ID: 992656725

View in Genome Browser
Species Human (GRCh38)
Location 5:78917807-78917829
Sequence CTTTAAACATAACTGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 274}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992656725_992656729 -3 Left 992656725 5:78917807-78917829 CCAGCCTGCAGTTATGTTTAAAG 0: 1
1: 0
2: 3
3: 21
4: 274
Right 992656729 5:78917827-78917849 AAGGTGGAATATTAAACCACAGG 0: 1
1: 0
2: 0
3: 11
4: 163
992656725_992656732 6 Left 992656725 5:78917807-78917829 CCAGCCTGCAGTTATGTTTAAAG 0: 1
1: 0
2: 3
3: 21
4: 274
Right 992656732 5:78917836-78917858 TATTAAACCACAGGTTCAAGGGG 0: 1
1: 7
2: 15
3: 17
4: 163
992656725_992656733 7 Left 992656725 5:78917807-78917829 CCAGCCTGCAGTTATGTTTAAAG 0: 1
1: 0
2: 3
3: 21
4: 274
Right 992656733 5:78917837-78917859 ATTAAACCACAGGTTCAAGGGGG 0: 1
1: 0
2: 0
3: 120
4: 6223
992656725_992656731 5 Left 992656725 5:78917807-78917829 CCAGCCTGCAGTTATGTTTAAAG 0: 1
1: 0
2: 3
3: 21
4: 274
Right 992656731 5:78917835-78917857 ATATTAAACCACAGGTTCAAGGG 0: 1
1: 0
2: 1
3: 14
4: 188
992656725_992656735 15 Left 992656725 5:78917807-78917829 CCAGCCTGCAGTTATGTTTAAAG 0: 1
1: 0
2: 3
3: 21
4: 274
Right 992656735 5:78917845-78917867 ACAGGTTCAAGGGGGAATCAAGG 0: 1
1: 0
2: 0
3: 7
4: 125
992656725_992656730 4 Left 992656725 5:78917807-78917829 CCAGCCTGCAGTTATGTTTAAAG 0: 1
1: 0
2: 3
3: 21
4: 274
Right 992656730 5:78917834-78917856 AATATTAAACCACAGGTTCAAGG 0: 1
1: 0
2: 1
3: 27
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992656725 Original CRISPR CTTTAAACATAACTGCAGGC TGG (reversed) Intronic
901093455 1:6659461-6659483 CTCTAATTAAAACTGCAGGCTGG + Intronic
901835616 1:11922349-11922371 ATTTAAAAATAACTGCAAGCTGG - Intronic
902891137 1:19444525-19444547 TTATAAACATAACTGCACACTGG + Intronic
903042768 1:20543634-20543656 TTTTAAAAACAACTGTAGGCTGG + Intergenic
903529333 1:24018186-24018208 CTTTAAATCAAATTGCAGGCTGG - Intergenic
904042634 1:27593304-27593326 TTTTAAAGATTGCTGCAGGCAGG - Intronic
904108042 1:28102609-28102631 CTTTAAAGAGCAATGCAGGCCGG + Intergenic
904182160 1:28673715-28673737 CTTTGGAAATAACTACAGGCTGG + Intronic
906244175 1:44261697-44261719 ATTTGAACAAAAGTGCAGGCAGG - Intronic
906412192 1:45587439-45587461 ATTAAATCATAACTGCAGCCGGG - Intronic
906494199 1:46292015-46292037 TTTTAAAAATTATTGCAGGCCGG + Intronic
910525969 1:88178679-88178701 CTTTAAACATGTCTTCAGGTTGG + Intergenic
912335748 1:108861105-108861127 TTTTAAACATATTTGTAGGCCGG + Intronic
915132598 1:153706120-153706142 TTATAAATATGACTGCAGGCTGG + Intergenic
915149861 1:153821860-153821882 CTTTAAAAATGAATTCAGGCCGG - Intronic
915157233 1:153887788-153887810 CATAAAAAATTACTGCAGGCTGG + Intronic
915656639 1:157366338-157366360 CTTAAAACTTAACTGCTGACAGG + Intergenic
916266978 1:162899879-162899901 CTTTAAAAATAACTCCTGGCAGG + Intergenic
916360125 1:163958910-163958932 TTTTAGGCAGAACTGCAGGCTGG + Intergenic
916409738 1:164534494-164534516 CTTTACACATAGCTGCAGGCCGG + Intergenic
917508373 1:175649348-175649370 AATTAAAAGTAACTGCAGGCAGG - Intronic
918986907 1:191642247-191642269 CTTTAAAAATAACTGCTAGTGGG - Intergenic
919024083 1:192145977-192145999 CATCAAACACAACTGCAGCCAGG + Intergenic
919399150 1:197087370-197087392 CTTAAAAGTTTACTGCAGGCTGG - Intronic
921532201 1:216298480-216298502 CTTTAAACATTAAGGCAGCCAGG - Intronic
921861548 1:220046983-220047005 CTTTAAAAATCACTGCAGGCCGG + Intergenic
922276597 1:224084810-224084832 CAATAAAAAAAACTGCAGGCTGG + Intergenic
922953697 1:229581085-229581107 CATGAAACAAAACTGCAGTCTGG - Intergenic
923599506 1:235389825-235389847 CTTTAAAAAGAAATGCAGACTGG + Intronic
1065293648 10:24255149-24255171 CTTTAAAGAAAATTACAGGCCGG - Intronic
1065461937 10:25976866-25976888 CTTTAAAAATAATTGCATCCAGG - Intronic
1065694251 10:28365299-28365321 TTTTAAACATAACTTAAGGCTGG - Intergenic
1068848379 10:61706952-61706974 CTTTATACAAAGGTGCAGGCTGG - Intronic
1070904685 10:80061559-80061581 CTTTTAAGCTAACTGCTGGCCGG + Intergenic
1071284297 10:84130039-84130061 TTTTAAAGATACTTGCAGGCTGG + Intergenic
1072506224 10:96070326-96070348 CTTTAAAAATAATTACCGGCTGG + Intergenic
1072827383 10:98621219-98621241 CTTTGAAAATAACTGCAGTAAGG + Intronic
1073444846 10:103574524-103574546 GTTTAAACATAAAAGGAGGCAGG + Intronic
1074091978 10:110269080-110269102 CTTTAAAAATAATTCCTGGCTGG + Intronic
1074750639 10:116583079-116583101 TTTGAAAGAAAACTGCAGGCTGG + Intergenic
1074802544 10:117015625-117015647 TTTCAAACATTACTACAGGCCGG - Intronic
1074849408 10:117427134-117427156 TTTTAAACATGGCTGCAGGCCGG + Intergenic
1075157799 10:119993656-119993678 GTTTTAATATAACTGAAGGCTGG - Intergenic
1077525514 11:3061968-3061990 CATTAAAAATAAAAGCAGGCTGG - Intergenic
1078234142 11:9468684-9468706 ATTTAAATATAACTCAAGGCTGG + Intronic
1079239359 11:18711692-18711714 TTTTAATTATAATTGCAGGCTGG - Intronic
1080525334 11:33110932-33110954 CTATAAAAATAAAAGCAGGCCGG + Intronic
1080646983 11:34194578-34194600 CTTACAGCATTACTGCAGGCTGG - Intronic
1081381383 11:42420186-42420208 CTCTAAACCTAACTACTGGCTGG + Intergenic
1081897431 11:46598709-46598731 TTTTTAACATGACTACAGGCTGG - Intergenic
1082954647 11:58857025-58857047 CTTTAAACATATATGCAGTAGGG + Intronic
1082971700 11:59029716-59029738 CTTTAAACATATATGCAGTAGGG + Intronic
1083444741 11:62700342-62700364 TTTGAAAAATAACTTCAGGCTGG + Intronic
1086428513 11:86712425-86712447 CTTTAAAAATAAATGAATGCTGG - Intergenic
1089433885 11:118446050-118446072 CTTTAAAAAGATTTGCAGGCCGG + Intronic
1089969913 11:122684892-122684914 CTTAAAAAATAACCACAGGCTGG - Intronic
1091084732 11:132710554-132710576 CTTTAAAAGTAAGTGAAGGCTGG + Intronic
1092694434 12:11153670-11153692 ATTTAAACATAAGAGGAGGCAGG - Intronic
1093459478 12:19395349-19395371 TTTAAAACATAAGTCCAGGCCGG - Intergenic
1096317677 12:50582738-50582760 TTTTTAAAATAACTGGAGGCTGG - Intronic
1097286768 12:57884132-57884154 CATTAAAAATGACAGCAGGCCGG + Intergenic
1097833977 12:64254828-64254850 CTTTAAAAATTCCTTCAGGCTGG - Intergenic
1099446167 12:82754436-82754458 CTTTAAAAAGTACTTCAGGCCGG + Intronic
1100113360 12:91272452-91272474 TTTTGAAAATAACAGCAGGCAGG - Intergenic
1100564955 12:95786866-95786888 CTTTAAAAAAAAATGCGGGCTGG + Intronic
1100604746 12:96142428-96142450 ATTTAAAAAACACTGCAGGCCGG + Intergenic
1102142585 12:110627391-110627413 CTTTAAATCTAACTGAGGGCTGG - Intronic
1103338355 12:120207307-120207329 ATCAAAACATAACTGCCGGCCGG - Intergenic
1103509338 12:121463874-121463896 CTATAAAAATGACTACAGGCTGG - Intronic
1104061941 12:125276008-125276030 CTTTAAAAATAATTTTAGGCTGG - Intronic
1105384058 13:19913858-19913880 CTATCAACATAGATGCAGGCAGG - Intergenic
1107092035 13:36492024-36492046 CTTTAAACCCAACTGAAGGATGG - Intergenic
1108702053 13:52952181-52952203 CTATAATCATAAGTGAAGGCTGG + Intergenic
1109367141 13:61369951-61369973 ATTAAAACATAACTGCAAACTGG - Intergenic
1111059196 13:82990366-82990388 CTTTAAACAAAATTACTGGCCGG + Intergenic
1111466364 13:88616770-88616792 CTTTAAACAGGACTACATGCAGG + Intergenic
1111471417 13:88687612-88687634 CTTTACACGTATTTGCAGGCTGG + Intergenic
1111795629 13:92916312-92916334 CTTTAAACATATCTCCTTGCTGG - Intergenic
1112959550 13:105106779-105106801 CTTTGAACATAATGGAAGGCAGG - Intergenic
1113462197 13:110490306-110490328 CTTGAGACGTCACTGCAGGCAGG - Intronic
1114147542 14:19994646-19994668 CTTTAAACAGAATGGGAGGCAGG - Intergenic
1115612538 14:35062582-35062604 CTTTAAAAACAACTACAGGTAGG - Intronic
1116316316 14:43398742-43398764 TTTTAAAAACAACTGTAGGCTGG - Intergenic
1116425045 14:44780565-44780587 AATTCAACATGACTGCAGGCTGG - Intergenic
1119324470 14:73751600-73751622 CTTTAAAAATAAAGCCAGGCCGG + Intronic
1124585078 15:30997798-30997820 TTTAAAACATATCTGCAGGCCGG + Intergenic
1125377545 15:39047171-39047193 CTTAAAACATAATTTCAGGTGGG + Intergenic
1126921901 15:53535981-53536003 CTTTAAACACGCATGCAGGCAGG - Intronic
1127065438 15:55232823-55232845 ATTAAAATTTAACTGCAGGCTGG + Intronic
1127359716 15:58234635-58234657 CTTTAAAAAGAAATGTAGGCTGG + Intronic
1128077292 15:64835547-64835569 ATTAAAACATAAATCCAGGCCGG - Intergenic
1128114396 15:65096247-65096269 CTTTAAACATTACTGCTGTCTGG + Intronic
1130172680 15:81531905-81531927 CGTTAAACATAAATGCAGACAGG + Intergenic
1131349470 15:91684460-91684482 CTGTAGACATCACTGCAGCCTGG + Intergenic
1132639025 16:969028-969050 TTTTTAAAATAATTGCAGGCCGG + Intronic
1132773261 16:1576835-1576857 CTGCAATCATAACTGCAGACAGG + Intronic
1133142037 16:3752533-3752555 CATTTAACATAAATGCAGTCAGG + Intronic
1133376658 16:5292917-5292939 TTTTAAAAAAAACTCCAGGCTGG - Intergenic
1133523313 16:6579880-6579902 CTTTAAAAAGGACTGAAGGCTGG - Intronic
1134375902 16:13672918-13672940 CTTTAAAGAATACTGCAGGCTGG - Intergenic
1134506205 16:14809310-14809332 CTTAAAACAAAATTTCAGGCTGG - Intronic
1134574345 16:15319454-15319476 CTTAAAACAAAATTTCAGGCTGG + Intergenic
1134728070 16:16436844-16436866 CTTAAAACAAAATTTCAGGCTGG - Intergenic
1134939366 16:18274982-18275004 CTTAAAACAAAATTTCAGGCTGG + Intergenic
1135006871 16:18832731-18832753 CTTAAAAAAAAAGTGCAGGCAGG - Intronic
1138160344 16:54747405-54747427 TTTTAAAAATAACTTCAGGCTGG + Intergenic
1140712161 16:77688694-77688716 CTTTAATCAGAAGTGAAGGCCGG - Intergenic
1141938618 16:87259118-87259140 ATTAAAAAATAACTGGAGGCTGG - Intronic
1142377509 16:89713710-89713732 CTTAAAACATCACTGAGGGCTGG + Intronic
1142636866 17:1263095-1263117 CATTACACATCACTGGAGGCAGG + Intergenic
1144735821 17:17554910-17554932 CTTTAAAAAAATCTGCTGGCCGG - Intronic
1144819597 17:18062777-18062799 TTTTAAAAATAACAGCTGGCCGG + Intronic
1146623408 17:34417808-34417830 CTTTTAACATGTCTACAGGCTGG - Intergenic
1148928320 17:51107246-51107268 CTTTAAAAGAAACTGCAGGAAGG + Intronic
1149187060 17:54010860-54010882 CTTTACACATAAGTGAAGGAAGG - Intergenic
1149248891 17:54745043-54745065 ATTTTAAAATTACTGCAGGCAGG - Intergenic
1149955956 17:61050027-61050049 CTTCAAAGATATCTGCTGGCTGG - Intronic
1150127054 17:62644120-62644142 TTTTAAACATGTCTGGAGGCTGG + Intronic
1150597752 17:66621903-66621925 CTTTAAAAATAAGTTGAGGCTGG + Intronic
1151033540 17:70771152-70771174 TTTTAAAAATATCTGGAGGCCGG - Intergenic
1151043246 17:70888746-70888768 CTTAACTCATGACTGCAGGCTGG - Intergenic
1151060485 17:71086976-71086998 CTTTACACATAACTACAGAATGG - Intergenic
1152848475 17:82617111-82617133 GTTTAAAAATCAGTGCAGGCTGG - Intronic
1153130644 18:1851990-1852012 CTTAAAAAATAACTCCTGGCCGG + Intergenic
1153872254 18:9332282-9332304 CTTTAAAAATAACTCTAGTCCGG + Intergenic
1155215477 18:23639830-23639852 CTTTAGATATCACAGCAGGCTGG - Intronic
1156926321 18:42584727-42584749 CTGAAAACATAATTGCTGGCTGG - Intergenic
1157014761 18:43698753-43698775 CCTTAAACACTGCTGCAGGCAGG - Intergenic
1161044119 19:2125704-2125726 TTTTAAACAGAAATGTAGGCCGG + Intronic
1161472302 19:4464566-4464588 TTTTAAACGATACTGCAGGCCGG + Intergenic
1161547822 19:4892653-4892675 TTTTAAAAATAAAAGCAGGCTGG - Intronic
1161617485 19:5279977-5279999 GTTTTAAAATAACTTCAGGCTGG - Intronic
1163858960 19:19730321-19730343 CCTTAAATAAAACTGCGGGCTGG - Intronic
1165203433 19:34163850-34163872 CTTTAAACATCTCTACGGGCTGG + Intergenic
1165991047 19:39814050-39814072 CTTTAAAAATAACTGAGGCCGGG + Intergenic
1167281498 19:48571906-48571928 CATTAAACACAAGTGCAGCCGGG - Intronic
925667780 2:6279407-6279429 ATTAAAAGAAAACTGCAGGCGGG - Intergenic
926417373 2:12663121-12663143 CATTAAACATAACTGAAGTAAGG - Intergenic
927551244 2:24001978-24002000 ATTTAAAAATAACTTCTGGCTGG + Exonic
928531390 2:32196016-32196038 CTTTAAAAAAAAATGAAGGCTGG + Intronic
928966781 2:36983900-36983922 TTTAAAATATAACTGGAGGCCGG + Intronic
929620576 2:43350181-43350203 ATACAAACAGAACTGCAGGCAGG + Intronic
930421797 2:51163153-51163175 CTTTATATATAATTGCTGGCAGG + Intergenic
930495103 2:52131468-52131490 CTTTAAACAGAATGGGAGGCAGG - Intergenic
931512564 2:63016725-63016747 ATTAAAACATAATTTCAGGCTGG - Intronic
932553418 2:72796117-72796139 TTTTAAAAATACCTGAAGGCTGG - Intronic
932704866 2:74016069-74016091 CTTTAAAAAAAAATTCAGGCTGG + Intronic
935418307 2:102841511-102841533 CTTGAACCAAAACTGCAGACAGG + Intronic
936037507 2:109124604-109124626 TTTAAAACAAAACTGCAGCCGGG - Intergenic
936148730 2:109998568-109998590 CTTTAAAGACATCTGCAGGCTGG + Intergenic
936195948 2:110372800-110372822 CTTTAAAGACATCTGCAGGCTGG - Intergenic
939738075 2:145874383-145874405 CCTTAAAAATAATTTCAGGCAGG + Intergenic
940185849 2:150984386-150984408 CTTTAAACAAAAATGTAGCCAGG - Intergenic
940270393 2:151884003-151884025 ATTTAAACAGCACTGAAGGCTGG + Intronic
943254941 2:185583144-185583166 CATTAAACATAAGTCCTGGCTGG + Intergenic
943792851 2:191954181-191954203 CTATAAAAATGAATGCAGGCCGG - Intronic
945696753 2:213116434-213116456 CTTTAAGAATTTCTGCAGGCTGG + Intronic
945948879 2:216020288-216020310 CTTTAGACATAACTGGATCCAGG + Intronic
947789521 2:232856226-232856248 AATTAAAAAGAACTGCAGGCCGG - Intronic
947822249 2:233080223-233080245 TTTTAAATTTAACTGCAGCCTGG - Intronic
1169160040 20:3369671-3369693 CTTTAAAGTTAACTTTAGGCCGG - Intronic
1169271032 20:4199573-4199595 GTATAAATATGACTGCAGGCTGG - Intergenic
1172868546 20:38120094-38120116 TTTTAACAATAACTACAGGCCGG - Intronic
1172936514 20:38624404-38624426 CCTTGAACATAGCTGCATGCAGG - Intronic
1173444793 20:43107951-43107973 CTTTTGGAATAACTGCAGGCAGG + Intronic
1173521226 20:43701722-43701744 CTATAAAAATATCTGCAGGCTGG + Intronic
1173889029 20:46489370-46489392 ATTTAAACATATCTTCAGGGTGG + Intergenic
1174344314 20:49918630-49918652 CTTTAAACCTAACATCAGGGTGG - Intergenic
1174797300 20:53532884-53532906 TTTTAAATATGTCTGCAGGCTGG + Intergenic
1176373380 21:6075692-6075714 TTTTAAAGATGACTGAAGGCCGG - Intergenic
1177550195 21:22611036-22611058 CTTTGAACATAATGGGAGGCAGG + Intergenic
1178578861 21:33819684-33819706 TTTTAAAAGTAACTACAGGCCGG + Intronic
1179201312 21:39224144-39224166 CATTAAACTTAACTCCTGGCTGG - Intronic
1179750097 21:43462551-43462573 TTTTAAAGATGACTGAAGGCCGG + Intergenic
1180551386 22:16544619-16544641 CTTTAAAGATGTTTGCAGGCTGG - Intergenic
1181352623 22:22269308-22269330 CTTTAAAGATGTTTGCAGGCTGG + Intergenic
1182244254 22:28943003-28943025 CTTTCAACATACCTGCAAGATGG - Intronic
1182322084 22:29484341-29484363 TTTTAAAGATAACTGGCGGCTGG + Intronic
1183918809 22:41147006-41147028 ATTAAAAAACAACTGCAGGCTGG + Intronic
1184672479 22:46022356-46022378 ATTTAAATATAAATGCAGGCTGG + Intergenic
1184944364 22:47792339-47792361 CTTTAAAAATTACTTAAGGCTGG - Intergenic
950383527 3:12637573-12637595 CTTAAAACACAAATGGAGGCCGG + Intronic
950583560 3:13878462-13878484 CTTAAAACACACCGGCAGGCTGG + Intronic
950993696 3:17470244-17470266 CTTAAAACATTATTTCAGGCAGG + Intronic
951372766 3:21871707-21871729 TTTTAAAAATTACTCCAGGCCGG + Intronic
952475329 3:33703780-33703802 CTTTAAACATGAGTGTGGGCTGG - Intronic
955103606 3:55875314-55875336 CTGTTATCATAACTGCATGCTGG + Intronic
955929477 3:64042020-64042042 CTTTAAAAATAATTCCTGGCCGG - Intergenic
958124136 3:89333575-89333597 AATAAAACCTAACTGCAGGCTGG + Intronic
961313473 3:126018451-126018473 GATTAAACATCACTGCTGGCAGG + Intronic
961654665 3:128434630-128434652 CTTTAAAGATAAATTCAGCCTGG - Intergenic
963779057 3:149468944-149468966 ATTTAAACCTAAATGCATGCAGG + Intergenic
964312724 3:155411708-155411730 CCCTAATTATAACTGCAGGCTGG + Intronic
966014015 3:175118495-175118517 CTTTAATGAGAACAGCAGGCAGG + Intronic
966149953 3:176856838-176856860 CTTTAAACATAACAGTAGAGTGG + Intergenic
966358187 3:179104539-179104561 TTTTAAAAATAATTGCCGGCCGG + Intergenic
966457655 3:180135916-180135938 CTTTCAACAGAACGGGAGGCAGG - Intergenic
967374525 3:188786081-188786103 TATTAAACATCAGTGCAGGCTGG + Intronic
967406419 3:189120372-189120394 CATTTACCATAACTGCAGGTGGG - Intronic
968294751 3:197567339-197567361 CTTTGAACAGAACGGGAGGCAGG - Intronic
970694881 4:18665607-18665629 CTTTAAAGAGAAGTGTAGGCTGG + Intergenic
972633201 4:40859499-40859521 GTTAAAACACTACTGCAGGCCGG - Intronic
973036983 4:45419376-45419398 CTTTAAACATAAATTGATGCTGG + Intergenic
973169880 4:47128705-47128727 GTTTAAACATAACTAAAGGTGGG + Intronic
973772313 4:54217991-54218013 GTTTAGAAATCACTGCAGGCGGG + Intronic
976288553 4:83393833-83393855 CTTTCAAGATAACTACAGGTAGG - Intergenic
976625348 4:87174577-87174599 CTTTTAATAAAACTGCAGGTGGG - Intronic
983157482 4:164368863-164368885 CTTTCAACCTTACTGCAGGTTGG + Intronic
983770977 4:171548478-171548500 CTTTAAAAATAACTTTTGGCCGG - Intergenic
984900879 4:184585387-184585409 GTTTAAACCTCACTGCTGGCTGG - Intergenic
985510017 5:308152-308174 ATCTAAAAATAACTTCAGGCCGG - Intronic
985907391 5:2851395-2851417 CTTCAAAAACAACTCCAGGCTGG - Intergenic
988041213 5:25890974-25890996 CATTAAAAATAATTCCAGGCCGG - Intergenic
988157397 5:27472821-27472843 CTTAAAAGTTAACTGCTGGCAGG - Intergenic
991702186 5:69326752-69326774 TCTTAAACTTAACTTCAGGCTGG + Intronic
992656725 5:78917807-78917829 CTTTAAACATAACTGCAGGCTGG - Intronic
993477153 5:88379956-88379978 CTTTAAAAATAAAAGTAGGCTGG - Intergenic
993680314 5:90869889-90869911 TTTTAAAAATGACTGGAGGCTGG - Intronic
994126602 5:96174036-96174058 CTTAAAAAATAAGTTCAGGCCGG - Intergenic
994199362 5:96955076-96955098 TTAAAAACATAATTGCAGGCCGG - Intronic
995166907 5:109053985-109054007 CATTAAATAGAACTCCAGGCCGG - Intronic
997501704 5:134380204-134380226 CATTAAAAATAACTGTAGCCAGG - Intronic
999780416 5:154845201-154845223 CTGAAAACATGTCTGCAGGCGGG - Intronic
1001385971 5:171339009-171339031 CTTTAAAAATTACTGTAGCCGGG - Intergenic
1002286769 5:178167933-178167955 CTTGAAACAGAGCTACAGGCCGG - Intergenic
1002803049 6:544849-544871 CTTAAAATAAAACTTCAGGCCGG + Intronic
1003316339 6:5015545-5015567 CTTTAAACAACACTGCTGCCTGG - Intergenic
1003653269 6:7982300-7982322 TTTTAAAAATAAATTCAGGCTGG + Intronic
1004683870 6:17922918-17922940 CGTAAAACATATGTGCAGGCTGG - Intronic
1004782991 6:18933002-18933024 CTTTAAACATAAATTCAGGAGGG + Intergenic
1005991050 6:30902355-30902377 CTTTTAAATTAACTGCAGGTGGG - Intergenic
1006066676 6:31467209-31467231 CCTTACCCACAACTGCAGGCAGG + Intergenic
1006254040 6:32815071-32815093 CTGTAGACACAACTACAGGCTGG - Exonic
1006311912 6:33267024-33267046 CTTTTCACATCACAGCAGGCTGG + Intronic
1008003982 6:46390469-46390491 CATGAAACATAACTGCAGGTGGG + Intronic
1008616721 6:53233399-53233421 CTTTAATAATAACTTCAGGCTGG - Intergenic
1008945831 6:57096113-57096135 ATTTAAAAATAGCTGCAGGCAGG - Intronic
1009720361 6:67460788-67460810 ATTTTAACACAACTGCAGACTGG - Intergenic
1009867816 6:69418815-69418837 TTAAAAAGATAACTGCAGGCTGG - Intergenic
1010214110 6:73386668-73386690 CTTGAAAAAGAACTGCAGCCGGG + Intronic
1011130675 6:84049126-84049148 CTTTAAAAATTACTTCTGGCTGG + Intronic
1011466544 6:87663464-87663486 CTGTAAACATAACAGCAGACAGG + Intronic
1011490099 6:87882919-87882941 TTTTAAACATAACTGGAGTTTGG + Intergenic
1014849477 6:126323811-126323833 TTTTAAAAATCCCTGCAGGCTGG + Intergenic
1015671993 6:135700780-135700802 GTTTAAAAATCAGTGCAGGCTGG - Intergenic
1015866498 6:137732331-137732353 CTATAAAAATGACTGCAGTCAGG + Intergenic
1020700738 7:11479251-11479273 CATTAAACAATACTGAAGGCTGG - Intronic
1024201323 7:47109590-47109612 CTTTAAAAATAATTTCAGGCCGG + Intergenic
1026973442 7:74481453-74481475 CTTTAAAAACAAAAGCAGGCTGG - Intronic
1028716715 7:93979471-93979493 CTTTAAACATGACTGCAAGATGG + Intronic
1029082546 7:97986207-97986229 ATTTAAACATAACCACGGGCTGG - Intronic
1032711925 7:134468274-134468296 CTTTATACAAAACTACAAGCAGG + Intergenic
1035656446 8:1310411-1310433 CTCTAATCATAGCTGGAGGCTGG + Intergenic
1035904076 8:3490426-3490448 TTTAAAATATAAATGCAGGCAGG - Intronic
1036420039 8:8586836-8586858 TTTAAAAAATAACTGCTGGCTGG - Intergenic
1037204028 8:16292687-16292709 CTTAAGAAATAACTTCAGGCCGG + Intronic
1037536001 8:19825228-19825250 TTTTGAAAATAACAGCAGGCTGG + Intronic
1039052634 8:33508843-33508865 CTTGAAACTCAACTGTAGGCCGG + Intronic
1039469536 8:37804689-37804711 CATTAAACAGCTCTGCAGGCAGG + Intronic
1040553312 8:48456334-48456356 TTTTAAAAATAACTGAAGACTGG + Intergenic
1041215742 8:55598134-55598156 CTCTCAGCATCACTGCAGGCTGG - Intergenic
1041548527 8:59074957-59074979 CTGTAAGCAGAACTGAAGGCAGG + Intronic
1042583894 8:70313872-70313894 CTTCAAAAACAACTGCTGGCCGG + Intronic
1044006471 8:86943084-86943106 CTTTTTAAATAAATGCAGGCTGG + Intronic
1046575758 8:116027003-116027025 GTTAAAACATAACTACCGGCTGG + Intergenic
1047612968 8:126539071-126539093 ATTTAAAAATAGATGCAGGCCGG + Intergenic
1047792969 8:128223868-128223890 CTTCAAACCCAATTGCAGGCAGG - Intergenic
1047822985 8:128541792-128541814 CTTTAAACATAAGTGAATGATGG - Intergenic
1048673544 8:136750758-136750780 CTTTAACAATTACTGTAGGCAGG + Intergenic
1049072127 8:140364265-140364287 CTTTGAATATAACTCCAGGCTGG - Intronic
1049235537 8:141510576-141510598 TTTTAAAAATAACTCCTGGCGGG + Intergenic
1049951193 9:645583-645605 TTTTAAATATGACTTCAGGCTGG + Intronic
1051754832 9:20387912-20387934 CTATAAACAGAAATACAGGCAGG + Intronic
1052741261 9:32395177-32395199 CTTAAAACATAAATGCAGGCTGG + Intronic
1052839557 9:33280271-33280293 CTTTAAAAACAACAACAGGCCGG - Intronic
1053460598 9:38267511-38267533 CTTCAAAACTTACTGCAGGCTGG + Intergenic
1054878760 9:70123492-70123514 AAATAAACATATCTGCAGGCTGG - Intronic
1055107979 9:72532225-72532247 TTTTAATCAAAACTTCAGGCTGG - Intronic
1056743292 9:89278793-89278815 CTTAGAACACCACTGCAGGCCGG + Intergenic
1056818800 9:89822210-89822232 TTTTAAACATGACTGCTGCCTGG + Intergenic
1056962110 9:91134428-91134450 CTTAAAACCCAACAGCAGGCCGG - Intergenic
1058367410 9:104225466-104225488 CTTTATACATTCCTGCAGCCAGG - Intergenic
1058917465 9:109581462-109581484 CTTTAAAAATAGCTGTTGGCCGG - Intergenic
1060893136 9:127201268-127201290 CTTGAAACATCCCTGCAGGGAGG + Intronic
1186421653 X:9431765-9431787 CTTTAAAAACAAGTGCAGCCTGG + Intergenic
1187138934 X:16575072-16575094 CTTTGAATATAACGGGAGGCAGG - Intergenic
1187414098 X:19077199-19077221 ATTTAAAAACAAATGCAGGCCGG + Intronic
1188352167 X:29145023-29145045 CTTTAAAAATAAGATCAGGCCGG - Intronic
1190238917 X:48641500-48641522 ATTTAAAAATAAATGTAGGCCGG - Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1190865620 X:54382235-54382257 CTGTAAAAAGAACTCCAGGCTGG + Intergenic
1192392023 X:70739704-70739726 CTTTAAAAATAGATTCAGGCTGG - Intronic
1194014687 X:88604846-88604868 CATAACACATAACTGGAGGCTGG - Intergenic
1196520629 X:116667372-116667394 CTTAAAACATAACTGCTGATGGG + Intergenic
1197504262 X:127282105-127282127 CTTTAATCATAAATGGATGCTGG - Intergenic
1198213354 X:134535178-134535200 CTTGAAAGATAAGTGGAGGCCGG + Intergenic
1198589792 X:138165088-138165110 CTTTAAAAATAAATACAGGTGGG - Intergenic
1199112215 X:143948411-143948433 CGTAAAACATAGCTTCAGGCCGG + Intergenic
1200422237 Y:2984255-2984277 TTTTAAAAATAATTGCTGGCTGG + Intergenic