134709855-134709877 GATGCTGGAGGGTCTCTGGAGGG + Intronic
1062205736 9:135335871-135335893 GGTGCTGGGTGGACACACGAAGG + Intergenic
1062359271 9:136179904-136179926 GATGCGGGAGGGCCCCAAGAAGG - Intergenic
1062599392 9:137313139-137313161 GAGGCTTGAGGGAAAGAGGAGGG + Intronic
1203377063 Un_KI270442v1:384699-384721 GAGGCTGGCGGGACAAAGGTTGG + Intergenic
1186537412 X:10364280-10364302 GATGTTGGAGGCAAACGGGAAGG + Intergenic
1187021413 X:15386700-15386722 TATGCTGGAGGAATACTGGAGGG + Intronic
1187368826 X:18686954-18686976 GATGCAGGATGGATGCAGGATGG - Intronic
1188644867 X:32553409-32553431 GAGGCTGGAGGGTAAGAGGAGGG + Intronic
1188810984 X:34654653-34654675 GGTGATGGTGGGACACAGGGCGG - Intronic
1189273596 X:39768960-39768982 GATTCAGGAGGGCCACATGAGGG + Intergenic
1189745157 X:44161382-44161404 GAGGCTGAAGGGGCACATGAGGG + Intronic
1190380853 X:49838557-49838579 GATGGTGGAGGAAGACAGGCTGG + Intergenic
1190511954 X:51182400-51182422 GATGGTGGAGGAACACTGAAGGG + Intergenic
1190879845 X:54484280-54484302 GATGCTGCAAGAACACATGAGGG - Intronic
1192075783 X:67994712-67994734 GAGGGTGGAGGGAGGCAGGAGGG - Intergenic
1192330274 X:70169823-70169845 TAAGCTGGAGGGACGGAGGAGGG + Intergenic
1192439925 X:71166856-71166878 GATGATGTAGGGCCAAAGGAGGG - Intronic
1193800866 X:85934463-85934485 GACACAGGATGGACACAGGATGG - Intronic
1193827979 X:86250050-86250072 GATGGTGGAGGGAGGGAGGAGGG + Intronic
1194878870 X:99225333-99225355 GAGGGTGGAGGGAGAAAGGAGGG - Intergenic
1195293438 X:103451386-103451408 GAAGCTGGAGGGAGACAGGTAGG - Intergenic
1195742014 X:108074446-108074468 GATGTGGGAGGGAGAGAGGAAGG - Intronic
1197783240 X:130177075-130177097 GAGGATGGAGGGGCACAGCATGG - Intronic
1198116769 X:133551789-133551811 GGAGCTAGAGGGGCACAGGAGGG - Intronic
1198799549 X:140434602-140434624 TAGGCTGGAGGGACAAAGGGAGG - Intergenic
1198915358 X:141664801-141664823 GATGCGGGAGAGAGGCAGGATGG - Intronic
1199035473 X:143045107-143045129 TATGTTGCATGGACACAGGAAGG + Intergenic
1200073825 X:153541606-153541628 GATGAGGGACGGTCACAGGATGG + Intronic
1200942548 Y:8800481-8800503 GATGGGGGAGGGAGGCAGGATGG - Intergenic
1201180034 Y:11334096-11334118 GAGGCTGCAGGGGCACAGGCGGG - Intergenic
1201348565 Y:13012859-13012881 GAGGCTGTAAGGATACAGGAGGG - Intergenic
1201409636 Y:13686411-13686433 GAGGGTGGAGGGAAAGAGGAGGG + Intergenic