ID: 992656575

View in Genome Browser
Species Human (GRCh38)
Location 5:78916304-78916326
Sequence AACAGGCCAGGGAAGATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 223}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992656575_992656579 -6 Left 992656575 5:78916304-78916326 CCAGAAATCTTCCCTGGCCTGTT 0: 1
1: 0
2: 1
3: 24
4: 223
Right 992656579 5:78916321-78916343 CCTGTTCCAGTCCAGAAGAAAGG 0: 1
1: 0
2: 2
3: 10
4: 171
992656575_992656581 1 Left 992656575 5:78916304-78916326 CCAGAAATCTTCCCTGGCCTGTT 0: 1
1: 0
2: 1
3: 24
4: 223
Right 992656581 5:78916328-78916350 CAGTCCAGAAGAAAGGAGACTGG 0: 1
1: 1
2: 0
3: 37
4: 338
992656575_992656584 7 Left 992656575 5:78916304-78916326 CCAGAAATCTTCCCTGGCCTGTT 0: 1
1: 0
2: 1
3: 24
4: 223
Right 992656584 5:78916334-78916356 AGAAGAAAGGAGACTGGGCCTGG 0: 1
1: 1
2: 10
3: 118
4: 1120
992656575_992656582 2 Left 992656575 5:78916304-78916326 CCAGAAATCTTCCCTGGCCTGTT 0: 1
1: 0
2: 1
3: 24
4: 223
Right 992656582 5:78916329-78916351 AGTCCAGAAGAAAGGAGACTGGG 0: 1
1: 1
2: 1
3: 25
4: 361
992656575_992656585 8 Left 992656575 5:78916304-78916326 CCAGAAATCTTCCCTGGCCTGTT 0: 1
1: 0
2: 1
3: 24
4: 223
Right 992656585 5:78916335-78916357 GAAGAAAGGAGACTGGGCCTGGG 0: 1
1: 0
2: 2
3: 61
4: 478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992656575 Original CRISPR AACAGGCCAGGGAAGATTTC TGG (reversed) Intronic