ID: 992656576

View in Genome Browser
Species Human (GRCh38)
Location 5:78916315-78916337
Sequence TTCTGGACTGGAACAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 211}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992656576_992656584 -4 Left 992656576 5:78916315-78916337 CCCTGGCCTGTTCCAGTCCAGAA 0: 1
1: 0
2: 0
3: 23
4: 211
Right 992656584 5:78916334-78916356 AGAAGAAAGGAGACTGGGCCTGG 0: 1
1: 1
2: 10
3: 118
4: 1120
992656576_992656581 -10 Left 992656576 5:78916315-78916337 CCCTGGCCTGTTCCAGTCCAGAA 0: 1
1: 0
2: 0
3: 23
4: 211
Right 992656581 5:78916328-78916350 CAGTCCAGAAGAAAGGAGACTGG 0: 1
1: 1
2: 0
3: 37
4: 338
992656576_992656587 29 Left 992656576 5:78916315-78916337 CCCTGGCCTGTTCCAGTCCAGAA 0: 1
1: 0
2: 0
3: 23
4: 211
Right 992656587 5:78916367-78916389 AAACTGTCTTTAGTTTAAAGAGG 0: 1
1: 0
2: 2
3: 39
4: 344
992656576_992656585 -3 Left 992656576 5:78916315-78916337 CCCTGGCCTGTTCCAGTCCAGAA 0: 1
1: 0
2: 0
3: 23
4: 211
Right 992656585 5:78916335-78916357 GAAGAAAGGAGACTGGGCCTGGG 0: 1
1: 0
2: 2
3: 61
4: 478
992656576_992656582 -9 Left 992656576 5:78916315-78916337 CCCTGGCCTGTTCCAGTCCAGAA 0: 1
1: 0
2: 0
3: 23
4: 211
Right 992656582 5:78916329-78916351 AGTCCAGAAGAAAGGAGACTGGG 0: 1
1: 1
2: 1
3: 25
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992656576 Original CRISPR TTCTGGACTGGAACAGGCCA GGG (reversed) Intronic