ID: 992663553

View in Genome Browser
Species Human (GRCh38)
Location 5:78984739-78984761
Sequence CCGGGCATGCGCAGAGGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 203}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992663549_992663553 -7 Left 992663549 5:78984723-78984745 CCGCGGGGCGCCAGAGCCGGGCA 0: 1
1: 0
2: 3
3: 15
4: 179
Right 992663553 5:78984739-78984761 CCGGGCATGCGCAGAGGCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 203
992663534_992663553 23 Left 992663534 5:78984693-78984715 CCCGCCCAACCCGGCGGCCGGGG 0: 1
1: 0
2: 3
3: 19
4: 191
Right 992663553 5:78984739-78984761 CCGGGCATGCGCAGAGGCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 203
992663537_992663553 19 Left 992663537 5:78984697-78984719 CCCAACCCGGCGGCCGGGGCGCG 0: 1
1: 0
2: 0
3: 18
4: 126
Right 992663553 5:78984739-78984761 CCGGGCATGCGCAGAGGCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 203
992663546_992663553 6 Left 992663546 5:78984710-78984732 CCGGGGCGCGGGTCCGCGGGGCG 0: 1
1: 0
2: 5
3: 38
4: 277
Right 992663553 5:78984739-78984761 CCGGGCATGCGCAGAGGCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 203
992663531_992663553 26 Left 992663531 5:78984690-78984712 CCACCCGCCCAACCCGGCGGCCG 0: 1
1: 0
2: 2
3: 30
4: 215
Right 992663553 5:78984739-78984761 CCGGGCATGCGCAGAGGCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 203
992663541_992663553 14 Left 992663541 5:78984702-78984724 CCCGGCGGCCGGGGCGCGGGTCC 0: 1
1: 1
2: 1
3: 41
4: 314
Right 992663553 5:78984739-78984761 CCGGGCATGCGCAGAGGCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 203
992663542_992663553 13 Left 992663542 5:78984703-78984725 CCGGCGGCCGGGGCGCGGGTCCG 0: 1
1: 0
2: 2
3: 36
4: 233
Right 992663553 5:78984739-78984761 CCGGGCATGCGCAGAGGCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 203
992663536_992663553 22 Left 992663536 5:78984694-78984716 CCGCCCAACCCGGCGGCCGGGGC 0: 1
1: 0
2: 4
3: 19
4: 210
Right 992663553 5:78984739-78984761 CCGGGCATGCGCAGAGGCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 203
992663538_992663553 18 Left 992663538 5:78984698-78984720 CCAACCCGGCGGCCGGGGCGCGG 0: 1
1: 0
2: 1
3: 19
4: 237
Right 992663553 5:78984739-78984761 CCGGGCATGCGCAGAGGCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992663553 Original CRISPR CCGGGCATGCGCAGAGGCCG CGG Intronic
900418130 1:2544316-2544338 CCAGGCATGTGCAGTGGCCTCGG + Intergenic
900658772 1:3772734-3772756 CCGGGCCTGGGCAGGGGGCGAGG - Intergenic
900671431 1:3857215-3857237 TCGCGCACGCGCAGAGGCCCTGG - Intergenic
901380878 1:8873238-8873260 CTGCGCATGTGCAGAGGCAGTGG + Intronic
901409375 1:9071899-9071921 CCGGGCTGAGGCAGAGGCCGAGG - Intronic
901409386 1:9071927-9071949 CCGGGCTGAGGCAGAGGCCGAGG - Intronic
901641192 1:10694026-10694048 CCGGGCGGGCGCCGAGGCCGCGG + Intronic
901771172 1:11531081-11531103 CTGGGGAGGCACAGAGGCCGTGG + Intronic
902560138 1:17272216-17272238 CCGAGCATGCGCAAAGGCCCGGG + Intronic
902975110 1:20082825-20082847 CCAGGGATGCTCAGAGGCAGTGG + Intronic
903310439 1:22451382-22451404 CCGGGCATGGTGGGAGGCCGAGG + Intergenic
903652357 1:24929888-24929910 CCGGGCAGGCGGAGACGGCGCGG + Intronic
910285932 1:85553955-85553977 CAGGGCAGGCACAGAGGCCTGGG - Intronic
910935783 1:92484025-92484047 CCGGGGATGCCCAGTGGTCGAGG + Intronic
914247567 1:145897289-145897311 CCGGGCATGAGCAGAAGGGGCGG + Exonic
915322088 1:155061763-155061785 GAGGGCATGCGCAGAGGGCTTGG - Intronic
921604763 1:217139717-217139739 GCGGGCCCGCGCAGAGGCCGGGG + Intergenic
922775504 1:228212698-228212720 CCGTGCAGGTGTAGAGGCCGCGG - Exonic
924613152 1:245590246-245590268 CCGCGCATGCGCAGGGTCCCGGG + Intronic
1062874016 10:931291-931313 CCGGGCCTGGGCCGGGGCCGGGG - Intronic
1063428099 10:5965311-5965333 CCGGGGATGGGCACAGGCCCTGG - Intronic
1064231030 10:13529166-13529188 CCGAGGAGGCGCGGAGGCCGCGG + Intergenic
1067980064 10:51074433-51074455 CTGGGCATGCTCAGAAGCCAGGG + Exonic
1068196679 10:53726652-53726674 ACGGGCAGGTGCAGAGGCTGTGG + Intergenic
1069896492 10:71683437-71683459 CCGGGCGTGGGCAGTGGCAGAGG - Intronic
1073442496 10:103560649-103560671 CTGGGCATGCACAGGGGCTGTGG + Intronic
1076116878 10:127907168-127907190 GCGGGGACGCGCAGAGGCCGTGG - Exonic
1076279333 10:129232521-129232543 CCGGGCAGGGGCAGGGGCAGGGG - Intergenic
1076430428 10:130398245-130398267 ATGGGCAGGTGCAGAGGCCGTGG + Intergenic
1077051715 11:569534-569556 CCAGGCCTGCGCGGATGCCGAGG - Intergenic
1077254646 11:1574714-1574736 CCGGGGAGGCGCCAAGGCCGCGG + Intergenic
1077887978 11:6400288-6400310 CCCGGCACTCTCAGAGGCCGAGG + Intronic
1081669664 11:44935961-44935983 CCGGACATGGGCAGGGGCCAGGG - Intronic
1082243240 11:49892228-49892250 GCGGCCCTGCCCAGAGGCCGCGG - Intergenic
1082986034 11:59172164-59172186 CCCGGCGTCTGCAGAGGCCGAGG + Intronic
1083407940 11:62471741-62471763 CCGGACATGCCCTGAGGCCTGGG + Intronic
1083571990 11:63765903-63765925 GGGGGCCTGCGGAGAGGCCGAGG - Exonic
1084670535 11:70604127-70604149 CTGGGCCTGCGCAGAGACAGAGG - Intronic
1085710273 11:78823249-78823271 CTGGGCAGGCGCTGAGGCCGGGG - Intronic
1085746014 11:79114895-79114917 CTGGGGATGCGAAGAGGCAGGGG + Intronic
1086380141 11:86244508-86244530 CAGGGGATGCGCAGGCGCCGTGG - Intergenic
1087188866 11:95231343-95231365 CCGGCCAATCGCAGGGGCCGAGG + Intronic
1094199139 12:27779837-27779859 CCGGGCGGGCGGAGAGGCTGCGG + Intergenic
1094839483 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG + Intergenic
1094841200 12:34343342-34343364 CCGCGCATGCGCAGGGTCCCAGG + Intergenic
1094846429 12:34363416-34363438 CCGTGCATGCGCAGGGCCCAGGG - Intergenic
1094849556 12:34376296-34376318 CTGGGCATGCGCAGGGCCCAGGG - Intergenic
1094851638 12:34384889-34384911 CCGCGCATGTGCAGAGCCCACGG - Intergenic
1096898183 12:54846312-54846334 ACGGGCAGGTGCAGAGGCCATGG - Intronic
1097192530 12:57226308-57226330 GCGGGCAGGGGCAGGGGCCGGGG - Exonic
1098477351 12:70920722-70920744 CTGGGCATGCTCAGTAGCCGCGG - Exonic
1098585245 12:72146621-72146643 ACGGGCAGGTGCAGAGGCCTCGG + Intronic
1102289258 12:111685681-111685703 CAGGGAATGCGGCGAGGCCGCGG + Intronic
1104692809 12:130839254-130839276 CCGGGCATGCGCAGAGCGCGCGG - Intronic
1104949711 12:132433889-132433911 CCTGGCCTGGGCAGAGGCAGTGG + Intergenic
1105882881 13:24618885-24618907 CCAGGCGTGCGCAGAGGCCTGGG + Intergenic
1107125302 13:36839842-36839864 ACGGGCAGGTGCAGAGGCCGTGG + Intergenic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1107435854 13:40380227-40380249 CCAGGCATGCCAAGAGGCAGTGG + Intergenic
1109284889 13:60397660-60397682 GCGGGCCTGGGGAGAGGCCGGGG + Intronic
1112058757 13:95716313-95716335 ATGGGCAGGTGCAGAGGCCGTGG + Intronic
1113931293 13:113970356-113970378 CCGGGCATGGGCACAGGTCGGGG - Intergenic
1116861815 14:50001441-50001463 CGGGGCATGGGCAGGGGCCAGGG - Intronic
1122399548 14:101458716-101458738 CCGGGCTGTCGCCGAGGCCGCGG - Intergenic
1122503871 14:102219410-102219432 CCAGGCATGCCCAGAAGCAGGGG - Intronic
1123735088 15:23176874-23176896 CCCAGCATCCCCAGAGGCCGAGG + Intergenic
1124285595 15:28398180-28398202 CCCAGCATCCCCAGAGGCCGAGG + Intergenic
1124297100 15:28513474-28513496 CCCAGCATCCCCAGAGGCCGAGG - Intergenic
1124453835 15:29822482-29822504 CCGGGCATGCTCAGTGGGCCGGG - Exonic
1126109347 15:45166737-45166759 CCGGGCCCGCCCAGAGGCCTGGG + Intergenic
1128987393 15:72231252-72231274 CCGGGATTGGGCAGAGGGCGGGG - Exonic
1130530970 15:84748117-84748139 CGGGGCAGGGGCAGGGGCCGAGG - Intergenic
1131536601 15:93242337-93242359 CCGGGCAGGAGCAGATGCCAGGG + Intergenic
1132544563 16:527409-527431 CCGCTGATGCGCAGACGCCGCGG + Intergenic
1132566992 16:628109-628131 GCGGGGCTGCCCAGAGGCCGGGG + Exonic
1133294543 16:4744936-4744958 CCGGGCACAAGCAGAGGCCTTGG - Exonic
1136141645 16:28292546-28292568 CCGGGCGGGCGCCGGGGCCGGGG + Exonic
1136556529 16:31010560-31010582 CCGGGCAGGGGCAGGGGCCTGGG + Exonic
1137964201 16:52914631-52914653 ATGGGCAAGTGCAGAGGCCGAGG - Intergenic
1139750407 16:69106357-69106379 GCGGGGCTGCGCCGAGGCCGGGG + Intronic
1141092726 16:81141296-81141318 CCTGGCATGTGCAGGGGCCCAGG + Intergenic
1142637745 17:1268450-1268472 CCGGGCACGGGCAGGTGCCGCGG + Intergenic
1144450013 17:15369120-15369142 CCAGGCACGGTCAGAGGCCGAGG + Intergenic
1144756330 17:17682356-17682378 CGGGGCCTGCGCACAGGCCCCGG - Intronic
1146646866 17:34581733-34581755 CTGGGCACCCGCACAGGCCGGGG + Intronic
1149289241 17:55199916-55199938 CAGGGCATGCGCCAAGGCCCTGG - Intergenic
1149461493 17:56833541-56833563 GCGGGCGGGCGCGGAGGCCGAGG - Intronic
1150658473 17:67056010-67056032 CCAGGCATGCTCAGGGACCGAGG - Intronic
1152250227 17:79208639-79208661 CCGGGCAGAGGCAGAGGCAGAGG + Intronic
1153805265 18:8705179-8705201 CGGGGCATGCGCACGGGCCTGGG + Intergenic
1153855196 18:9137531-9137553 CCGAGCGTGCGCCGACGCCGGGG + Intronic
1154354849 18:13616855-13616877 ATGGGCATGCTCAGAGGCTGTGG - Intronic
1156268134 18:35506867-35506889 CCGAGCAAGCGGAGAGGCAGTGG + Intergenic
1160295480 18:77633243-77633265 CTGGGCCTGGGCAGAGGCAGGGG - Intergenic
1160362465 18:78295469-78295491 CCCGGCAGGCGCAGACACCGGGG + Intergenic
1160896938 19:1407546-1407568 CCGGGCGTGCGCAGGGGCGGCGG + Intergenic
1160974998 19:1788845-1788867 CAGGGCATCCCCAGAGGCCCTGG + Intronic
1161153551 19:2721328-2721350 GCGGGCAGGAGCAGCGGCCGCGG - Exonic
1161170154 19:2808457-2808479 CCGGGCAGGGGCAGGGGCAGGGG + Intronic
1161203620 19:3029131-3029153 GCGGGCAGGGGCAGCGGCCGGGG + Exonic
1161348246 19:3778455-3778477 CCGGGCAGGTCCAGAGGCTGTGG - Intronic
1161401351 19:4067266-4067288 CCGCCCCTGCGCAGAGGCTGGGG - Intergenic
1161776147 19:6263304-6263326 ACGGGCATGGGCAGTGGCCTGGG + Intronic
1162033082 19:7925701-7925723 CCGGGCATGGGCGTAGCCCGGGG - Intronic
1162525222 19:11202823-11202845 CAGGGCATGGGCACAGGCAGGGG + Intronic
1162726076 19:12690294-12690316 ACGGGGATGGGCAGAGGCCTGGG - Intronic
1163021490 19:14483029-14483051 CAGGGCCTGGGCAGAGGCCTTGG + Intronic
1163664177 19:18595284-18595306 CCGGGCACGAGCAGGGGCCAAGG + Intronic
1166390459 19:42406419-42406441 CCTGGCAGGGGCAGAGGCCTGGG + Intronic
1167117830 19:47498317-47498339 CCGGCCAAGGGCAGAGGCTGTGG + Intronic
926305812 2:11636784-11636806 ACGGGCATGGGCAGGGGCAGAGG + Intronic
927514033 2:23661545-23661567 CCTGGCATGGGCAGTGGCAGAGG + Intronic
929280510 2:40072786-40072808 TCGGGCATGTGCAGAGACCCAGG - Intergenic
930641695 2:53859931-53859953 CCCGGGATGCGCGGAGGCGGTGG - Exonic
932191038 2:69741871-69741893 CCGGGCAGGGGGCGAGGCCGGGG + Intronic
932606537 2:73169446-73169468 CCCAGCATGAGCAGAGGCAGCGG + Intergenic
933714556 2:85350548-85350570 CAGGGCATCCCCAGAGGCCAGGG + Intronic
933925889 2:87090989-87091011 CCCAGCATGAGCAGAGGCAGCGG - Intergenic
934636292 2:95992379-95992401 CCGGGCATGGGCTTCGGCCGGGG - Intergenic
934836054 2:97590392-97590414 CCGGGCATGGGCTTCGGCCGGGG - Intergenic
936493526 2:112996728-112996750 TCAGGCATGCACAGAGGCCCAGG - Intergenic
937451069 2:122002535-122002557 CCGGCCCTGTGCAGAGGCCTGGG - Intergenic
938135147 2:128750657-128750679 CCAGGCATGTGCACAGGCAGAGG - Intergenic
938301129 2:130213714-130213736 GCGGGCAGGCGCAGCGACCGGGG - Intergenic
938583883 2:132670558-132670580 CCTGGAAGGCGCAGAGGACGTGG - Intronic
938817445 2:134918703-134918725 CCGCGCATGCGCAAGGGCGGAGG + Intronic
942455646 2:176136675-176136697 CCGGGCGGGAGCCGAGGCCGCGG - Intergenic
945150775 2:206788481-206788503 CCTAGCATGTGGAGAGGCCGAGG + Intronic
947642325 2:231714015-231714037 CCCGGCATTCTAAGAGGCCGGGG - Intergenic
947750417 2:232529220-232529242 CCGGGCCTGGGCAGAGGCATGGG - Intronic
1173488490 20:43458585-43458607 CCGGGCAGGCGCGAGGGCCGGGG + Intronic
1173640908 20:44601259-44601281 CCTGGCAGGTGCAGAGGCCAAGG + Intronic
1175306201 20:57977275-57977297 CCGGGCCAGCTCTGAGGCCGGGG - Intergenic
1175429195 20:58890640-58890662 CGCGCCAAGCGCAGAGGCCGCGG + Intronic
1175810123 20:61853273-61853295 CCGGGCAGGCGGAGAGGCTAGGG + Intronic
1175815866 20:61882946-61882968 CAGGAGATGCGCAGAGGCTGGGG - Intronic
1178493856 21:33070969-33070991 CGGCGCAGGTGCAGAGGCCGGGG - Exonic
1179977027 21:44874019-44874041 CCGCGCAGGCGCAGGAGCCGCGG - Intergenic
1180846394 22:18984760-18984782 CCTGGGGTGCGCAGAGGCAGAGG + Intergenic
1182344172 22:29648730-29648752 CAGGGCATACGCTGAGGCTGAGG - Intronic
1184441981 22:44522722-44522744 CGGGGCATGGGCAGTGGCCTGGG - Intergenic
1184698008 22:46150513-46150535 CCGGGCATGGGCCGTGGACGCGG + Intronic
1185069150 22:48646841-48646863 CCGAGGATGCGCTGAGGCCTAGG - Intronic
1185245179 22:49769593-49769615 CCGGGCATGGGGACAGGCCGGGG + Intergenic
952943346 3:38459612-38459634 CCGGGGAGCCGCAGAGGCTGTGG + Intronic
953531193 3:43741114-43741136 CCAGTCATGCTCAGAGGCCAGGG + Intergenic
954575111 3:51671523-51671545 CAGGGCATGCCCCGGGGCCGTGG + Exonic
961661761 3:128472737-128472759 GAGGGCCTGGGCAGAGGCCGTGG + Intergenic
963827408 3:149970562-149970584 CCGGGCGGGCGGGGAGGCCGAGG - Intronic
967881401 3:194304296-194304318 GCGGGCATGCGGTGAGGCAGCGG + Intergenic
970989060 4:22191754-22191776 ACGGGCAGGTGCAGAGGCTGAGG - Intergenic
974550180 4:63362559-63362581 GCGGCCAGGTGCAGAGGCCGGGG + Intergenic
974962784 4:68724565-68724587 CCAGGCAGGTGCAGAGGCCAGGG + Intergenic
981449670 4:144881788-144881810 CCTGGTATGCGCAGAGCCCATGG - Intergenic
982474681 4:155835269-155835291 ACGGGCAGGTGCAGAGGCCAGGG - Intronic
986335688 5:6753665-6753687 CCGAGCATCCGCAGAGCCCAAGG - Intronic
986695946 5:10354137-10354159 CCGGGCAGGGGCCGGGGCCGGGG + Intronic
990359774 5:55007030-55007052 TCAGGCATGCACAGAGGCCCAGG + Intronic
991505361 5:67318736-67318758 CAGAGCAGGCGCCGAGGCCGAGG - Intergenic
992663553 5:78984739-78984761 CCGGGCATGCGCAGAGGCCGCGG + Intronic
995494425 5:112726065-112726087 ACGGGCAGGTGCAGAAGCCGGGG + Intronic
996852237 5:127966215-127966237 ATGGGCAAGTGCAGAGGCCGGGG + Intergenic
997384935 5:133465183-133465205 CATGGCATGGGCAGAGGCCAGGG - Intronic
997462135 5:134059906-134059928 CCAGGCTTGGGCAGAGGCCCAGG + Intergenic
999324934 5:150638007-150638029 CTGGGCTTGCCCAGAGGCCAGGG - Intronic
999768150 5:154755983-154756005 CCGGGCAGCTGCAGCGGCCGCGG - Intronic
1001395998 5:171419956-171419978 CCGGGCTGGCGCAGGGGCTGCGG - Exonic
1002177470 5:177409383-177409405 CAGGTCATGAGCAGAGGCCATGG + Intronic
1002435844 5:179230242-179230264 GAGGGGATGCGCAGAGGCAGAGG + Intronic
1003290715 6:4776371-4776393 CTGGGCATGCTCAGTAGCCGGGG + Intronic
1004174580 6:13328574-13328596 GGGCGCATGCGCAGAGGGCGCGG + Intronic
1007547458 6:42705080-42705102 CAGGGCCTGTGCAGAGGCAGGGG + Intronic
1007669466 6:43539558-43539580 CCGGGCCGGGGCTGAGGCCGCGG - Intronic
1014137666 6:117907637-117907659 CCGGGAACGCGCAGAGGACCCGG - Exonic
1018828782 6:167425961-167425983 CCGGGCCAGTGCAGAGGCCCTGG - Intergenic
1019466667 7:1193466-1193488 CAGGGCCTGCGTTGAGGCCGTGG + Intergenic
1023609123 7:41956505-41956527 CAGGGCATGAGCAGAGCCCCAGG + Intergenic
1023989066 7:45117399-45117421 CCGGGCAGGCACAGAAGCAGGGG - Intergenic
1026745098 7:73005537-73005559 CCGCGCGTGCGCAGTGGGCGGGG + Intergenic
1026807091 7:73435453-73435475 GCAGCCATGCGCAGCGGCCGCGG + Exonic
1027031210 7:74890232-74890254 CCGCGCGTGCGCAGTGGGCGGGG + Intergenic
1027098642 7:75359543-75359565 CCGCGCGTGCGCAGTGGGCGGGG - Intergenic
1029372590 7:100158751-100158773 CCGGGCACCCGCAGATTCCGGGG - Intergenic
1029399741 7:100336355-100336377 CCGCGCGTGCGCAGTGGGCGGGG - Intronic
1031162444 7:118184286-118184308 CCGGGGTCGCGGAGAGGCCGCGG + Intronic
1033253222 7:139777879-139777901 CCGGGCGGGCGGAGCGGCCGAGG + Intronic
1033564794 7:142567867-142567889 ACGGGCAGGTGCAGAGGCCATGG - Intergenic
1033654153 7:143362149-143362171 CGGGGCTGGCGCGGAGGCCGAGG + Intronic
1034977609 7:155457603-155457625 CCGAGCCCGCGCGGAGGCCGAGG + Intergenic
1034991588 7:155551007-155551029 CTGCGCCTGTGCAGAGGCCGGGG + Intergenic
1035233403 7:157480643-157480665 CCGGGGATGCGCAGGGGGCTTGG - Intergenic
1035376723 7:158411433-158411455 CCGGGCATGTGCAAGGGCCCAGG - Intronic
1035666586 8:1384707-1384729 CAGGGGATGGGCATAGGCCGGGG - Intergenic
1035666823 8:1385620-1385642 CAGGGGATGGGCATAGGCCGGGG - Intergenic
1035666855 8:1385745-1385767 CAGGGGATGGGCATAGGCCGGGG - Intergenic
1035774419 8:2176919-2176941 CTGGGCATGCCCAGGGGCAGGGG + Intergenic
1035811781 8:2497716-2497738 CCCAGGATGCGCAGAGGCTGTGG - Intergenic
1036658377 8:10692047-10692069 CGGGGCATGTGCAGACGCCCTGG + Intronic
1037529097 8:19756974-19756996 CAGGGCACGGGCAGGGGCCGGGG - Intronic
1037727302 8:21493543-21493565 CAGGGCATGAGCAGAGGCTGAGG - Intergenic
1037911345 8:22745390-22745412 CAGGGCAGGGGCAGAGGCTGGGG + Intronic
1039564712 8:38542692-38542714 CCCGGCATGTTAAGAGGCCGAGG - Intergenic
1042167542 8:65960180-65960202 CCGGCCATGCAGAGAGGCCCTGG + Intergenic
1045327326 8:101126782-101126804 GCGGGGATCCCCAGAGGCCGCGG + Intergenic
1049145765 8:141000635-141000657 CCGGGCGCGCGGAGAGGCCGAGG - Intronic
1049172705 8:141171801-141171823 CTGGGCGTGCACAGTGGCCGTGG + Intronic
1049220113 8:141425205-141425227 CCGGGCCTGCGCAGAGGGTTTGG + Intronic
1049782995 8:144437306-144437328 CCGGGCAGGCACAGAGGCGGAGG - Intronic
1049936400 9:504869-504891 CCGGGGTTGCGCGGCGGCCGTGG + Intronic
1053443260 9:38132733-38132755 CAGGGCATGGGCAGGGGCCCTGG + Intergenic
1059119721 9:111631280-111631302 CCGCGCAGGCGCACAGGGCGCGG - Intergenic
1062409711 9:136417148-136417170 CTGGGGGAGCGCAGAGGCCGTGG + Exonic
1185893245 X:3838170-3838192 CCAGGCATGCGCTGGGGCGGTGG - Intronic
1185898357 X:3876592-3876614 CCAGGCATGCGCTGGGGCGGTGG - Intergenic
1185903472 X:3915021-3915043 CCAGGCATGCGCTGGGGCGGTGG - Intergenic
1187419613 X:19122715-19122737 CGGGGCAGGGGCAGGGGCCGGGG + Intergenic
1194119510 X:89943270-89943292 TCGGGCAGGTGCAGAGGCTGGGG - Intergenic
1194666721 X:96684636-96684658 CCGGGCATGCTCAGTAGCTGGGG + Intergenic
1200149869 X:153946112-153946134 CTGAGCATGAGCCGAGGCCGAGG - Intergenic