ID: 992660037

View in Genome Browser
Species Human (GRCh38)
Location 5:78950314-78950336
Sequence TTTCCTCAGCCCAGCTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 322}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992660037 Original CRISPR TTTCCTCAGCCCAGCTTCTC TGG (reversed) Intronic
900933110 1:5748924-5748946 CCTCCTCAGCCCAGCGTCTCTGG + Intergenic
902106110 1:14037536-14037558 TGTGCACAGCCCAGCTCCTCAGG + Intergenic
902170038 1:14602572-14602594 TTTCCTCAGCATAACATCTCTGG + Intronic
903121500 1:21219423-21219445 GTGCCTCAGCCCAGCCTCACAGG + Intronic
903862690 1:26374444-26374466 TGTCCTCAGCCCACCTCCTGGGG - Intronic
903914973 1:26757088-26757110 TTTTCTAATCCCAGCTACTCAGG + Intronic
904909142 1:33921161-33921183 TACCCTCAACCCAGCTTCCCAGG + Intronic
905130126 1:35748404-35748426 TTTGGTCAGCTCAGCTTCTAAGG - Exonic
906065801 1:42979370-42979392 GTTCTTCAGCCCAGCTTCCCAGG - Intergenic
906962309 1:50426091-50426113 TATCCTCTGCCCAGCTTCCCAGG + Intergenic
907421506 1:54350682-54350704 TTTATTCAGCTCAGCTTCCCAGG - Intronic
907570245 1:55476617-55476639 TTTCCTCTGCACATTTTCTCAGG - Intergenic
908140732 1:61181795-61181817 TTTTCTCAGCCCAATTTCTATGG - Intronic
911290399 1:96050618-96050640 TATTCTCAGCCCAACTTCCCAGG - Intergenic
911889226 1:103345617-103345639 ATTCCTCAGCCCATCTTTTTTGG - Intergenic
912820344 1:112862761-112862783 TTTCCTGAGGCCTGCTTCTGAGG - Intergenic
913209813 1:116572758-116572780 TTTCCTCAGCCCTGCTCTTAAGG - Intergenic
913717398 1:121550689-121550711 TTTCCTGAGCCAACCTTCTCAGG - Intergenic
915280321 1:154818126-154818148 TTTCCTCAGGCCAGTGTGTCCGG - Intronic
915909724 1:159906995-159907017 TTTCCTGAGGCCTGCTTCTGAGG - Intergenic
916425164 1:164673415-164673437 TTTCATCAGCCCAACCTCTCTGG + Intronic
916542367 1:165769146-165769168 CTACCTCAGCCCAACTTCTGTGG + Intronic
916710275 1:167399344-167399366 TTTCCCCAGCCCAACTTCACTGG + Exonic
916749906 1:167714404-167714426 TTTCCTCAGCCCGGGCTCCCGGG + Intergenic
916855203 1:168741953-168741975 TTTCCTCACCTCATCTTCACTGG + Intergenic
918106574 1:181420347-181420369 TTTCCTCAGGCCCACTTTTCAGG + Intronic
918318208 1:183340735-183340757 TTTCGTCAGCCCAGCTTGGTAGG - Intronic
918536604 1:185581860-185581882 TTTTCTCAGCCCAGTTACTTAGG - Intergenic
920039810 1:203088153-203088175 CTTCTTCAGCCCAGCTGGTCAGG - Intergenic
920867953 1:209768893-209768915 TTTCCACAGCTCTGCTTTTCTGG - Intronic
920946056 1:210529601-210529623 TATCCCAGGCCCAGCTTCTCAGG + Intronic
921284328 1:213595403-213595425 TTTCCTCTGCCCTGATGCTCTGG - Intergenic
921926622 1:220715283-220715305 TTTCCTGAGGCCTGCTTCTGAGG + Intergenic
922042180 1:221907241-221907263 TGTTCTCAGCCCAGCATCACCGG + Intergenic
923683247 1:236136403-236136425 ATTCCTAATCCCAGCTACTCGGG + Intergenic
924004510 1:239593089-239593111 TTTTATCAGCAAAGCTTCTCTGG - Intronic
1063487607 10:6434570-6434592 TTTCCTCAGTGCAGCTTTCCAGG - Intronic
1064602462 10:17007526-17007548 TTTCCTGAGCACTGCTTCTGAGG - Intronic
1064772669 10:18739928-18739950 TTTACTAATCCCAGCTACTCAGG + Intergenic
1065833785 10:29639052-29639074 TTTCGTTATCCCAGCTACTCAGG - Intronic
1070547439 10:77463744-77463766 CTTCCCCAGCCCATTTTCTCTGG - Intronic
1070668277 10:78360668-78360690 TTTCCTCTGCCTTGCTTCTCTGG + Intergenic
1070761659 10:79027873-79027895 ATTGCTCAGCTCAGCTTCTGAGG - Intergenic
1070801089 10:79244727-79244749 TCTCCTCAGCCCAATTTCTGTGG - Intronic
1071201087 10:83221295-83221317 TCTCTTCAGCCCTGCTCCTCTGG - Intergenic
1072750394 10:97974721-97974743 CTCCCTGAGTCCAGCTTCTCCGG - Intronic
1074037796 10:109758079-109758101 TTTCCTCTGCCCAGCTTTTAAGG + Intergenic
1074162795 10:110847696-110847718 TCTCCCCAGCCCCGCTCCTCTGG - Intergenic
1074265060 10:111893569-111893591 TTTCCTGAGACCTGCTTCTGAGG - Intergenic
1074265144 10:111894248-111894270 TTTCCTGAGACCTGCTTCTGAGG + Intergenic
1074751629 10:116592366-116592388 TTTTCGCAGCCCAGCCTCACAGG - Intronic
1075441832 10:122485907-122485929 CTTCCTCAGACCAGCTTCCTGGG - Intronic
1075740339 10:124692041-124692063 TTTCCTCTACAAAGCTTCTCTGG - Intronic
1077609965 11:3637953-3637975 ATTCCTCAGCCCCACTTGTCAGG - Intergenic
1078675384 11:13407763-13407785 TCTCCTCAGCCATGCTCCTCTGG - Intronic
1079149512 11:17884811-17884833 TCTTCTCACCCCAACTTCTCTGG - Intronic
1079769256 11:24438001-24438023 TTTTCTGAGGCCTGCTTCTCAGG + Intergenic
1081722938 11:45303395-45303417 TTTGCTCATCCCAGCTGCCCAGG - Intergenic
1083929255 11:65830916-65830938 TATCCTCACCCCATTTTCTCTGG - Intronic
1084955225 11:72687648-72687670 TTTCCTCAGCCTGGGATCTCAGG + Intronic
1087076888 11:94133881-94133903 TTCCCTCAGCACAGCCACTCTGG - Intronic
1087360322 11:97150501-97150523 TATCTTAATCCCAGCTTCTCAGG + Intergenic
1088606718 11:111540484-111540506 ATTCCTCCGCCCAGCGCCTCGGG + Intronic
1089714056 11:120338857-120338879 TTTCTTCAGCATTGCTTCTCAGG + Intronic
1091279400 11:134373581-134373603 ACCCCTCACCCCAGCTTCTCAGG + Intronic
1091805120 12:3350424-3350446 CTTCCTCTGAACAGCTTCTCAGG - Intergenic
1092156042 12:6282120-6282142 CTTTCAGAGCCCAGCTTCTCCGG + Intergenic
1092916331 12:13192796-13192818 TTATCTGAGCCCAGCTACTCTGG + Intergenic
1095600082 12:44003494-44003516 TCCGCTCAGCCCATCTTCTCTGG + Intronic
1096694312 12:53339021-53339043 CTCCCTCAGCCCAGCCTCCCAGG + Intronic
1096786667 12:54020844-54020866 TTTCCCCAGTCCAGCTGCTTGGG - Intronic
1097603322 12:61721828-61721850 TTGCCTGATCCCAGCTACTCTGG + Intronic
1097688745 12:62714644-62714666 TTTGCTCTGCCAAGCTTCTGGGG - Intronic
1100353353 12:93805899-93805921 TTTGCCCAGCCAAGCATCTCTGG - Intronic
1100860184 12:98796997-98797019 TTACCTGAGACCAGCTACTCCGG - Intronic
1101477526 12:105064733-105064755 TTGACTCAGCCCAGGCTCTCAGG - Intronic
1103213099 12:119180685-119180707 TTTCTACTGCCCAGCTTCACAGG - Intronic
1103356861 12:120328037-120328059 TGTACTCAGCCCAGCTTCACGGG + Intergenic
1105292730 13:19062825-19062847 TTTCCTCCGCCCTGCTTTCCCGG - Intergenic
1106857536 13:33869172-33869194 TTTTCTCAGCCTGGATTCTCTGG + Intronic
1108440846 13:50451368-50451390 TTTCATCTGCTCAGCTTCTGGGG + Intronic
1109569400 13:64166476-64166498 TCTCCTCATCCCAATTTCTCTGG + Intergenic
1109811594 13:67520058-67520080 TTCCCACATCCCAGCTGCTCTGG + Intergenic
1111685132 13:91492419-91492441 CTTCCCCACCCCAGATTCTCAGG - Intronic
1113280760 13:108784980-108785002 CTTCATCAGCCCAGCACCTCTGG - Intronic
1114377051 14:22158230-22158252 TTTGGCCAGCCCAGCTGCTCAGG - Intergenic
1115414446 14:33114925-33114947 TTTCCACAGCCCATATCCTCAGG - Intronic
1116627762 14:47287954-47287976 TTGCCTCTTCCCAGCTTCTGGGG - Intronic
1121828997 14:97033713-97033735 CTTCGTGACCCCAGCTTCTCAGG + Intergenic
1122077434 14:99245557-99245579 CTTCCTCAGCCCACCTTGGCGGG - Intronic
1122430249 14:101635698-101635720 TTCCTCCAGCCCAGCTTCCCTGG + Intergenic
1122454723 14:101841590-101841612 TTTCCTCGCCCCACCTCCTCAGG - Intronic
1122955895 14:105070863-105070885 TCTCATACGCCCAGCTTCTCTGG - Intergenic
1124512274 15:30337337-30337359 TTTCCCCTGCCCAGCTTTTCGGG + Intergenic
1124730640 15:32193414-32193436 TTTCCCCTGCCCAGCTTTTCGGG - Intergenic
1125344908 15:38709470-38709492 TTTTCTGAGCCCAGTTTCTGGGG + Intergenic
1126168206 15:45671767-45671789 CTTTCTCAGGCCAGCTTCACAGG + Intronic
1126695269 15:51320634-51320656 TTTCCTTAACCCCACTTCTCAGG + Intronic
1127029442 15:54845532-54845554 TTTTCTGAGCCCTGCTTCTGAGG + Intergenic
1127046727 15:55033689-55033711 TAACCTCAGCCCGGCTTCTCTGG + Intergenic
1127698336 15:61473277-61473299 TTGGCTCAGCCCAGATTCTAAGG - Intergenic
1128260816 15:66231663-66231685 TGTGCTCACACCAGCTTCTCTGG + Intronic
1128591383 15:68900802-68900824 TTTCCTCAGCCCAGGCTCGAAGG - Intronic
1130154838 15:81341430-81341452 TCAGCACAGCCCAGCTTCTCAGG + Exonic
1131773422 15:95766310-95766332 TTTCTACAGCCCACCTTCTAGGG + Intergenic
1132152332 15:99471268-99471290 TTTTCTCTCCCCAGCTTCTCTGG - Intergenic
1132799689 16:1745890-1745912 CTGCCTCTGCCCAGCCTCTCTGG - Intronic
1133232779 16:4374327-4374349 TTTCCTCATTCCAGCCTCCCTGG + Intronic
1134005891 16:10818633-10818655 CAGCCTCAGCGCAGCTTCTCGGG + Exonic
1134187907 16:12098891-12098913 CTTCCTCAGCTCAGCTCCTGTGG - Intronic
1135867111 16:26113971-26113993 TCTCCTCTGCACAGCTTCCCTGG - Intronic
1135951469 16:26918286-26918308 TTTCCCAAGCCCAGCTTTCCAGG - Intergenic
1136081137 16:27853281-27853303 TAGCATCAGCTCAGCTTCTCAGG - Intronic
1137696392 16:50464885-50464907 GGTCCTCAGCCCAGATTCCCTGG + Intergenic
1137945858 16:52732597-52732619 TTTTGTCCACCCAGCTTCTCTGG + Intergenic
1138563509 16:57816138-57816160 TTTCCTCTCCCCAGCAGCTCAGG - Intronic
1138577009 16:57914450-57914472 TTTTCTCTGCCCTGTTTCTCTGG + Intronic
1138942609 16:61808472-61808494 CTTCCTCAGCCTAGCTTTTGAGG - Intronic
1140771875 16:78212829-78212851 TTTTCTCAGGCCAGCTGCACTGG + Intronic
1141217491 16:82038753-82038775 TTTTCCCTGCCCATCTTCTCTGG - Intronic
1142141233 16:88473695-88473717 GCTCCCCAGCCCAGATTCTCGGG + Intronic
1146585776 17:34080347-34080369 TGAACTCAGCCCAGCTTCCCTGG + Intronic
1146891604 17:36510003-36510025 TTCCCCCAGCAGAGCTTCTCAGG + Intronic
1148085613 17:44992020-44992042 TTCCCCCAGCCCCGCTTCCCAGG - Intergenic
1149016368 17:51913271-51913293 TTTCCTCCCCCCTGCTTTTCTGG - Intronic
1149596220 17:57866367-57866389 TTGCCTGAGCCCAGCGCCTCTGG + Intronic
1149776036 17:59357929-59357951 TTTCCTCATCCCACCTCCACTGG - Intronic
1150162822 17:62913717-62913739 ATTCCTCAGCCCCCCTTCCCAGG + Intergenic
1150287142 17:63960882-63960904 TTTCCTCACCCCTGCTTCCAGGG + Intronic
1150822435 17:68446286-68446308 TTTTCCCACCCCAGCCTCTCGGG + Intronic
1152573181 17:81129318-81129340 TGTCCTGAGCCCAGCCTGTCTGG + Intronic
1152734954 17:81992720-81992742 TTTCCTGAGCCCTGCGTCTCGGG + Intronic
1154165991 18:12014881-12014903 TTTCCTTAGCCCAGAATCTCAGG + Intronic
1154289000 18:13089041-13089063 TTTTCTCACCTCAGATTCTCTGG + Intronic
1155356154 18:24955975-24955997 TTTGCTCAGCCCAGTTACTCAGG + Intergenic
1156701268 18:39828451-39828473 TTACCATAGCCCAGCTCCTCTGG - Intergenic
1157593784 18:48851613-48851635 TGTCCTGAGACTAGCTTCTCAGG - Intronic
1157722906 18:49939004-49939026 TCTCCTCAGCCCTTGTTCTCAGG - Intronic
1158988323 18:62842316-62842338 GTTCCCCACCCCAACTTCTCAGG - Intronic
1160117208 18:76090465-76090487 TTGCCTCATCCCCACTTCTCAGG - Intergenic
1160312489 18:77808965-77808987 TTTCCTCTGTCCAGCTTTTCAGG + Intergenic
1160563625 18:79773619-79773641 TTTCCTCAGCCTGCTTTCTCTGG - Intergenic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1162078530 19:8205200-8205222 TGTCCCCTGCCCAGCTTCCCAGG - Intronic
1162536012 19:11262937-11262959 TTTCCCCAGCCCTGCTCCTGGGG - Intergenic
1163497558 19:17655601-17655623 TTTCACCAGCCCAGCCCCTCTGG + Intronic
1163591759 19:18197714-18197736 TTTCCTCAGAGAAGCATCTCTGG - Intronic
1164145537 19:22510422-22510444 TGCCCTCAGCCCTGCTTCTGAGG - Intronic
1164558531 19:29271566-29271588 TTTCCACAGCCCCGTGTCTCTGG - Intergenic
1165056881 19:33183140-33183162 ATTCCTCAGCAGAGCTTCTCTGG + Intronic
1165406904 19:35636649-35636671 TTTCCTCAGCCCTGCTTCCTTGG - Intronic
1165652816 19:37506269-37506291 TTTCCTCAGGTCGGCTTCTCGGG + Intergenic
1165832058 19:38735287-38735309 TTCCCCCACCCCAGCATCTCAGG - Intronic
1166253920 19:41589162-41589184 CTTGGTCAGCTCAGCTTCTCAGG - Intronic
1166352264 19:42205007-42205029 TTTCCTCAATCCCGCTTCTGAGG - Intronic
1167485661 19:49761620-49761642 TTTCCTGAGCCCAGCCTCACTGG + Intronic
1167506718 19:49874745-49874767 CTTCCGCAGCCCAGCAGCTCTGG - Intronic
925290928 2:2748277-2748299 AGTCCTCAGCCCAGCAACTCTGG + Intergenic
925617658 2:5758935-5758957 TTTTCACAGCCCGGGTTCTCTGG - Intergenic
925671028 2:6310097-6310119 TTTCTGCAGCCCAGCATCTTTGG + Intergenic
927723287 2:25401382-25401404 TGTCCTCAGGGCACCTTCTCTGG - Intronic
928296706 2:30090060-30090082 TCAGCTCAGCCTAGCTTCTCAGG + Intergenic
929291420 2:40196305-40196327 TTTTCTCAGGACAACTTCTCTGG - Intronic
930064945 2:47320746-47320768 TACCCTCAGCCCAGACTCTCCGG - Intergenic
930247142 2:48995685-48995707 TTTCACCAGCCCATCATCTCAGG + Intronic
930251633 2:49041367-49041389 TTTGCTTAGCCTAGCTTCTGAGG + Intronic
930929340 2:56861768-56861790 TTTCCTCAGCAAATCTTCTGGGG + Intergenic
933486712 2:82933618-82933640 TTTCCTTAACCCAGCTTCAGTGG - Intergenic
933796236 2:85922164-85922186 TTTCCTCTGCCCCACTTCCCCGG + Intergenic
933840556 2:86282881-86282903 TGTGCTCAGCCCTGCCTCTCAGG + Intronic
935211058 2:100939534-100939556 TCAGATCAGCCCAGCTTCTCTGG - Intronic
936075320 2:109397997-109398019 TATGCTCAGGCCAGCTTCTGGGG + Intronic
936151336 2:110023942-110023964 CTTCCTCACCCCACCTTCCCTGG + Intergenic
936193339 2:110347427-110347449 CTTCCTCACCCCACCTTCCCTGG - Intergenic
942224431 2:173802832-173802854 TTTCCTGAGGCCTGCTTCTGAGG + Intergenic
942232633 2:173874198-173874220 CTCCCTCACCCCAGCTGCTCTGG - Intergenic
942338628 2:174919011-174919033 TTCCCTCACCACAGCTTATCAGG + Intronic
943363571 2:186948578-186948600 TTTCCTCAGGCCAGTGTATCTGG + Intergenic
944718153 2:202395981-202396003 TTTCCTTAGCCCAGCCTCAAAGG - Intronic
944908802 2:204288876-204288898 TTTCCACAGGACAGCTTCTCTGG - Intergenic
945009383 2:205445406-205445428 TGGCATCAGCTCAGCTTCTCAGG + Intronic
946142953 2:217706936-217706958 GTTCCTCACCCCAGTCTCTCAGG + Intronic
946745773 2:222844222-222844244 TTTGCTTAGCCCAGATGCTCAGG + Intergenic
946839711 2:223808307-223808329 TCTCTGCAGCGCAGCTTCTCTGG - Intronic
946854133 2:223936172-223936194 GTGCCTCAGCCCAGCTTCTTGGG + Intronic
947297857 2:228652707-228652729 TCTCCTCATTCCAGGTTCTCAGG - Intergenic
949044702 2:241867099-241867121 CTTCCTGAGCTCAGCTTCTGGGG - Intergenic
1169640935 20:7751413-7751435 TTGCCTCAGCCCTGCAACTCAGG - Intergenic
1169903899 20:10581061-10581083 TCTCCTCAACACAGCTTTTCTGG - Intronic
1171032650 20:21691311-21691333 TTTAAGCATCCCAGCTTCTCTGG - Intergenic
1172506576 20:35467207-35467229 TTTTCCCAGCCCTGCTCCTCAGG + Intronic
1172526891 20:35605244-35605266 TTTCCTCAGGGAACCTTCTCTGG + Intergenic
1173034911 20:39399406-39399428 TGTCCTAAACCCATCTTCTCTGG + Intergenic
1173603062 20:44309914-44309936 TATTCTTAGCCCAGCCTCTCAGG + Intronic
1175189678 20:57202785-57202807 TTTCCTCACCACAGCTACTGAGG - Intronic
1175647531 20:60687481-60687503 TTTCCTCAGCACAAATTCTAGGG - Intergenic
1175941353 20:62538925-62538947 TCCCCTCAGCCCGGCATCTCAGG - Intergenic
1176885830 21:14254812-14254834 TTTCCTCTGCCCATCTCCTGTGG + Intergenic
1178674614 21:34620659-34620681 TCCCCTCTGGCCAGCTTCTCAGG + Intergenic
1179831652 21:44000714-44000736 TGGCCTCAGCCCAGCTTTTTTGG - Intergenic
1180002493 21:45001653-45001675 TTGCCCCAGCTCAGCATCTCGGG - Intergenic
1181043378 22:20203414-20203436 TGTCCTCTGCCCTGCATCTCAGG - Intergenic
1182439260 22:30352634-30352656 CTTCCTCAGGCCAGCAGCTCAGG + Intronic
949291401 3:2470800-2470822 TTTCCTCAGTTCAGCTTCAGAGG - Intronic
949763784 3:7503094-7503116 TTTCCTCTGCCCAGCTTTCTAGG - Intronic
950615205 3:14152554-14152576 TTTGCCTAGCACAGCTTCTCTGG - Intronic
951783811 3:26395837-26395859 TATCCTCATCCAAGATTCTCTGG - Intergenic
951890130 3:27560847-27560869 TTTCCCCATCCCAGCTGCTGTGG + Intergenic
952052611 3:29403483-29403505 TTTCCCCAGCTCATCTTCCCTGG - Intronic
952279681 3:31911005-31911027 TCTCCACAGCCCAGCCTTTCAGG + Intronic
952413014 3:33066121-33066143 TCTCCTCAGCTGAGCTCCTCAGG + Intronic
952520148 3:34148685-34148707 TGTCCTCACCCCAGGTTCTTGGG - Intergenic
952537086 3:34322462-34322484 AATCCTTAGCACAGCTTCTCAGG - Intergenic
953612464 3:44458646-44458668 TTTTCTGAGCCCTGCTTCTGAGG - Intronic
954215479 3:49122069-49122091 CATCCTCAGCCCAGCTCCTGGGG + Exonic
954331175 3:49891166-49891188 TTGCTTCACCCCAGCTACTCTGG + Intronic
955516350 3:59730157-59730179 TCTTCTCAGCTCAGCTTCCCAGG - Intergenic
955564542 3:60229627-60229649 TTTTCTCAGCCCAGTTACTCTGG - Intronic
957418628 3:79938605-79938627 TTGTCTCTGCCCAGCTGCTCAGG + Intergenic
958709477 3:97699923-97699945 TTGCCTCAGCCCAAGTTCCCTGG + Intronic
958856425 3:99391636-99391658 TTTCCTCACCACAGAATCTCTGG + Intergenic
959302905 3:104625062-104625084 TTTCCTCTGGGCGGCTTCTCAGG + Intergenic
959317929 3:104832942-104832964 TCAGCTCAGCCGAGCTTCTCTGG - Intergenic
961718933 3:128879399-128879421 TTTCCTCCGGCCAGCTCCTTTGG + Intergenic
962186510 3:133266117-133266139 TTTCCTTAGCCTAGATTTTCTGG + Intronic
962279349 3:134038591-134038613 TTTCCTCAGTCTTGCTTCTAGGG + Intronic
962856606 3:139351852-139351874 ATTCCTCAGCCTAGCATCTGAGG - Intronic
963836887 3:150067234-150067256 AATCCTCAGCCCAGTTTATCAGG + Intergenic
963848614 3:150184465-150184487 TTCCCACAGCCCAGCGGCTCTGG - Intergenic
964750466 3:160049518-160049540 CTTCCTCAGCCCAGTGTTTCTGG - Intergenic
964920195 3:161886457-161886479 TGCCCTCACCACAGCTTCTCAGG - Intergenic
965189607 3:165511497-165511519 TTTCCTCTCCTCAGCTTCTTTGG + Intergenic
965776366 3:172235903-172235925 TCTTTTCAGCCCAGCTTCTCAGG - Intronic
965816714 3:172643903-172643925 TTTCCTCTGGCCAGCTGCTCAGG + Intronic
967036904 3:185654900-185654922 TTAGCTCAGCCCACCTCCTCTGG + Intronic
967900011 3:194440259-194440281 TTTCTTTAGCTCAGCTACTCTGG - Intronic
969478777 4:7435916-7435938 TGTCCTCAGCTCAGCTTCCTGGG + Intronic
969633428 4:8351566-8351588 TTTCCTGGGCCCAGCTCCTAGGG + Intergenic
969951653 4:10843212-10843234 TGTCATCAGCTCAGCTTCTTTGG + Intergenic
970001161 4:11367504-11367526 CTTCCAGAGCCCAGCTTCTCTGG - Intergenic
971783114 4:31064569-31064591 TTGCCTCTTCCCAGCTTCTGTGG + Intronic
974024483 4:56721338-56721360 TTTCCTGAGGCCTGCTTCTGAGG - Intergenic
976552010 4:86407312-86407334 TTTCCTCTGCCCATCTTCTCAGG - Intronic
977378471 4:96238416-96238438 TTGCATCTGCCCAGCTTCTAGGG - Intergenic
979780412 4:124644733-124644755 GTTCCTCAGCGCAGCCTCTGTGG + Intergenic
981549063 4:145924541-145924563 CTGCCTCAAACCAGCTTCTCAGG - Intronic
981883822 4:149648980-149649002 TTTCCTTATGCCAGCATCTCGGG + Intergenic
984206256 4:176792083-176792105 TTTCCCCCGCGCAGGTTCTCGGG + Intronic
984480283 4:180292002-180292024 CTTCCTCTGCACAGTTTCTCAGG + Intergenic
984569610 4:181376232-181376254 TTTCCTCTGTGCAGCTTCTGTGG + Intergenic
984803329 4:183733939-183733961 TTATCTTAGCCCAGGTTCTCTGG - Intergenic
985478686 5:93803-93825 CTTCCTCAGCCCAGCATTTCTGG - Intergenic
985532176 5:440377-440399 TATCCCCACACCAGCTTCTCGGG + Intergenic
985614088 5:909177-909199 TCTCCACAGCCCAGCCTCACAGG + Intronic
985714403 5:1447134-1447156 TTTCCTCAACCCTGCTGCTCTGG - Intergenic
986239212 5:5942313-5942335 TTTCCTTAGACCAGCCTCTAAGG + Intergenic
986754753 5:10824563-10824585 TCTCTTCAGCCCAGCTTCTGTGG + Intergenic
988139774 5:27220896-27220918 TTAGCTCTGCTCAGCTTCTCTGG - Intergenic
988539759 5:32098350-32098372 TTTCCTCATCCCAGGTCCACAGG + Exonic
989189444 5:38655713-38655735 TTAACTCAGTCTAGCTTCTCTGG - Intergenic
989961162 5:50417095-50417117 TTTCCTGAGCCAACCTTCTCGGG + Intronic
992591058 5:78295748-78295770 TTCCCCCAGCCCGCCTTCTCAGG + Intergenic
992660037 5:78950314-78950336 TTTCCTCAGCCCAGCTTCTCTGG - Intronic
992712782 5:79477060-79477082 TTTCCTGAGACCTGCTTCTGAGG + Intronic
992744275 5:79804015-79804037 ATTCCTGAGCCCAGCTGCTAAGG + Intergenic
993124961 5:83822573-83822595 TTTTCACAGCCCCACTTCTCTGG - Intergenic
993130244 5:83887873-83887895 TTTCCTCTACTCAGTTTCTCAGG - Intergenic
993435869 5:87893428-87893450 TTTCCTCTGCCCAACTTGGCTGG + Intergenic
996308350 5:122076906-122076928 TTTCCTCCGCCGCGCATCTCAGG + Exonic
996525012 5:124469921-124469943 TTTCTTCAGCCCAGTGTTTCTGG + Intergenic
997310306 5:132874129-132874151 ACTCCTCTGCCCAGCTTCCCAGG - Intronic
998400732 5:141847632-141847654 TTTCCTCAGGGAAGCTTCCCTGG + Intergenic
999667786 5:153932019-153932041 TTGCTTCAGTCCTGCTTCTCGGG + Intergenic
1003130728 6:3393178-3393200 TTTCGTCACCCCCGCTGCTCAGG - Intronic
1005183652 6:23137335-23137357 TGTCCTGAGGCCAGCTTCCCTGG + Intergenic
1006106203 6:31718522-31718544 TTTCCCCAGCCCAGCCTCCCAGG + Intergenic
1007633343 6:43284540-43284562 TTTCCTAAGCCTGGCCTCTCCGG - Intronic
1007711195 6:43825497-43825519 GTTCCCAAGCCCAGCTTCTCTGG + Intergenic
1007711602 6:43827849-43827871 TGTCCCCAGCCCAGTGTCTCTGG + Intergenic
1007998510 6:46334502-46334524 TTACCTCAGCCTCCCTTCTCAGG - Intronic
1010357100 6:74947185-74947207 TGTTCTCAGCCTAGCTTCTTCGG + Intergenic
1010387717 6:75301850-75301872 TTTCAGCAGCCCTTCTTCTCTGG + Intronic
1011381182 6:86743743-86743765 TTTCCTGAGGCCTGCTTCTTAGG + Intergenic
1011726975 6:90219476-90219498 TTTCCTCCTCCCAGCTCCTTTGG + Intronic
1012464563 6:99502913-99502935 TGTCATCAGCTCAGCTTCTGGGG - Intronic
1013498906 6:110727865-110727887 TTGTCCCAGCCCAGCTACTCAGG + Intronic
1015840532 6:137471960-137471982 TTTCCTCAGCTCTGGTTCTGTGG - Intergenic
1015897679 6:138033123-138033145 TTTCGTCAGTGGAGCTTCTCTGG - Intergenic
1017718989 6:157232131-157232153 TATCCTCAGTCCAGCTTCTGAGG + Intergenic
1018516863 6:164591095-164591117 TTTACTCAGCCATACTTCTCTGG - Intergenic
1018952415 6:168387747-168387769 TGTCCCCAGCAGAGCTTCTCAGG + Intergenic
1020263086 7:6542178-6542200 TTTATTCATCCCAGCTACTCGGG + Intronic
1021200798 7:17726874-17726896 TTCCCTCAACCCTGCTTCCCTGG + Intergenic
1022465912 7:30653177-30653199 TTTGCCCATCCCAGCCTCTCTGG - Intronic
1022713409 7:32874474-32874496 TTTAGTCATCCCAGCTACTCAGG + Intronic
1023342897 7:39240974-39240996 CTTCCTCTGCCCACCTTCTTGGG + Intronic
1024274132 7:47664124-47664146 TTTCCACAGGACAGCCTCTCTGG + Intergenic
1024700402 7:51899814-51899836 CTGCCTCAGCCCAGCTGCACTGG - Intergenic
1025940136 7:66070533-66070555 ATTCCTTGGGCCAGCTTCTCAGG - Intergenic
1026253134 7:68688306-68688328 TTTCCTCAGAGCAGCTGCACGGG + Intergenic
1026825583 7:73579267-73579289 TTCCCACATCCCAGCTTCTCAGG - Intergenic
1027054798 7:75042705-75042727 TTTCCTAAGACGGGCTTCTCAGG + Exonic
1028243380 7:88448361-88448383 TTTTCTCTCCCCAGCTTCCCCGG + Intergenic
1029439224 7:100578023-100578045 TTCCCTCTGCCCAGCATCCCAGG - Intronic
1030278480 7:107744477-107744499 TTTATTTAGCCCAGCTGCTCTGG + Intronic
1031401467 7:121329595-121329617 TTGGCGCAGCCCAGCTTCTCTGG - Exonic
1032150717 7:129427257-129427279 CTTCCTCAGCCCATCCTCTGTGG - Exonic
1033271106 7:139933953-139933975 TCTCCTCATCCCTTCTTCTCAGG - Intronic
1034949046 7:155284709-155284731 TGTCCTCAGTCCAGGTTCCCAGG - Intergenic
1037022577 8:13992098-13992120 TTTTTTCTGCCCAGCTTCTGTGG + Intergenic
1037804020 8:22049424-22049446 TGCCCCCACCCCAGCTTCTCCGG + Intronic
1039269643 8:35866988-35867010 ATTCCTCAGGCCAGAATCTCTGG + Intergenic
1039358307 8:36845922-36845944 TGTCCTTAGCCCAGCCTCTAGGG + Intronic
1039866580 8:41509927-41509949 ATTCCTTGGGCCAGCTTCTCAGG + Exonic
1041748199 8:61231994-61232016 TTTCCTCAGGGCTCCTTCTCTGG - Intronic
1042500030 8:69498793-69498815 TTTCCTCAGGCCAGCTTCTTTGG - Intronic
1042533975 8:69840556-69840578 TTTCCTGAGGCCTGCTTCTGAGG + Intergenic
1042724002 8:71852607-71852629 TTTGGTCTGCCCAGCCTCTCAGG + Intronic
1044738664 8:95303926-95303948 TTTCCTCAGCGCAGGCTCTCTGG + Intergenic
1044890340 8:96828465-96828487 TTTTCCCATCCCAGCTTCCCAGG + Intronic
1045248483 8:100463628-100463650 CTTCCTCCACCCAGCTACTCAGG - Intergenic
1045440318 8:102202402-102202424 TTCCATCATCCCACCTTCTCAGG + Intergenic
1047334928 8:123926384-123926406 TTTCCCCAGGCCAGATTGTCTGG + Intronic
1047436018 8:124835909-124835931 ATGCCTCAGCCCAGCCTCCCTGG - Intergenic
1048310869 8:133321614-133321636 TGTCCTCAGCCCACCCTCTCTGG + Intergenic
1048416340 8:134231532-134231554 TTATCTTAGTCCAGCTTCTCTGG - Intergenic
1051399394 9:16663252-16663274 TGTAATCAGCCCAGCTACTCGGG - Intronic
1053459079 9:38254544-38254566 TTCCCACAGCCCAGCATCTTTGG - Intergenic
1055296688 9:74840496-74840518 CTGCCTCACCCCAGGTTCTCTGG - Intronic
1056100942 9:83300262-83300284 CTTCCTCAGGGCATCTTCTCTGG - Intronic
1056543854 9:87596712-87596734 CTTCCTCTGCACAGCTTCTGGGG + Intronic
1057361041 9:94374288-94374310 TAGCCTCAGTCCAGATTCTCCGG + Intergenic
1057662301 9:97013818-97013840 TAGCCTCAGTCCAGATTCTCCGG - Intergenic
1058113449 9:101056998-101057020 TGTCCCCAGCCCAGCTTTCCAGG + Intronic
1059442431 9:114316328-114316350 CCTCCTCACCCCAGCTTGTCTGG + Intergenic
1059568422 9:115407767-115407789 TTTCCTCTCCCCAGCATGTCTGG + Intergenic
1059937155 9:119322631-119322653 GATCATCAGCCCAGTTTCTCAGG - Intronic
1061406144 9:130394019-130394041 TGGCCTCTGGCCAGCTTCTCTGG + Intronic
1061536440 9:131253054-131253076 TCTCGTCATCCCAGCTACTCAGG - Intergenic
1062205281 9:135333104-135333126 TTTCTTCAGCGCTGCCTCTCTGG + Intergenic
1062268214 9:135696989-135697011 TTCCCTCTGCCCAACTCCTCCGG + Intronic
1062697236 9:137881635-137881657 CTCCCTCAGCCCAGCTTCCCGGG + Intronic
1185491416 X:520017-520039 CTTTCTCAGCCCACCGTCTCTGG - Intergenic
1185573438 X:1152219-1152241 TTCCCTCACCCCAGCTCCTGGGG - Intergenic
1186414383 X:9370520-9370542 GTTCCTCTCCCCAGCATCTCAGG - Intergenic
1187335332 X:18376595-18376617 TTGCCTCAGCGCAGCCTCCCAGG + Intergenic
1187576066 X:20556851-20556873 TTTCCTCTGCTGAGCTTCTATGG + Intergenic
1187862129 X:23692661-23692683 TTTTCTGAGCCCTGCTTCTGAGG + Intergenic
1189157766 X:38776450-38776472 TTTATTTAGCCTAGCTTCTCTGG - Intergenic
1189674492 X:43447137-43447159 TTTCCTCAGACTAGCTTCTAAGG - Intergenic
1190512901 X:51192204-51192226 TTCCCACATCCCAGCCTCTCTGG - Intergenic
1192213615 X:69142972-69142994 CTGCCTCAGCCCCGCCTCTCGGG - Intergenic
1192496360 X:71618673-71618695 CATCCTCTGCCCAGCTTTTCTGG - Intergenic
1194142540 X:90222854-90222876 TGACCGCAGCCCACCTTCTCAGG - Intergenic
1194711674 X:97243299-97243321 TTCCCTCATGCCTGCTTCTCTGG + Intronic
1194779332 X:98004699-98004721 TTTTCTAAGCCCAGCAACTCAGG + Intergenic
1194919827 X:99751015-99751037 TTACCACATCCCAGCTGCTCTGG + Intergenic
1195667961 X:107447944-107447966 GTTCCTCAGAGCATCTTCTCAGG + Intergenic
1195879526 X:109577967-109577989 TCTCCCCACCCCAGGTTCTCAGG - Intergenic
1196276308 X:113769375-113769397 CTTCCTCAGCGGAGTTTCTCAGG - Intergenic
1197717262 X:129718608-129718630 ATTCCTCAGCCAGGCCTCTCAGG - Intergenic
1198256991 X:134932565-134932587 TTTCCTGAGGCCAGCTTCTGAGG + Intergenic
1198295674 X:135284024-135284046 TCTGCTCAGCTCATCTTCTCTGG + Intronic
1199591046 X:149468899-149468921 TTTCCACAACCCAGCATCTTTGG + Intergenic
1200425599 Y:3017369-3017391 TGTACTCATCCCAGCTACTCAGG - Intergenic
1201771849 Y:17623315-17623337 TGACCTCAGGGCAGCTTCTCAGG - Intergenic
1201829706 Y:18282671-18282693 TGACCTCAGGGCAGCTTCTCAGG + Intergenic