ID: 992665708

View in Genome Browser
Species Human (GRCh38)
Location 5:79006922-79006944
Sequence GTAGGTCAGCAATTTAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992665708_992665711 11 Left 992665708 5:79006922-79006944 CCAACTTTAAATTGCTGACCTAC 0: 1
1: 0
2: 2
3: 17
4: 162
Right 992665711 5:79006956-79006978 GAGAAAGTTTCCATTAGCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992665708 Original CRISPR GTAGGTCAGCAATTTAAAGT TGG (reversed) Intronic
900812609 1:4818773-4818795 ATAGGTCAGCATTCCAAAGTGGG + Intergenic
901260939 1:7870199-7870221 GTAGGCAAGTAAATTAAAGTAGG + Intergenic
903046947 1:20571653-20571675 GTAGGCCAGCAATTTGGATTGGG - Intergenic
903529611 1:24020237-24020259 GTGGGTCAGCTATTTGAGGTGGG + Intergenic
907082998 1:51642104-51642126 GTTGGTCAGAAAATTAAAATCGG - Intronic
908618933 1:65953607-65953629 GAAGGTCAGCAGTCTAAAATGGG - Intronic
910115335 1:83725465-83725487 GTAGGTTAGTAATTAATAGTAGG + Intergenic
910194662 1:84628087-84628109 GTTGGTTTGCAATTTGAAGTAGG + Intergenic
910766802 1:90790222-90790244 GGAGGTCAGAAGTCTAAAGTGGG - Intergenic
914339866 1:146750913-146750935 GTGGGTCAGAAATTTGAAGGTGG + Intergenic
914931075 1:151934076-151934098 GGAGGTCAGAAATTTGAAGTGGG + Intergenic
915630433 1:157150032-157150054 GTAGGTCAGGAATTTGAACAAGG - Intergenic
917195625 1:172462246-172462268 GTAAGTCAACAATTTAAATCAGG + Intronic
921714189 1:218401550-218401572 GTAGGTCAGAAATTGAGAGAAGG + Intronic
921968796 1:221122035-221122057 GTGGGTCAGCAATTTAGGCTGGG + Intergenic
923858228 1:237867453-237867475 GTTGGCCAGCAGTTTAAAATAGG + Intergenic
924304025 1:242668441-242668463 GTAGGTCAGCAAGTTGAGCTGGG - Intergenic
924823482 1:247516819-247516841 GTATGTCAACAATTAAATGTTGG - Intronic
1063961498 10:11309784-11309806 GTTGGTGAGCAATTAAGAGTAGG - Intronic
1068226034 10:54108062-54108084 GTAGGACAGCAGTCTACAGTGGG + Intronic
1071381218 10:85062161-85062183 GTAGGTGAGTTATTTAAAGCTGG - Intergenic
1073379893 10:103070116-103070138 GTTGGTCAGCAGTTGACAGTGGG - Intronic
1074012372 10:109495567-109495589 GTAGGTTAGAAATTTGAATTAGG + Intergenic
1074462785 10:113653701-113653723 GGAGGTCAGTACTTTAAAATGGG + Intronic
1075471907 10:122697386-122697408 GTGGGTTAGCAATTTAAGCTGGG - Intergenic
1076545579 10:131243806-131243828 GTGGGTCAGCAATTTGAGCTGGG + Intronic
1076591111 10:131584031-131584053 GCATGTCAGCCTTTTAAAGTAGG + Intergenic
1078203898 11:9211050-9211072 GAAGGTCAGCACTTCAAAGAAGG + Intronic
1079796379 11:24808146-24808168 GTAACTCCGCAATTTAAAATTGG - Intronic
1083092009 11:60209476-60209498 GGAGGTCAGAAGTTCAAAGTGGG - Intronic
1086054628 11:82631960-82631982 GTAGGTCAGCAATTTGGTCTAGG - Intergenic
1086822878 11:91456918-91456940 GTAGCTCAGAATTCTAAAGTCGG - Intergenic
1094325096 12:29229347-29229369 GTAGGTCATGAATTTAAAGCAGG - Intronic
1095114728 12:38339626-38339648 GTTGGTCAGCAATTTGGACTGGG + Intergenic
1097055721 12:56247993-56248015 GTAGGGCAGCAGCCTAAAGTGGG + Intronic
1098814569 12:75142200-75142222 TTAGGTTAGCCATTTAAAGTAGG - Intronic
1099885746 12:88528052-88528074 GGAGGTCAGAAGTTTAAAATAGG + Intronic
1100593830 12:96054704-96054726 GTAGGCCATTATTTTAAAGTAGG + Intergenic
1101825929 12:108219870-108219892 GCAGGTTAACAATTTGAAGTTGG + Intronic
1102154582 12:110714518-110714540 GTAGGTCAGTAATCAAAACTTGG + Intergenic
1102632464 12:114293273-114293295 GCAGGTCAGCAATTTGTACTGGG - Intergenic
1107119908 13:36785122-36785144 GTAGGTCAGCAATTTGACAGTGG + Intergenic
1107742789 13:43470998-43471020 GTAGGTCAACATCTAAAAGTAGG - Intronic
1108404570 13:50087127-50087149 GGAGGTCAGAAATTCAAAATGGG - Intronic
1109306997 13:60651897-60651919 TCAGGTCAGAAATTTATAGTTGG + Intergenic
1109406320 13:61904649-61904671 ATAGGTAAGCAATTTTAATTAGG + Intergenic
1110603779 13:77407665-77407687 GTAGGTCGGCAGTATAAAGAAGG + Intergenic
1115905809 14:38201817-38201839 GTAGGTAAGTAAGTTAAAATTGG + Intergenic
1116539540 14:46082344-46082366 GGAGTTCAGAAATTCAAAGTGGG - Intergenic
1128269393 15:66294603-66294625 GATGCCCAGCAATTTAAAGTTGG - Intronic
1130213769 15:81949725-81949747 GTAGGTCAGAAATCTGAAATGGG + Intergenic
1130992199 15:88882234-88882256 GTGGGTCAGCATTTTGGAGTGGG - Intronic
1132164635 15:99573803-99573825 GTAAGTCAGCTATTTAGAATGGG - Intronic
1137930889 16:52586357-52586379 GCAAGTCAGCAATTTAAGCTGGG - Intergenic
1138755460 16:59478936-59478958 GTTGGTCAGCAAAATAATGTGGG + Intergenic
1139229616 16:65271133-65271155 GTAGGTGAGCTCTTTAAAGTTGG - Intergenic
1139994425 16:70966497-70966519 GTGGGTCAGAAATTTGAAGGTGG - Intronic
1140828836 16:78732501-78732523 GTGGGTCAGCAATTTGAATATGG - Intronic
1146447051 17:32940641-32940663 GTAGGTATGCAATTTAAAGTTGG - Intronic
1148911778 17:50946860-50946882 GTAGGTCAGGTATGTATAGTTGG + Intergenic
1150038780 17:61834903-61834925 GGGGGTCAGCAATTTAGGGTGGG - Intronic
1150968897 17:70004220-70004242 GTAGGTCAGAAGTCTGAAGTGGG + Intergenic
1151389858 17:73779016-73779038 GGAGGTCAGAAGTCTAAAGTGGG + Intergenic
1151586784 17:75013631-75013653 GTAGGGTTGCAATTTTAAGTAGG + Intronic
1152884364 17:82840703-82840725 GTGCCTCTGCAATTTAAAGTGGG - Intronic
1153156560 18:2156411-2156433 GGAGGCCAGCCAATTAAAGTTGG + Intergenic
1155865341 18:30957803-30957825 GCAGGTCAGAAATCTAAAATAGG - Intergenic
1157056980 18:44241409-44241431 GTAGGTCAGCAATTTGGATTGGG - Intergenic
1162740900 19:12773026-12773048 CTAGGTCAGCAATCTGAAGATGG - Exonic
1163153784 19:15429362-15429384 GAAGATCAGCAAAGTAAAGTGGG + Intronic
927727790 2:25440882-25440904 GTTGGTCAGCAATCAAAAGCTGG - Intronic
927829537 2:26337491-26337513 GTGGGTCAGCAATTTGGAATGGG - Intronic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
930611337 2:53547391-53547413 GGAGGTTAGCAATTTTAAGTGGG - Intronic
931954868 2:67411665-67411687 GTAAGTCAACCATTTTAAGTTGG + Intergenic
932869199 2:75380103-75380125 GTAGGTCAGCAGTTTAGGCTAGG - Intergenic
935303692 2:101716675-101716697 GTAGGTCAGTAATTTGGACTGGG + Intronic
935540075 2:104338346-104338368 GTAGGTCAGGAATTCAGATTTGG - Intergenic
937162434 2:119777336-119777358 GTAGGAAAGCAATTTTAAATAGG - Intronic
937173323 2:119900092-119900114 GTAGGTTAGCTATTCAAATTGGG + Intronic
937564582 2:123268670-123268692 GTATGTCAATATTTTAAAGTTGG + Intergenic
938040183 2:128069330-128069352 GGAGGTCAGGAGTTTAAAATGGG - Intergenic
938398992 2:130973123-130973145 GTAGGCCAGCAGTTTTAATTGGG - Intronic
939096581 2:137839601-137839623 GGAGGTCAGAAATTTAAAATAGG + Intergenic
940138433 2:150465366-150465388 TGAGGTCAGAAATCTAAAGTAGG + Intergenic
940506996 2:154568488-154568510 GTGGGTAGGCAATTTAAACTGGG + Intergenic
940752121 2:157637935-157637957 GTAGTTCATCATTTTAATGTAGG - Intergenic
942215314 2:173713556-173713578 ATAGGTCAGAAATTTAAGGTTGG - Intergenic
943521292 2:188952860-188952882 ATATGTCAGCAACTTAAAGTTGG - Intergenic
943861680 2:192872993-192873015 GTAGTTATGCAATTTACAGTTGG - Intergenic
946687661 2:222287441-222287463 TTGGGTCAGCAATTTTGAGTTGG + Intronic
946850906 2:223906413-223906435 GTAGCTCAGCAATTTAGTGGGGG + Intronic
1173571747 20:44081614-44081636 GTAGGCCAGCAATGGCAAGTGGG - Intergenic
1174668108 20:52279520-52279542 TTAGCTCAGCAATCTATAGTTGG - Intergenic
1177140196 21:17350315-17350337 GGAGGTCAGAAATTTAACATGGG + Intergenic
1177531544 21:22364345-22364367 GTATGTCAGCAATTTTGAATGGG - Intergenic
1177710041 21:24762391-24762413 GGAGGTCAGAAATTCAAAGCAGG + Intergenic
1178049766 21:28734901-28734923 GGAGGTCAGCAAGTCAGAGTAGG + Intergenic
1179916734 21:44482519-44482541 GTAGGTTAGCAATGTGAACTTGG - Intergenic
1184249436 22:43251734-43251756 GTAGGTCAGAAATTTGACCTGGG - Intronic
1184379685 22:44137567-44137589 GTGGGTCAGCAATTTAGGCTGGG + Intronic
951394012 3:22142395-22142417 ATACGTCACCAATTTAAATTTGG - Intronic
951915107 3:27792321-27792343 ATTGGTCAGCAATTTGAACTGGG - Intergenic
952904952 3:38133770-38133792 GTGGCTCAGCACTTCAAAGTAGG + Intronic
953023289 3:39129683-39129705 GCATCTAAGCAATTTAAAGTGGG + Intronic
956285420 3:67604363-67604385 GTGGGTCAGCATTTTAAACATGG - Intronic
957728632 3:84102694-84102716 CTAGGCCAGCAATTTACAATTGG - Intergenic
960286321 3:115833227-115833249 GTATGTCAGGAATTCAAAATGGG + Intronic
960818211 3:121696355-121696377 CTAGGCCAGCAATTTGTAGTTGG + Exonic
962006657 3:131356513-131356535 GTAGGTCAGGAATTAAAAGGGGG - Intergenic
964169533 3:153753333-153753355 GTAGTTCATTAATTTAAAATAGG + Intergenic
965043831 3:163549403-163549425 GTGGAGCAACAATTTAAAGTGGG + Intergenic
970656787 4:18240086-18240108 GGAGGTCAGAAATCTAAAATAGG + Intergenic
971355719 4:25893674-25893696 GAGGGTCAGCAATTTATATTGGG - Intronic
971707288 4:30062239-30062261 ATAAGGCAGCATTTTAAAGTAGG + Intergenic
972967086 4:44523926-44523948 GGAGGTCAGAAATCTAAAATGGG - Intergenic
975340515 4:73234735-73234757 GTAGGTCAGCAGTTTAGTATGGG - Intronic
975491445 4:74993449-74993471 GTGGGTCAGGAATTTGAACTGGG - Intronic
975805955 4:78112762-78112784 CTATGTCAGCAAGTTAAGGTCGG + Intronic
977245668 4:94628279-94628301 GTAGGTCAGCTATTTTATGGTGG - Intronic
978159684 4:105530679-105530701 TAAGGTCATGAATTTAAAGTGGG + Intergenic
979493434 4:121357133-121357155 GGAGGTCAGAAATTTGAAATGGG + Intronic
979494257 4:121366675-121366697 ACAGGTCAGCAATTTCAGGTTGG - Intronic
980728796 4:136800848-136800870 ATAGGTCATGAATTTAAAATAGG - Intergenic
981137254 4:141224720-141224742 GTAGTTCAACAATTTGAACTTGG + Intronic
981514046 4:145587871-145587893 GCAGGTCAGCAATTGGAGGTTGG - Intergenic
982873319 4:160612312-160612334 GGAGATCAGGAATTTAAAATGGG + Intergenic
986878589 5:12141564-12141586 TTAGGTCAGCGTTTGAAAGTGGG + Intergenic
988052682 5:26051206-26051228 GAAGATCAGAAATTTAAAATTGG - Intergenic
988865398 5:35329084-35329106 GTAGCTCTGTAATATAAAGTCGG - Intergenic
989552421 5:42751337-42751359 TAAGGTCAGCAGTTTAAACTGGG - Intergenic
990717849 5:58658635-58658657 GTGGGTCAGCAATTTGGACTGGG + Intronic
992665708 5:79006922-79006944 GTAGGTCAGCAATTTAAAGTTGG - Intronic
995045301 5:107640017-107640039 GTAGGTCAGTATTTGAAAATAGG + Intronic
995495119 5:112733649-112733671 GTAGGTCAGAAGTCTAAAATGGG - Intronic
997927935 5:138047884-138047906 GTAGGTCAGCAGTCTGACGTGGG - Intronic
999458732 5:151739709-151739731 GTAGGTCAACAAGGCAAAGTTGG + Intergenic
1000240406 5:159403470-159403492 CTAGGAAAGCAATTTAAAGAGGG - Intergenic
1000299112 5:159939362-159939384 GCAGGTCAGCAATTTACCTTGGG - Intronic
1001380191 5:171301020-171301042 GTAGGTCAGGAATTTGCAGCTGG + Intergenic
1004418963 6:15450648-15450670 CTAGGTGAACAGTTTAAAGTAGG + Intronic
1005023171 6:21436916-21436938 GTGGATCAGCAATTTTAACTTGG - Intergenic
1005527647 6:26666839-26666861 GTAGATCAGAAGTTTAAACTGGG + Intergenic
1008437142 6:51489469-51489491 GGAGGTCAGAAATCTAAAATGGG - Intergenic
1008913167 6:56758511-56758533 GTAGGTCAGAAATTCAAACCAGG + Intronic
1010329736 6:74609211-74609233 TTAGGTTAGCAATTTAGATTGGG + Intergenic
1012708531 6:102566526-102566548 GTAGGTCAGAATTTTAACATGGG - Intergenic
1013577494 6:111499082-111499104 GTAAGCTAGTAATTTAAAGTAGG + Intergenic
1016585875 6:145684748-145684770 GGAGATGAGCAATTTGAAGTAGG - Intronic
1020850446 7:13346558-13346580 GTATGTCAACAATTTTATGTTGG + Intergenic
1022152655 7:27624550-27624572 GTAGGTAAGCACTTTAGATTGGG + Intronic
1024179075 7:46870745-46870767 GTAGGTTAGCAATCTAACATGGG + Intergenic
1026189424 7:68111384-68111406 GTAGGTCAGAAAATTGAAATTGG + Intergenic
1030716167 7:112809950-112809972 GTAGGTCAGAAGTCCAAAGTGGG - Intergenic
1031089288 7:117334475-117334497 GTGGGTCAGAAATTTAAACTGGG + Intergenic
1035876949 8:3200952-3200974 GTAGGTCATCAATTAAAAGTGGG + Intronic
1037342862 8:17865431-17865453 ATAGGCTAGCAATTTAAAGAAGG - Intronic
1039634509 8:39148435-39148457 GTAAGAGACCAATTTAAAGTAGG - Intronic
1042237827 8:66631923-66631945 TTAGGTCATCAACTTAAATTTGG + Exonic
1042517411 8:69674103-69674125 GTAAGTCAGGAATTTAAAGGGGG - Intronic
1042858164 8:73287987-73288009 GGAGGTCAGAAATCTAAAATAGG - Intergenic
1044338935 8:91024623-91024645 GTAGTGCAGAAATTTAAAATAGG - Intronic
1044425555 8:92045968-92045990 GGAGGTCAGAAAATTTAAGTGGG + Intronic
1046680100 8:117159150-117159172 GGAGGTCAGAAATCTAAAGTGGG - Intronic
1046727443 8:117690796-117690818 GTTGGTAAGCAATGTAGAGTTGG - Intergenic
1051564879 9:18486186-18486208 GTAGGTCAAAAATTTTAACTGGG - Intronic
1052505547 9:29349464-29349486 GTAGGTCAGAAGTTTGAAATGGG - Intergenic
1052603262 9:30666466-30666488 GCAGGTAAGGAATTTAAAATAGG + Intergenic
1056618216 9:88187042-88187064 GTGGGTCAGCAATTTAGGATAGG - Intergenic
1057022665 9:91712321-91712343 GCAGGAAAGCAGTTTAAAGTGGG - Intronic
1058095607 9:100856924-100856946 GGAGGTCAGAAGTTTAAAGTGGG + Intergenic
1059549215 9:115211663-115211685 GTGGGTCAGCAACTTAAAGCAGG - Intronic
1059752685 9:117263022-117263044 GTAGTTTAGAAATTTAAAATGGG - Intronic
1059956770 9:119524078-119524100 GCAGGTTAGCAACTTAAACTAGG - Exonic
1185924016 X:4126543-4126565 GAAGATAAGCAATTTTAAGTGGG - Intergenic
1186076970 X:5891193-5891215 CTAGGTCACCAATTTAAAATGGG + Exonic
1192873706 X:75208025-75208047 CTTGGTCAGCAAGTTGAAGTTGG + Intergenic
1193214090 X:78841721-78841743 GTAGGCCTGTAATATAAAGTAGG - Intergenic
1194806755 X:98338581-98338603 GTAGGTCAGACATTTGAAATGGG + Intergenic
1196392411 X:115222067-115222089 GTAGGTCAGGAATGCAAAGTGGG + Intronic
1197885975 X:131218984-131219006 GTGGGTCAGGAACTTAAAGCCGG + Intergenic
1198807252 X:140504515-140504537 GTCGGTCAGCAGTTTCCAGTCGG + Exonic