ID: 992656577

View in Genome Browser
Species Human (GRCh38)
Location 5:78916316-78916338
Sequence CTTCTGGACTGGAACAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992656577_992656582 -10 Left 992656577 5:78916316-78916338 CCTGGCCTGTTCCAGTCCAGAAG 0: 1
1: 0
2: 0
3: 17
4: 168
Right 992656582 5:78916329-78916351 AGTCCAGAAGAAAGGAGACTGGG 0: 1
1: 1
2: 1
3: 25
4: 361
992656577_992656584 -5 Left 992656577 5:78916316-78916338 CCTGGCCTGTTCCAGTCCAGAAG 0: 1
1: 0
2: 0
3: 17
4: 168
Right 992656584 5:78916334-78916356 AGAAGAAAGGAGACTGGGCCTGG 0: 1
1: 1
2: 10
3: 118
4: 1120
992656577_992656587 28 Left 992656577 5:78916316-78916338 CCTGGCCTGTTCCAGTCCAGAAG 0: 1
1: 0
2: 0
3: 17
4: 168
Right 992656587 5:78916367-78916389 AAACTGTCTTTAGTTTAAAGAGG 0: 1
1: 0
2: 2
3: 39
4: 344
992656577_992656585 -4 Left 992656577 5:78916316-78916338 CCTGGCCTGTTCCAGTCCAGAAG 0: 1
1: 0
2: 0
3: 17
4: 168
Right 992656585 5:78916335-78916357 GAAGAAAGGAGACTGGGCCTGGG 0: 1
1: 0
2: 2
3: 61
4: 478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992656577 Original CRISPR CTTCTGGACTGGAACAGGCC AGG (reversed) Intronic