ID: 992661083

View in Genome Browser
Species Human (GRCh38)
Location 5:78961534-78961556
Sequence AACACGGAACTGAGGACAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992661083 Original CRISPR AACACGGAACTGAGGACAAT AGG (reversed) Intronic
911439691 1:97909710-97909732 AACAAGGGACTGAGGACTTTAGG - Intronic
919369383 1:196704783-196704805 AACATGGAACTGAGGATTATTGG + Intronic
920831028 1:209465828-209465850 AACAAGGGAGTGTGGACAATGGG + Intergenic
1068339112 10:55678234-55678256 AACAGGGAACTCAGGTCACTGGG - Intergenic
1069359763 10:67628827-67628849 AACAATTAACTGTGGACAATGGG - Intronic
1076649758 10:131979863-131979885 ACCTCGGAACAGAGAACAATGGG - Intronic
1083036043 11:59638566-59638588 AACACTGAACTGGGTACAACAGG - Intronic
1083327565 11:61880609-61880631 AACCTGGAACTGAGGACCACTGG + Intronic
1089280077 11:117368092-117368114 AACTAAGTACTGAGGACAATAGG + Intronic
1095308844 12:40670700-40670722 AACAGGAAATTCAGGACAATTGG + Intergenic
1101229150 12:102722078-102722100 TACACAGAACTCAGGACAAAAGG - Intergenic
1103458310 12:121084687-121084709 AACAGAGAGCTGAGGACAAAGGG - Intergenic
1103542376 12:121675059-121675081 AGAACGGATCTGAGGACAAAGGG - Intergenic
1104373570 12:128244901-128244923 AACATAGAATTGAGGTCAATGGG + Intergenic
1109382396 13:61580933-61580955 AACACTGATTTGAGGACAACTGG + Intergenic
1111520060 13:89389688-89389710 CCCACTAAACTGAGGACAATAGG + Intergenic
1112777519 13:102861406-102861428 AACAGGGAACAAAGAACAATTGG - Intronic
1113666210 13:112143479-112143501 AACATGGAGATGAGGACGATTGG + Intergenic
1121437036 14:93927078-93927100 ACCAGGGAACTGAGGTCAAGGGG + Intronic
1128774197 15:70307215-70307237 AACACAGGAGTGAGGAAAATTGG + Intergenic
1129850183 15:78789370-78789392 AATACAGCACTGAGGGCAATGGG + Intronic
1130252078 15:82306206-82306228 AATACAGCACTGAGGGCAATGGG - Intergenic
1131362799 15:91808732-91808754 AATACGGTACTGAGGACCAGTGG + Intergenic
1131573911 15:93567236-93567258 AATAAGGAACTGAGCAGAATGGG - Intergenic
1132979507 16:2729249-2729271 AACACAGAACAGCAGACAATGGG - Intergenic
1159810115 18:73008336-73008358 AACAAGGAACTTAGCTCAATTGG - Intergenic
1161914487 19:7218319-7218341 ACCACAGTACTGAGGACATTTGG - Intronic
1202631634 1_KI270706v1_random:5126-5148 AAACCGGAACTGAAAACAATGGG - Intergenic
931058572 2:58501139-58501161 AACAGTGAACTGAGGTCAAAAGG + Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
931826650 2:66007353-66007375 TACAGGGAACTGAGCACAGTTGG + Intergenic
940087587 2:149878203-149878225 ATCACAGAAATCAGGACAATGGG + Intergenic
941380293 2:164784536-164784558 AACACAGTGCTGTGGACAATGGG - Intronic
942280227 2:174355559-174355581 AACATGGAACTGTACACAATTGG - Intronic
944276664 2:197846639-197846661 AATAAAGAACTGAAGACAATTGG + Intronic
1171845832 20:30273999-30274021 AACATGGAAGTCAGGAAAATAGG - Intergenic
1172267545 20:33629836-33629858 AACACAGAGCTGAGGAAAACGGG + Exonic
1179659629 21:42865942-42865964 AACAGGGCACTGAGGACACCAGG + Intronic
1182183190 22:28372799-28372821 AACACCGAAGTCAGGAGAATGGG + Intronic
1184533655 22:45072056-45072078 AACCCGGTGCTGAGGACAAGTGG - Intergenic
1184562909 22:45273769-45273791 CACAGGGGCCTGAGGACAATGGG - Intergenic
949927332 3:9052011-9052033 AACACAGAACTGAGCAAAATTGG - Intronic
950164667 3:10785122-10785144 AACACACAACTGTGGCCAATAGG - Intergenic
950799457 3:15538200-15538222 AACACGGAACTCAACACAACAGG - Intergenic
952136120 3:30422576-30422598 AACACGGAAGTGGTGATAATGGG + Intergenic
952174668 3:30848878-30848900 TACACGGAACAGAGAACAACTGG - Intronic
959594274 3:108111992-108112014 AAGAAAGAACTGAGGACATTAGG - Intergenic
959828031 3:110824080-110824102 AACAGGGAATTTAGGAGAATGGG - Intergenic
966403940 3:179575656-179575678 AGCACAGAACTGTGGAAAATGGG + Intronic
967266312 3:187695415-187695437 AAAACGGAAGTGAGGACAAGGGG - Intergenic
970046466 4:11859957-11859979 AACACTGACCTAAGGACAAGAGG - Intergenic
972067886 4:34974286-34974308 CACATGGAAATGAGGACAAGTGG - Intergenic
975086529 4:70347700-70347722 AACACTGAAATGAACACAATTGG + Intergenic
975710242 4:77154295-77154317 CACATGTCACTGAGGACAATGGG + Intergenic
979898006 4:126185451-126185473 AACAGTAAACTGAAGACAATTGG - Intergenic
980031015 4:127830474-127830496 AACACAGAACTGAAGAGAATGGG - Intronic
981265598 4:142779606-142779628 AACACGGAATGAAGGACAAGAGG - Intronic
982446124 4:155492421-155492443 TACACTGAAATGAGGTCAATAGG + Intergenic
982905849 4:161069456-161069478 AATATGGAACTGGGGAAAATTGG - Intergenic
987047081 5:14118485-14118507 AACACGAAACTGCAGACTATTGG - Intergenic
990666705 5:58080653-58080675 AAAATGGAACAGGGGACAATGGG - Intergenic
992661083 5:78961534-78961556 AACACGGAACTGAGGACAATAGG - Intronic
993466420 5:88252268-88252290 AAAAAGGAACTGTGGAAAATAGG + Intronic
993830744 5:92754705-92754727 AGCACCAAACTGAGGATAATTGG + Intergenic
996831601 5:127746664-127746686 ATCAGGGATCCGAGGACAATTGG + Intergenic
998178257 5:139915311-139915333 GACACAGTACAGAGGACAATGGG + Intronic
1000690956 5:164320130-164320152 AACATGAAAATAAGGACAATGGG - Intergenic
1001066460 5:168538623-168538645 AGGAGGGAAATGAGGACAATGGG - Intergenic
1005018538 6:21396118-21396140 AACATGGGACTGAGGGTAATAGG - Intergenic
1006368344 6:33629340-33629362 ATCACACCACTGAGGACAATGGG - Intronic
1008852347 6:56038341-56038363 AACTTTGAAATGAGGACAATGGG - Intergenic
1015744786 6:136498348-136498370 CACAAGTAACTGAGGACACTGGG + Intronic
1016030942 6:139337335-139337357 AACACAGAACAGAGGAAAAATGG + Intergenic
1016121446 6:140347052-140347074 AGCATGGAACAGAGGGCAATAGG - Intergenic
1035995559 8:4542437-4542459 AACACAGTTCTGAGAACAATGGG + Intronic
1039253643 8:35694208-35694230 AACACTGAACTGGGGACTGTTGG + Intronic
1039256682 8:35726463-35726485 AGGACAGAACTGAGGACAACTGG + Exonic
1043176674 8:77030100-77030122 CACAGGGAACTGAAGAAAATGGG - Intergenic
1043855860 8:85263868-85263890 ATCACGGAGCTGAGCACAAAGGG - Intronic
1045804128 8:106137202-106137224 AACATGGAACTGAAGGCAATTGG - Intergenic
1055834895 9:80427818-80427840 AAAACGGAACTGATGGCAATAGG + Intergenic
1057953703 9:99390498-99390520 AACAGTTAACTGAGGAAAATGGG + Intergenic
1059796430 9:117702067-117702089 AACACAGAAAAGAAGACAATTGG + Intergenic
1188741025 X:33781767-33781789 AACACGGAAATCAGGGCAAAAGG + Intergenic
1189099812 X:38177039-38177061 AACAAGGACCTGAGGGCACTAGG + Intronic
1193469301 X:81879295-81879317 AACAAGGCTCTGAAGACAATAGG - Intergenic
1198618154 X:138480623-138480645 AACAAGGAAGTGCGGAGAATAGG - Intergenic
1200927519 Y:8667900-8667922 AACATGGAAGTGAGGAAAAGAGG - Intergenic