ID: 992663679

View in Genome Browser
Species Human (GRCh38)
Location 5:78985208-78985230
Sequence GCGAGCTTGCCCCGAGGCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992663679_992663684 11 Left 992663679 5:78985208-78985230 CCGGGGCCTCGGGGCAAGCTCGC 0: 1
1: 0
2: 1
3: 6
4: 94
Right 992663684 5:78985242-78985264 GACCCATCCTTGTCCGCCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 39
992663679_992663689 26 Left 992663679 5:78985208-78985230 CCGGGGCCTCGGGGCAAGCTCGC 0: 1
1: 0
2: 1
3: 6
4: 94
Right 992663689 5:78985257-78985279 GCCCGCGGTCCCAGCGCCTGTGG 0: 1
1: 0
2: 1
3: 43
4: 1282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992663679 Original CRISPR GCGAGCTTGCCCCGAGGCCC CGG (reversed) Exonic