ID: 992654437

View in Genome Browser
Species Human (GRCh38)
Location 5:78894521-78894543
Sequence CAGTGAGATCCTTTAGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992654437_992654440 5 Left 992654437 5:78894521-78894543 CCAGATTCTAAAGGATCTCACTG 0: 1
1: 0
2: 1
3: 7
4: 135
Right 992654440 5:78894549-78894571 TGGGTGTTTAATGCAGAGAGAGG 0: 1
1: 0
2: 0
3: 19
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992654437 Original CRISPR CAGTGAGATCCTTTAGAATC TGG (reversed) Intronic
901751435 1:11412433-11412455 CAGTGAGATCCTGGAGAGGCGGG + Intergenic
903486582 1:23693816-23693838 CTGTCAGATCCTTTGGCATCCGG + Exonic
909243279 1:73242193-73242215 CATTGAGATCATTTACATTCAGG - Intergenic
909789026 1:79650017-79650039 CAGTAAGATCTTATAGAATGTGG - Intergenic
909999521 1:82325857-82325879 CAGTGTGATCCTTAAGCCTCTGG + Intergenic
914242906 1:145864067-145864089 CAGTGAATTCCTCTAAAATCTGG - Intergenic
916150058 1:161779162-161779184 CCATGAGATACTTTAGAATGTGG + Intronic
916568784 1:166007328-166007350 GAATGAGATCCTTGAGATTCAGG - Intergenic
919158153 1:193793509-193793531 TAGTGAGAACATTTAAAATCTGG - Intergenic
919239991 1:194902297-194902319 AAGTGAGATCCTTTAGGGACAGG - Intergenic
920346828 1:205311319-205311341 CAGTGAGCTCCTTAGCAATCTGG - Intronic
921475867 1:215608769-215608791 CAGTGAGATTCTTTCAAATGGGG - Intronic
922996294 1:229964432-229964454 AAGTGAGATGCTTTGGATTCTGG - Intergenic
1062999600 10:1903330-1903352 CAGAGACATTGTTTAGAATCGGG - Intergenic
1065876063 10:29998468-29998490 CAGTGAGGTCCCTAAGAAGCCGG - Intergenic
1066245825 10:33582514-33582536 TAGTGAGCCACTTTAGAATCTGG - Intergenic
1074914560 10:117942952-117942974 CAGGGTAATCCTTTAGAATTTGG + Intergenic
1075011973 10:118880105-118880127 CATTGAGATTGTTTTGAATCTGG - Intergenic
1076259789 10:129056099-129056121 CAGTGAGAGGCTTCAGAAACAGG - Intergenic
1076465599 10:130679412-130679434 CAGAGAGATCTTTTAAAAACTGG - Intergenic
1079043564 11:17080166-17080188 CGGTTAGAGCGTTTAGAATCGGG - Intronic
1079261913 11:18890709-18890731 CAGTGAGATTCTTTTCATTCTGG + Intergenic
1080119452 11:28660401-28660423 AAGTGAGAGCCTCTAGATTCTGG + Intergenic
1080279750 11:30543198-30543220 ACGTGAGATCCTTGAGAATGAGG - Intronic
1080413325 11:32046642-32046664 CAGTGAGATCCTTGAAGTTCTGG + Intronic
1086794162 11:91079964-91079986 CAGTGAGATCCTTGAGAGAAAGG + Intergenic
1087315449 11:96597187-96597209 CAGCAGGATCCTTTAGAATAAGG - Intergenic
1091436325 12:475894-475916 CAGGCAGTTCCCTTAGAATCGGG + Intronic
1092548130 12:9469257-9469279 CACTGTGAACCTTTAGAATTGGG - Intergenic
1093250246 12:16793936-16793958 AAGTGAGATTCGTTAGAATTGGG + Intergenic
1097719329 12:63003027-63003049 CAGTGGGATCCTTTATAAGTAGG + Intergenic
1098382244 12:69881420-69881442 CAGTGTAAACCTCTAGAATCTGG - Intronic
1098568089 12:71957629-71957651 CCTTAAGATCCTTTAGAGTCTGG - Intronic
1100596593 12:96077510-96077532 CAGGGAGATCTTTTATAAACGGG + Intergenic
1101144288 12:101826919-101826941 CAGGGAGAGCCTTCAGAATGGGG - Intronic
1101398847 12:104371270-104371292 CAGGGAGACACTTGAGAATCAGG + Intergenic
1103337664 12:120201828-120201850 CAGAGGGATCCTTTAAAACCTGG + Intergenic
1107030009 13:35840965-35840987 CAGTGAGATCCTTCATCCTCTGG + Intronic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1109206853 13:59492281-59492303 CAGTGTGAAGATTTAGAATCTGG - Intergenic
1111283829 13:86063127-86063149 CTATGACATCCTTTAAAATCTGG - Intergenic
1111586868 13:90292673-90292695 CAGTGTGTTCCTTTAGGATTGGG - Intergenic
1113576640 13:111399729-111399751 CAGTGAGAACCTTAAGGAACTGG + Intergenic
1114234056 14:20809277-20809299 CTCTGAGATGCTTTAGAACCAGG - Intergenic
1115450039 14:33537575-33537597 CAGTGTGATCATTTAAAATAAGG - Intronic
1115881328 14:37922718-37922740 GAGTAAGAACCTTTGGAATCAGG + Intronic
1115925585 14:38429740-38429762 CCATGAGATCTTCTAGAATCTGG - Intergenic
1121372571 14:93374014-93374036 CAGTGACATCTTTTGAAATCTGG - Intronic
1121682393 14:95804479-95804501 CAGTGAGCTCCTTCAGGACCAGG + Intergenic
1123727793 15:23121896-23121918 GAGTGATTTCCTTTATAATCGGG - Intergenic
1126652056 15:50933330-50933352 CAATTAAATACTTTAGAATCCGG - Intronic
1128822465 15:70671982-70672004 CAGAGTGATCATTTAGGATCAGG - Exonic
1131424728 15:92336294-92336316 CAGAGTGATCTTTTAAAATCAGG - Intergenic
1131741958 15:95402565-95402587 CAGTGAGGTCCTGTAGAAAAAGG - Intergenic
1133890969 16:9878164-9878186 CAGAGAGATCCTTAACAATTTGG + Intronic
1134207451 16:12249707-12249729 CAGGGAGATCATTGAGAATTAGG + Intronic
1135606925 16:23833520-23833542 CAGGGAAATCCTTTATAATATGG - Intergenic
1137748732 16:50842390-50842412 CAGGCTGATCCTTTAGAAACAGG + Intergenic
1139326274 16:66154925-66154947 CAGTGCGTCCCTTGAGAATCTGG - Intergenic
1140788181 16:78363799-78363821 CAGTGAGGTCCTGTAGGATGAGG + Intronic
1141328190 16:83082341-83082363 CAGGGAGATCTTTCTGAATCTGG - Intronic
1143883165 17:10045766-10045788 CTGTGGGATCTCTTAGAATCAGG - Intronic
1145200640 17:20941800-20941822 CAGTGAGCTCCCTTTGTATCTGG + Intergenic
1149288128 17:55188650-55188672 TTGTGGGATCCTTTAAAATCAGG - Intergenic
1152523451 17:80873781-80873803 CAGTGAGATTCTTCACATTCTGG - Intronic
1153505471 18:5792573-5792595 AAGTGAGAGCATTTAGTATCTGG - Intergenic
1156376842 18:36522171-36522193 CTGTGAGATCCTTGAGAGCCAGG + Intronic
1157008059 18:43610313-43610335 CAGTGAGCTCAGTTAGGATCAGG - Intergenic
1157734351 18:50033478-50033500 CAGTGAGCCCCTTAAGAAGCAGG + Intronic
1158726483 18:59977807-59977829 CAGTGATATTCCTTAGAATAAGG + Intergenic
1159606934 18:70484608-70484630 TTGTGAGATCCATTAGGATCTGG + Intergenic
1159729723 18:72010330-72010352 AAGTAAGATCCTTTAGAACCAGG - Intergenic
1161263646 19:3352315-3352337 CAGTGAGACCCTGTAGAAAAAGG + Intergenic
1166295041 19:41884739-41884761 CAGTGGCATCCCCTAGAATCCGG + Intronic
926476030 2:13323623-13323645 CTGTGAGCTTCTTTAGAACCAGG + Intergenic
927382853 2:22499149-22499171 GAGGGAGATCCTTCAGCATCAGG + Intergenic
928223436 2:29424965-29424987 CAGTGAATGCCTTTAGAATAGGG - Intronic
928735742 2:34286668-34286690 CAGTGGGGTCCATGAGAATCTGG - Intergenic
932084845 2:68748895-68748917 CAGAGAAATCCTTCAGACTCAGG + Intronic
932668183 2:73714287-73714309 CAGTAATATGTTTTAGAATCAGG + Intergenic
933066109 2:77798953-77798975 CAGTTAAACCATTTAGAATCTGG - Intergenic
933150544 2:78909764-78909786 CAGGGAGAGCCTCTAGAAGCTGG + Intergenic
934055249 2:88246105-88246127 GAGTAAGATCCTTAAGAAACAGG - Intergenic
943590480 2:189790188-189790210 CACTGAGCTCCTTTAGAGTTAGG - Intronic
944183451 2:196922630-196922652 GAGAGACATCCTTTAAAATCTGG + Intronic
1169105224 20:2988801-2988823 CAGTGAGTTCCTTGAGAATAGGG - Intronic
1175143193 20:56875698-56875720 CTGGGAGATCCTTTAAAATAAGG - Intergenic
1175202963 20:57290594-57290616 TAATGAGATCATTTAGAATAGGG - Intergenic
1176660392 21:9629694-9629716 CAGTGAGTTCCCTTAGAGGCGGG + Intergenic
1185171484 22:49297181-49297203 GAGTGAGATCCTATAGAAAGAGG + Intergenic
950385798 3:12658742-12658764 CAGTAAAACCCCTTAGAATCTGG + Intronic
961265089 3:125635102-125635124 CAGGGACCTCGTTTAGAATCAGG - Intergenic
963033985 3:141009037-141009059 CACTGAGAACCTTCAGAACCTGG + Intergenic
963467453 3:145701378-145701400 CTGTGAGATCCTATAGAAAGGGG - Intergenic
970702740 4:18762144-18762166 CAGAGAAAGCCTTTAGAATATGG - Intergenic
978114395 4:105002425-105002447 CTGTGAGCTCCTTTAGAGTCTGG + Intergenic
982682304 4:158445605-158445627 CAGGCAGATCCTTTGAAATCAGG - Intronic
983951217 4:173644104-173644126 CAGTGAATCCCTTTATAATCTGG - Intergenic
985414965 4:189726723-189726745 CAGTGAGTTCCCTTAGAGGCGGG - Intergenic
988490832 5:31703828-31703850 CAGTGATTTCTTTTACAATCAGG - Intronic
988545284 5:32151037-32151059 GAGTGAAAACCTTTATAATCTGG + Intronic
989095734 5:37779603-37779625 CAGGGTGATTCTTTTGAATCGGG + Intergenic
991553260 5:67866664-67866686 CAGTTAGATCATTAAAAATCAGG - Intergenic
992654437 5:78894521-78894543 CAGTGAGATCCTTTAGAATCTGG - Intronic
993116954 5:83730535-83730557 CAATGAGATTCTTTATATTCAGG + Intergenic
994284611 5:97949543-97949565 CAGTGAGATCACTTGGACTCAGG - Intergenic
995077553 5:108004752-108004774 CAGTGGCATCCTATAGAATTTGG - Intronic
995165392 5:109033982-109034004 TAGTGAGATCATTTAAAATCTGG + Intronic
995585305 5:113642524-113642546 CTGTGACATCTTTTATAATCTGG - Intergenic
998960074 5:147476905-147476927 CCTTTAGATGCTTTAGAATCAGG + Intronic
998994758 5:147859088-147859110 CAGTGAGATCATTTGCAACCTGG - Intergenic
1000724239 5:164749186-164749208 CTCTGAGATACTTTAAAATCTGG + Intergenic
1010356208 6:74936976-74936998 CAGTGTGATCCTTTGGCATCTGG - Intergenic
1011838988 6:91472942-91472964 AAGTTGGATCCTTTAGAAACAGG + Intergenic
1017729269 6:157300628-157300650 CAGTGGGATCCTTTATAAATAGG - Intronic
1018621462 6:165733030-165733052 CAATGAGAACCTTTGGAATTCGG - Intronic
1018949189 6:168367740-168367762 CAGTGAGATCATCTATCATCTGG - Intergenic
1021443189 7:20703087-20703109 CAGCGAGTTACTATAGAATCAGG + Intronic
1022315650 7:29242708-29242730 AAGTGAGATACTTTATAGTCTGG + Intronic
1024355427 7:48409629-48409651 CATTGATACCCTTTGGAATCAGG - Intronic
1026620802 7:71948419-71948441 CACTGAGCTCCATTAGAATTTGG + Intronic
1027289566 7:76690462-76690484 CAGTGAGAAATTTTAGAATTTGG + Intergenic
1027887956 7:83933617-83933639 CAGTGGGATCTTGTAGGATCTGG + Intergenic
1027903131 7:84144016-84144038 CAGTGATATCCTTTAGAAGAAGG - Intronic
1028254883 7:88582645-88582667 AAGTTTGATCCTTTTGAATCTGG + Intergenic
1028352453 7:89865505-89865527 GAGTGAGGTCCTTTGTAATCTGG - Intergenic
1029065659 7:97845444-97845466 AAGTGAGATCCTTTATAATCTGG - Intergenic
1038130123 8:24720632-24720654 CAGTTTAATCCTTTGGAATCTGG - Intergenic
1040920708 8:52613407-52613429 CAGTAATTTCCTTTAGAATCGGG + Intergenic
1041135670 8:54755793-54755815 CAGAGAGATTGTTAAGAATCTGG - Intergenic
1044061498 8:87641939-87641961 GAGTGAGATCCTTTTCATTCTGG - Intergenic
1045226672 8:100254057-100254079 CAGTGATATCCCAAAGAATCTGG + Intronic
1050220606 9:3385068-3385090 CATTGAGATCTATTAGAATGAGG + Intronic
1050599572 9:7236711-7236733 CAGTGAGATCCCTTGGGATATGG + Intergenic
1051007234 9:12360475-12360497 CAATGAGAACCTGTAGAAGCTGG + Intergenic
1058926047 9:109665434-109665456 CAGTCAGGTCCTTTAGATGCAGG + Intronic
1059743651 9:117179748-117179770 CAGTGGGGTCTTTCAGAATCAGG - Intronic
1061388661 9:130305171-130305193 CAGTGAGAGCCATTAGACTTTGG - Intronic
1203637961 Un_KI270750v1:131537-131559 CAGTGAGTTCCCTTAGAGGCGGG + Intergenic
1186179537 X:6959518-6959540 CATTGACATCCTTTAAAATTTGG - Intergenic
1186263531 X:7806952-7806974 AAGTGAAATTCTTTAGAATGGGG + Intergenic
1186846607 X:13536908-13536930 CTGGGAGATCCTTTATAATATGG - Intergenic
1191956082 X:66643664-66643686 CAGTGAGAGAAGTTAGAATCAGG - Intergenic
1199161139 X:144613576-144613598 CAGTGACTTCCTTTAAATTCTGG - Intergenic