ID: 992656585

View in Genome Browser
Species Human (GRCh38)
Location 5:78916335-78916357
Sequence GAAGAAAGGAGACTGGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 542
Summary {0: 1, 1: 0, 2: 2, 3: 61, 4: 478}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992656577_992656585 -4 Left 992656577 5:78916316-78916338 CCTGGCCTGTTCCAGTCCAGAAG 0: 1
1: 0
2: 0
3: 17
4: 168
Right 992656585 5:78916335-78916357 GAAGAAAGGAGACTGGGCCTGGG 0: 1
1: 0
2: 2
3: 61
4: 478
992656576_992656585 -3 Left 992656576 5:78916315-78916337 CCCTGGCCTGTTCCAGTCCAGAA 0: 1
1: 0
2: 0
3: 23
4: 211
Right 992656585 5:78916335-78916357 GAAGAAAGGAGACTGGGCCTGGG 0: 1
1: 0
2: 2
3: 61
4: 478
992656578_992656585 -9 Left 992656578 5:78916321-78916343 CCTGTTCCAGTCCAGAAGAAAGG No data
Right 992656585 5:78916335-78916357 GAAGAAAGGAGACTGGGCCTGGG 0: 1
1: 0
2: 2
3: 61
4: 478
992656574_992656585 9 Left 992656574 5:78916303-78916325 CCCAGAAATCTTCCCTGGCCTGT 0: 1
1: 1
2: 5
3: 16
4: 271
Right 992656585 5:78916335-78916357 GAAGAAAGGAGACTGGGCCTGGG 0: 1
1: 0
2: 2
3: 61
4: 478
992656575_992656585 8 Left 992656575 5:78916304-78916326 CCAGAAATCTTCCCTGGCCTGTT 0: 1
1: 0
2: 1
3: 24
4: 223
Right 992656585 5:78916335-78916357 GAAGAAAGGAGACTGGGCCTGGG 0: 1
1: 0
2: 2
3: 61
4: 478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992656585 Original CRISPR GAAGAAAGGAGACTGGGCCT GGG Intronic