ID: 992656574

View in Genome Browser
Species Human (GRCh38)
Location 5:78916303-78916325
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 1, 2: 5, 3: 16, 4: 271}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992656574_992656585 9 Left 992656574 5:78916303-78916325 CCCAGAAATCTTCCCTGGCCTGT 0: 1
1: 1
2: 5
3: 16
4: 271
Right 992656585 5:78916335-78916357 GAAGAAAGGAGACTGGGCCTGGG 0: 1
1: 0
2: 2
3: 61
4: 478
992656574_992656584 8 Left 992656574 5:78916303-78916325 CCCAGAAATCTTCCCTGGCCTGT 0: 1
1: 1
2: 5
3: 16
4: 271
Right 992656584 5:78916334-78916356 AGAAGAAAGGAGACTGGGCCTGG 0: 1
1: 1
2: 10
3: 118
4: 1120
992656574_992656582 3 Left 992656574 5:78916303-78916325 CCCAGAAATCTTCCCTGGCCTGT 0: 1
1: 1
2: 5
3: 16
4: 271
Right 992656582 5:78916329-78916351 AGTCCAGAAGAAAGGAGACTGGG 0: 1
1: 1
2: 1
3: 25
4: 361
992656574_992656581 2 Left 992656574 5:78916303-78916325 CCCAGAAATCTTCCCTGGCCTGT 0: 1
1: 1
2: 5
3: 16
4: 271
Right 992656581 5:78916328-78916350 CAGTCCAGAAGAAAGGAGACTGG 0: 1
1: 1
2: 0
3: 37
4: 338
992656574_992656579 -5 Left 992656574 5:78916303-78916325 CCCAGAAATCTTCCCTGGCCTGT 0: 1
1: 1
2: 5
3: 16
4: 271
Right 992656579 5:78916321-78916343 CCTGTTCCAGTCCAGAAGAAAGG 0: 1
1: 0
2: 2
3: 10
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992656574 Original CRISPR ACAGGCCAGGGAAGATTTCT GGG (reversed) Intronic