ID: 992656587

View in Genome Browser
Species Human (GRCh38)
Location 5:78916367-78916389
Sequence AAACTGTCTTTAGTTTAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 344}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992656580_992656587 17 Left 992656580 5:78916327-78916349 CCAGTCCAGAAGAAAGGAGACTG No data
Right 992656587 5:78916367-78916389 AAACTGTCTTTAGTTTAAAGAGG 0: 1
1: 0
2: 2
3: 39
4: 344
992656583_992656587 12 Left 992656583 5:78916332-78916354 CCAGAAGAAAGGAGACTGGGCCT 0: 1
1: 0
2: 1
3: 23
4: 244
Right 992656587 5:78916367-78916389 AAACTGTCTTTAGTTTAAAGAGG 0: 1
1: 0
2: 2
3: 39
4: 344
992656577_992656587 28 Left 992656577 5:78916316-78916338 CCTGGCCTGTTCCAGTCCAGAAG 0: 1
1: 0
2: 0
3: 17
4: 168
Right 992656587 5:78916367-78916389 AAACTGTCTTTAGTTTAAAGAGG 0: 1
1: 0
2: 2
3: 39
4: 344
992656578_992656587 23 Left 992656578 5:78916321-78916343 CCTGTTCCAGTCCAGAAGAAAGG No data
Right 992656587 5:78916367-78916389 AAACTGTCTTTAGTTTAAAGAGG 0: 1
1: 0
2: 2
3: 39
4: 344
992656586_992656587 -8 Left 992656586 5:78916352-78916374 CCTGGGCACACAGACAAACTGTC 0: 1
1: 0
2: 1
3: 22
4: 205
Right 992656587 5:78916367-78916389 AAACTGTCTTTAGTTTAAAGAGG 0: 1
1: 0
2: 2
3: 39
4: 344
992656576_992656587 29 Left 992656576 5:78916315-78916337 CCCTGGCCTGTTCCAGTCCAGAA 0: 1
1: 0
2: 0
3: 23
4: 211
Right 992656587 5:78916367-78916389 AAACTGTCTTTAGTTTAAAGAGG 0: 1
1: 0
2: 2
3: 39
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992656587 Original CRISPR AAACTGTCTTTAGTTTAAAG AGG Intronic