ID: 992656578

View in Genome Browser
Species Human (GRCh38)
Location 5:78916321-78916343
Sequence CCTTTCTTCTGGACTGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992656578_992656584 -10 Left 992656578 5:78916321-78916343 CCTGTTCCAGTCCAGAAGAAAGG No data
Right 992656584 5:78916334-78916356 AGAAGAAAGGAGACTGGGCCTGG 0: 1
1: 1
2: 10
3: 118
4: 1120
992656578_992656587 23 Left 992656578 5:78916321-78916343 CCTGTTCCAGTCCAGAAGAAAGG No data
Right 992656587 5:78916367-78916389 AAACTGTCTTTAGTTTAAAGAGG 0: 1
1: 0
2: 2
3: 39
4: 344
992656578_992656585 -9 Left 992656578 5:78916321-78916343 CCTGTTCCAGTCCAGAAGAAAGG No data
Right 992656585 5:78916335-78916357 GAAGAAAGGAGACTGGGCCTGGG 0: 1
1: 0
2: 2
3: 61
4: 478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992656578 Original CRISPR CCTTTCTTCTGGACTGGAAC AGG (reversed) Intronic