ID: 992653646

View in Genome Browser
Species Human (GRCh38)
Location 5:78886617-78886639
Sequence CAGAGTTAAGACATTAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992653644_992653646 -10 Left 992653644 5:78886604-78886626 CCAAATGAGGGCTCAGAGTTAAG 0: 1
1: 0
2: 0
3: 9
4: 109
Right 992653646 5:78886617-78886639 CAGAGTTAAGACATTAAAGTGGG 0: 1
1: 0
2: 3
3: 26
4: 204
992653643_992653646 -6 Left 992653643 5:78886600-78886622 CCAGCCAAATGAGGGCTCAGAGT 0: 1
1: 0
2: 0
3: 9
4: 118
Right 992653646 5:78886617-78886639 CAGAGTTAAGACATTAAAGTGGG 0: 1
1: 0
2: 3
3: 26
4: 204
992653642_992653646 -5 Left 992653642 5:78886599-78886621 CCCAGCCAAATGAGGGCTCAGAG 0: 1
1: 0
2: 1
3: 11
4: 154
Right 992653646 5:78886617-78886639 CAGAGTTAAGACATTAAAGTGGG 0: 1
1: 0
2: 3
3: 26
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992653646 Original CRISPR CAGAGTTAAGACATTAAAGT GGG Intronic
901729881 1:11271817-11271839 CATAGTTCAGACATGAATGTTGG + Intergenic
903909668 1:26713766-26713788 CAGACCAAAGACAATAAAGTGGG - Intronic
905911010 1:41654592-41654614 CAGAACTAAGACATTAACATTGG + Intronic
906572810 1:46859097-46859119 CAGATTTAAGACATCTAAGCTGG - Intergenic
907815578 1:57915528-57915550 CATACTTAAGACATCAAAGCTGG + Intronic
910326738 1:86017490-86017512 CAGAGATAAGACAATAAAGCTGG + Intronic
910825794 1:91405605-91405627 CAGAATTAAGACTTAAAGGTTGG - Intergenic
915394735 1:155574420-155574442 CAAAATTAAGAAATTAAAGTTGG - Intergenic
915409694 1:155690615-155690637 CAAAATTAAGAAATTAAAGCTGG - Intronic
915512178 1:156392346-156392368 AAAAGTCAAGACATTGAAGTTGG - Intergenic
915568647 1:156731783-156731805 CAGAGTTAAGCCACCAGAGTCGG + Intronic
916676668 1:167069564-167069586 AAGAGTCAAGAAAATAAAGTGGG - Intronic
917094231 1:171383927-171383949 GAAAGTTAATATATTAAAGTTGG - Intergenic
919234432 1:194821239-194821261 AGGGGTTAAGAAATTAAAGTGGG + Intergenic
919442925 1:197661144-197661166 AAGAGTTAAGTAATTTAAGTAGG - Intronic
921526165 1:216221204-216221226 CAGAGTTAAGCCAATAAAAAGGG - Intronic
923589620 1:235307767-235307789 AAGAGTTAATATTTTAAAGTAGG - Intronic
923880684 1:238100853-238100875 TTGACTTAAGATATTAAAGTTGG - Intergenic
924365962 1:243294222-243294244 CAGAGTTATCACATTACAATAGG - Intronic
1063656866 10:7999402-7999424 CAGCCTTTAGACATTAAGGTTGG - Intronic
1063991354 10:11567333-11567355 CATAGTTAAGACAATACACTGGG + Intronic
1068928754 10:62566987-62567009 CAGAGTTAAGACAAGAACTTAGG - Intronic
1069600293 10:69700954-69700976 CAAAACTAAGACATTAAGGTTGG + Intergenic
1070837093 10:79455352-79455374 CAGAGTTGAAACACAAAAGTAGG - Intergenic
1071239751 10:83692483-83692505 CAGAGCCAAGACATTCAAGGAGG - Intergenic
1074350562 10:112732906-112732928 CAGAGTTGACACAGTAAAGGTGG + Intronic
1082263798 11:50098275-50098297 CAGAGATCAGACAGTAATGTGGG + Intergenic
1082964613 11:58954242-58954264 AAGAGTTAAGTCCTTAAACTTGG - Intronic
1083119369 11:60496004-60496026 CAGAGTTAGGACTTGAAAATGGG - Intronic
1083396936 11:62398767-62398789 CAGAGATAAGACAACAAAGATGG - Intergenic
1088954071 11:114600753-114600775 CAGAATTAAGAAATTAACATTGG - Intergenic
1090673023 11:128963830-128963852 CAGAAATAAGACATTTTAGTTGG - Intergenic
1092321970 12:7485856-7485878 CAGATTTATGTCATTAAAATAGG + Intronic
1095585888 12:43848731-43848753 CAGGATTAAGAGATTAAAGACGG + Intronic
1095878551 12:47107448-47107470 CAAATTTAAGAGAGTAAAGTGGG + Intronic
1098412386 12:70200383-70200405 CAAACTGAAGACATTAAAGTTGG + Intergenic
1099198440 12:79647633-79647655 CAGAGTTAGGTCATCAAAATAGG + Intronic
1100886144 12:99072635-99072657 CAGCGTTTAGACAATACAGTGGG + Intronic
1101126237 12:101637091-101637113 CATAAATAATACATTAAAGTAGG - Intronic
1101329923 12:103749396-103749418 CAGAGCTAAGAAATTAATGTTGG - Intronic
1104277956 12:127347336-127347358 CAGGATTAAGAAATTAAAGTAGG + Intergenic
1106865302 13:33958150-33958172 TGAAGTTAAGACATCAAAGTAGG + Intronic
1109364807 13:61340501-61340523 CAGAGTTAAATCATTGAAATAGG + Intergenic
1110321414 13:74164431-74164453 AAGTGTTAACACATGAAAGTAGG + Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1115480103 14:33852179-33852201 CAGAGTTGAGACATTCTAGACGG - Intergenic
1115667399 14:35567088-35567110 CAGAGTAAATACATTAAATCAGG - Intronic
1116656871 14:47665178-47665200 AACAGTTAAGACTTGAAAGTGGG - Intronic
1117385889 14:55212434-55212456 CATATTTCAGAGATTAAAGTTGG + Intergenic
1119061396 14:71478728-71478750 CAGAGATGAGACATTAGAATAGG + Intronic
1120058203 14:79950242-79950264 CAGAATAAAAACATTAAAGAGGG - Intergenic
1120167089 14:81212423-81212445 CACAGTTTACACATTAAAGTAGG + Intronic
1121800438 14:96769823-96769845 CAGAGTTAGGACTTCAAGGTAGG + Intergenic
1122457496 14:101865593-101865615 CACAGTTAGCAGATTAAAGTTGG - Intronic
1125501941 15:40245386-40245408 CAGAGTTAAAACTTTAAAACCGG + Intronic
1127136290 15:55927177-55927199 CTGAGCTAAGACTTGAAAGTTGG + Intronic
1127157643 15:56146059-56146081 CATATTTAAGACATTAAAGTGGG - Intronic
1127536166 15:59891857-59891879 CAGAATTAGGACATTGAAGGAGG + Intergenic
1127949591 15:63792102-63792124 CTGGTTTAAGACATTAAGGTTGG - Intronic
1128822015 15:70665442-70665464 CAGAGTTAAGAAAATCAGGTTGG + Intronic
1128979200 15:72174561-72174583 CAGTGTTTTGACATTAAAGGAGG + Intronic
1135011410 16:18883229-18883251 CAGAGTTAAGCCACGACAGTGGG + Intronic
1135318321 16:21470817-21470839 CAGAGTTAAGCCATGACAGTGGG + Intergenic
1135371214 16:21902612-21902634 CAGAGTTAAGCCATGACAGTGGG + Intergenic
1135440573 16:22468103-22468125 CAGAGTTAAGCCATGACAGTGGG - Intergenic
1135936047 16:26781060-26781082 AAGATTTAAAACATTAAAGTAGG - Intergenic
1136443209 16:30292262-30292284 CAGAGTTAAGCCATGACAGTGGG + Intergenic
1138918766 16:61500742-61500764 AAGAGGTAATTCATTAAAGTTGG - Intergenic
1139274309 16:65713389-65713411 CAGAGTTCATAAATGAAAGTGGG + Intergenic
1139889935 16:70244683-70244705 CAGAGTTAAGCCATGACAGTGGG + Intergenic
1140106811 16:71968162-71968184 CAGACCTAAGTCACTAAAGTGGG + Intronic
1140653100 16:77109880-77109902 AAGAGGTAACTCATTAAAGTGGG + Intergenic
1140707342 16:77643091-77643113 CAGAGTTTGGAAATTAAAGGGGG - Intergenic
1141393973 16:83688417-83688439 CAGATTTAAGAGTTTAAATTGGG + Intronic
1142484201 17:236206-236228 CAGAGGTAGGACATTAGAGTGGG - Intronic
1144031970 17:11331218-11331240 CAGAGTCAAGCCAATAAAGAAGG - Intronic
1146224892 17:31057220-31057242 CAAAATTAAGACATTAACATTGG - Intergenic
1149386611 17:56149031-56149053 CAGAGTCAAGACATAAACTTGGG + Intronic
1149856232 17:60085457-60085479 GAAAGTGAAGACATTTAAGTGGG - Intergenic
1153088135 18:1312502-1312524 CACTGTTAATAGATTAAAGTTGG + Intergenic
1156332403 18:36135461-36135483 CAGAGTTAGGACATGAACCTGGG + Intronic
1156844833 18:41653112-41653134 AAAAGTTAGGACATTAAAGAAGG + Intergenic
1159219735 18:65444182-65444204 CAGAGTATAGACATAAAACTTGG - Intergenic
1159779826 18:72648188-72648210 CTCAATTAAGACATTAAAATGGG - Intergenic
1160471922 18:79143816-79143838 AAGAGTTCAGACATACAAGTTGG + Exonic
1164391841 19:27829932-27829954 CACATTTAAAACAGTAAAGTTGG - Intergenic
1168567351 19:57435934-57435956 CAGAGTTAGAAGTTTAAAGTTGG + Intronic
925565543 2:5250240-5250262 CAGAGTTAAGAGATTAGAAGTGG - Intergenic
926602622 2:14862501-14862523 CACAGTTAAGAAAATAAGGTAGG - Intergenic
927043072 2:19249378-19249400 CAGATTAAAGATATTAAAGCAGG + Intergenic
927043420 2:19253201-19253223 CAGAGGTAAGATATGAATGTGGG - Intergenic
933394751 2:81716897-81716919 AAGAGATAAGACATTAAAGTTGG + Intergenic
933464269 2:82631947-82631969 CTGTGTTAAAACATTAAAATTGG - Intergenic
933643232 2:84786643-84786665 CAAATTTAAGAAATTAAGGTAGG + Intronic
938175119 2:129118662-129118684 CAGAGTAAACACATTATATTAGG - Intergenic
938662382 2:133500623-133500645 GGGAGTTCAAACATTAAAGTAGG + Intronic
939630964 2:144525301-144525323 CAGACTTTAGACATTACAATAGG + Intergenic
941799695 2:169644822-169644844 AATGGTTAAGACATTAAATTAGG + Intergenic
942148654 2:173052258-173052280 CAGAGGTAAGACAATGAAGATGG - Exonic
942728031 2:179032073-179032095 CTGAGTCAAGCCAGTAAAGTGGG - Intronic
943057713 2:183003896-183003918 TAGAGTTAAGACATGAAAGAGGG + Intronic
945097647 2:206234696-206234718 CAGAGTTATGAGAGTAAAGAAGG - Intergenic
948534688 2:238637213-238637235 CAGAGTTATAACAGGAAAGTTGG - Intergenic
1169843783 20:9967585-9967607 CACAGTTATGAAATTAAAATAGG + Intergenic
1172625321 20:36343360-36343382 CAGTTTTGAGACATTAAAATTGG - Intronic
1174303405 20:49598547-49598569 CATAGGTAAGACATTTAAATGGG - Intergenic
1176031802 20:63016406-63016428 CAGAGTTGTGACTGTAAAGTGGG + Intergenic
1181757395 22:25033931-25033953 CAGATTTAACACATTCAACTTGG + Intronic
1182924933 22:34113405-34113427 CAGTTTTAAGAAATTAACGTGGG + Intergenic
1183069280 22:35385042-35385064 CAAAGTTAAGACATTTAGGTTGG - Intronic
949545660 3:5070079-5070101 CTGTGTTAAGACACTAAAATTGG - Intergenic
951236900 3:20247133-20247155 CAAAATGAAGAAATTAAAGTTGG - Intergenic
951856923 3:27207657-27207679 CAGAATTAACACATTGCAGTGGG - Intronic
951969448 3:28427758-28427780 CACACTTAAGTCATAAAAGTGGG - Intronic
952648198 3:35688229-35688251 GAGAGTTAAGATATCAAACTTGG - Intronic
953831352 3:46300223-46300245 CAAAGCTCAGACTTTAAAGTAGG - Intergenic
954969935 3:54643042-54643064 CAGGGAAAAGACATCAAAGTGGG + Intronic
955413366 3:58670251-58670273 CAGAGTTAGGACATACAAGCAGG - Intergenic
955949528 3:64228253-64228275 CAGAGAGAAGACAATTAAGTAGG + Intronic
956512774 3:70012566-70012588 TAGAGGTCAGACATTACAGTGGG - Intergenic
957810667 3:85217532-85217554 CAGATTTAATACATAAATGTAGG - Intronic
958042934 3:88247572-88247594 CTGAATTAAGACAGTAAAGGGGG + Intergenic
958085942 3:88806969-88806991 GAGATTTGAGACATTAAACTTGG - Intergenic
959761474 3:109970612-109970634 AAGAGTGAAGAAATTAAAGATGG - Intergenic
960008004 3:112801248-112801270 GGGAGATAAGACAATAAAGTTGG - Intronic
962302675 3:134256854-134256876 CAGACTAAATACATTAAATTAGG - Intergenic
963371161 3:144402282-144402304 CATACTTAAGTCATTATAGTAGG + Intergenic
965449942 3:168825289-168825311 CAGTTTTAAGACAATAAAGAAGG + Intergenic
965764290 3:172113830-172113852 CAGAGTGAAGACTGTAAAGTGGG - Intronic
966068675 3:175847770-175847792 CAGAATTAGGACATTAATGTAGG + Intergenic
966166756 3:177028077-177028099 CAGAGCTAAGACATTTAAAAAGG + Intronic
966561680 3:181327641-181327663 CGGAGTTAAGATTTTAAACTTGG - Intergenic
966966508 3:185000223-185000245 CAGAATTATGACTTTTAAGTAGG + Intronic
968197927 3:196724888-196724910 CAGAGTCAAGACATTAATCCAGG - Intronic
970368914 4:15388760-15388782 GAGAGTTATGACAGTAATGTTGG + Intronic
971789198 4:31145712-31145734 CAAAGTTAAGGCATTAATATGGG + Intronic
972402167 4:38715601-38715623 CAGCTTAAACACATTAAAGTTGG + Intergenic
973572499 4:52254818-52254840 CAGTGTTAAGATTTTATAGTAGG + Intergenic
974058223 4:57005731-57005753 CAGAATGAAGTCATTAAAGCAGG + Intronic
974116765 4:57588544-57588566 CAAAGTTATGACAATAATGTAGG + Intergenic
974164692 4:58186069-58186091 CAGGATTAAGAGATTAAAGATGG + Intergenic
974671891 4:65041897-65041919 CACAGTTAAGAAATTAACGTTGG - Intergenic
975025694 4:69545937-69545959 CAGAGCTAAGAAAATAAATTAGG - Intergenic
975167566 4:71194738-71194760 CAGATTTAAAATATTACAGTGGG + Intronic
976465782 4:85367300-85367322 CAAAATGAAGACATTAATGTTGG + Intergenic
978716829 4:111854717-111854739 CATAGTTCAGAAATAAAAGTTGG + Intergenic
978787165 4:112622711-112622733 AAGAGTTAGGATATTAAAGTTGG - Intronic
981340255 4:143614022-143614044 CATAGATATGACATTCAAGTAGG + Intronic
982081029 4:151790408-151790430 CAGAGTTAATATATTACACTGGG - Intergenic
982761412 4:159288822-159288844 CAGAGTAAAGACCTTCAGGTGGG - Intronic
983273851 4:165593777-165593799 CAGAGTAAAAACAGTAATGTGGG + Intergenic
984048295 4:174830244-174830266 CTAAGTTAAGAGATGAAAGTAGG - Intronic
986924551 5:12731215-12731237 CAGAGTTCAGACCCTGAAGTGGG + Intergenic
987978317 5:25044816-25044838 CAGGATTAAGAGATTAAAGTAGG + Intergenic
988455259 5:31381802-31381824 CAGAGTTAAGCAATGAAGGTAGG - Intergenic
988864831 5:35323882-35323904 CAGAGGGAAGACACTGAAGTGGG + Intergenic
992653646 5:78886617-78886639 CAGAGTTAAGACATTAAAGTGGG + Intronic
993533301 5:89049881-89049903 CAGGATTAAGAGATGAAAGTAGG - Intergenic
993886833 5:93424756-93424778 CAGAATTAACACATCAAACTGGG + Intergenic
995354396 5:111222389-111222411 CAGAGTTCAGGCAGTAATGTGGG - Intergenic
995903635 5:117097338-117097360 CTGATTCAAGACATAAAAGTAGG + Intergenic
996586566 5:125094488-125094510 CCTAGTTAAGACATTAAGATTGG - Intergenic
999519592 5:152337562-152337584 CAGTGTTAATCCATTAAAGAGGG - Intergenic
999552234 5:152701918-152701940 CAGACCTAAGACAGTAAAGAAGG + Intergenic
1000207407 5:159075628-159075650 CAGAGTGGAGACAGAAAAGTAGG - Intronic
1001160204 5:169305998-169306020 CAGGGTTAAGAAATCAAAGAGGG - Intergenic
1003285327 6:4729054-4729076 CAGAGAGAAGACATTAAATAAGG - Intronic
1003724697 6:8747795-8747817 GAGAGTTAAGAGGTTGAAGTTGG + Intergenic
1004152883 6:13137380-13137402 CATAGTTAAGACATTGGAATAGG - Intronic
1004199834 6:13537530-13537552 CAGTGTTATAAAATTAAAGTTGG + Intergenic
1005352166 6:24947432-24947454 TACATTTCAGACATTAAAGTAGG - Intronic
1009491577 6:64299125-64299147 CTGAGTTAATAGCTTAAAGTAGG + Intronic
1011345749 6:86368342-86368364 CAGAGCAAAGGAATTAAAGTTGG + Intergenic
1012831225 6:104205811-104205833 TAAGGTTAACACATTAAAGTAGG - Intergenic
1013982247 6:116145488-116145510 CTTATTTAAGAGATTAAAGTGGG + Intronic
1014573600 6:123042517-123042539 CAGAGATAAGAGTTTAAATTGGG - Intronic
1015861134 6:137681398-137681420 CAGAGCTAAGAAATTCAAGGTGG - Intergenic
1016432502 6:144002066-144002088 CAAAGTTAAGAAATTAACATTGG - Intronic
1017167323 6:151421452-151421474 GTGAGTTAAGACATTAATCTGGG - Intronic
1017272184 6:152520192-152520214 CAAAGTAAGGACATTAAAATTGG - Intronic
1020041322 7:5004542-5004564 CAGAATTAAAACATTTAAGCTGG - Intronic
1020371060 7:7432455-7432477 CAAAGGTAAGACTTTAAAGTAGG - Exonic
1021530125 7:21634850-21634872 CAGATTTAAAACATTTAAGTTGG + Intronic
1024882465 7:54104149-54104171 CAGAGTTAAGACTTGAAATTAGG + Intergenic
1025723018 7:64033532-64033554 CAGGATTAAGAGATTAAAGACGG + Intronic
1027288525 7:76675999-76676021 CAAAGTTAATACAATTAAGTAGG - Intergenic
1028655724 7:93204425-93204447 CTCAGTTAAAACTTTAAAGTAGG + Intronic
1030930082 7:115511982-115512004 CAAACTTAAGAAATTAATGTTGG - Intergenic
1031388998 7:121189815-121189837 CAGAGTTAAGATGATAAAATAGG - Intronic
1031511239 7:122652858-122652880 CATAGTTAAGATATGAAATTAGG - Intronic
1031671894 7:124558131-124558153 CACAGGAAAGAAATTAAAGTAGG + Intergenic
1035420834 7:158728128-158728150 AACAGTTGAGACATGAAAGTTGG - Intergenic
1036394045 8:8351483-8351505 AAGAGTAGAGACATCAAAGTAGG - Intronic
1036414710 8:8536301-8536323 TAGACTTAGGACATCAAAGTTGG - Intergenic
1036910189 8:12752361-12752383 CAGAGCTAACAAATTAGAGTTGG - Intronic
1037122245 8:15302711-15302733 AATAGTTAAAACATTAAACTCGG + Intergenic
1037327044 8:17702952-17702974 CAGGATTAAGAGATTAAAGTAGG - Intronic
1037590491 8:20308003-20308025 CAGAGATAAGAGATTCAAGGTGG - Intergenic
1039182914 8:34886618-34886640 CACAGTTCAGTCATTAATGTGGG + Intergenic
1042937178 8:74071385-74071407 CAGAGTTAACTCTTTAATGTAGG + Intergenic
1043705969 8:83351341-83351363 CAAAAATAAAACATTAAAGTGGG + Intergenic
1043734206 8:83724014-83724036 CAGAGAGAAGACCCTAAAGTGGG + Intergenic
1043774223 8:84244566-84244588 CAGATGTAAGACAGTACAGTGGG - Intronic
1043983813 8:86670756-86670778 CAAAGTTAAGACAGTACAGATGG - Intronic
1044394579 8:91695690-91695712 CATAGTTAAAACATTAATTTTGG - Intergenic
1044998609 8:97860523-97860545 CAGATTGAATACATCAAAGTAGG + Intergenic
1046012872 8:108571704-108571726 AAGAGTCAAGACATTACATTGGG - Intergenic
1046351044 8:113012903-113012925 GAGAGTTATAACATTAGAGTAGG + Intronic
1046508047 8:115161486-115161508 CTGAGTTTAGAGATTAAAGATGG - Intergenic
1047895469 8:129361679-129361701 CAGAGTTAAGAGAAAAATGTTGG + Intergenic
1048098238 8:131317984-131318006 AAGAATGAAGACATAAAAGTGGG - Intergenic
1048692064 8:136977671-136977693 CAGAGATAAGAATTGAAAGTGGG + Intergenic
1050188183 9:2997203-2997225 CAGAGTTAGGAGAATAAAGAAGG - Intergenic
1051122792 9:13770127-13770149 CAAGGTTAAGACAATAAAGAGGG + Intergenic
1051377808 9:16421724-16421746 CAGAGTAAAGACCTCACAGTAGG - Intronic
1053256592 9:36621670-36621692 TAGAGTTAAGTCAATAAATTAGG - Intronic
1062496560 9:136834383-136834405 CAGAGTTCACACATTACATTTGG + Intronic
1188151570 X:26682291-26682313 AAAAGTAAAGATATTAAAGTGGG - Intergenic
1189601599 X:42632630-42632652 CAGAGGTAAGACATCACAGTGGG + Intergenic
1190982236 X:55466499-55466521 CAGAGTTGAGACTTCAATGTGGG + Intergenic
1190986462 X:55506683-55506705 CAGAGTTGAGACTTCAATGTGGG - Intergenic
1193866218 X:86733683-86733705 CACATTTAAGAAATTTAAGTTGG + Intronic
1194036237 X:88875974-88875996 CAGAGTCAAACCATTTAAGTGGG - Intergenic
1195529461 X:105935985-105936007 CAGAGTTAAGACATTATAGAAGG - Intronic
1197156293 X:123273502-123273524 CAGAGTTAAGACTTGAACTTAGG + Intronic
1197289545 X:124638549-124638571 CATAGTAAAGACATTAATGTTGG + Intronic
1197725133 X:129771149-129771171 CAGAGTTAATCCCTTAAAGCAGG - Intergenic
1200361872 X:155615497-155615519 AAGAGTTAAAAAATTAAAGAAGG + Intronic
1201061420 Y:10050083-10050105 CTGAGTTAAGACAATGAATTTGG + Intergenic
1201793599 Y:17870165-17870187 CAGATGTAAGTCATTAAAGAAGG - Intergenic
1201807955 Y:18035821-18035843 CAGATGTAAGTCATTAAAGAAGG + Intergenic
1201978583 Y:19881632-19881654 CTCAGTTAAGACCTTAAACTTGG - Intergenic
1202354982 Y:24037987-24038009 CAGACGTAAGTCATTAAAGAAGG - Intergenic
1202515796 Y:25632122-25632144 CAGACGTAAGTCATTAAAGAAGG + Intergenic