ID: 992666552

View in Genome Browser
Species Human (GRCh38)
Location 5:79015164-79015186
Sequence GATTAACTAGGAAACACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992666552_992666561 30 Left 992666552 5:79015164-79015186 CCACCTGTGTTTCCTAGTTAATC 0: 1
1: 0
2: 1
3: 11
4: 148
Right 992666561 5:79015217-79015239 TTCACATGCAGTCCCTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992666552 Original CRISPR GATTAACTAGGAAACACAGG TGG (reversed) Intronic
902431823 1:16369164-16369186 GATTAACCAGGACAAAGAGGAGG - Intronic
907317027 1:53578978-53579000 GATTTTCTAGGAGACACAGCAGG + Intronic
909949890 1:81706384-81706406 GAAAAAATAGGAAACATAGGAGG + Intronic
913191036 1:116413265-116413287 GATTAACAAGGAAATGGAGGAGG - Intergenic
914227534 1:145733538-145733560 AATTAACTAGGAACCATAGGAGG - Intronic
917373650 1:174324403-174324425 AATGAGATAGGAAACACAGGGGG + Intronic
918632612 1:186736115-186736137 GGTAAAGTAGGAAACACAGAAGG - Intergenic
924514666 1:244755874-244755896 GATTAACAAGCAAACAGAGCCGG - Intergenic
1063258653 10:4357858-4357880 GATAAACTAGCAAAGACAAGTGG + Intergenic
1063777733 10:9283379-9283401 GATTTACTAGGACCCACAGGTGG - Intergenic
1064957670 10:20929382-20929404 TATTGACTAGGAAAGGCAGGTGG - Intronic
1065119611 10:22515745-22515767 GATAAAATAGGAAAAACTGGAGG + Intergenic
1066555473 10:36608141-36608163 GATGAATGGGGAAACACAGGGGG - Intergenic
1067416167 10:46104993-46105015 GATTACCCAGGAAAGACTGGTGG - Intergenic
1067436310 10:46281485-46281507 GATTACCCAGGAAAGACTGGTGG - Intergenic
1068897754 10:62226271-62226293 GATTTAGTAAGAAACAAAGGAGG - Intronic
1075107547 10:119551536-119551558 GATCCACTAGGAGATACAGGAGG + Intergenic
1076215724 10:128692197-128692219 GATTAACTTGGGAACCAAGGAGG + Intergenic
1078028745 11:7726318-7726340 ACTCAAATAGGAAACACAGGAGG + Intergenic
1078827557 11:14944533-14944555 AATTCACTTGGAAAAACAGGTGG - Intronic
1083116638 11:60466246-60466268 CAGTAACTAGCAAACTCAGGTGG - Intronic
1083655520 11:64227314-64227336 GAGAAACTAGAAAACACGGGAGG + Intronic
1084297565 11:68222741-68222763 GAATAAGAAGGAAACACAGGAGG - Intergenic
1087931799 11:103986681-103986703 GTTTAACTAGGAAACAAAGACGG + Intronic
1088024201 11:105157875-105157897 GATTCATTAGGATACACAGTTGG + Intergenic
1088672102 11:112152178-112152200 AGTGAAATAGGAAACACAGGAGG - Intronic
1091422150 12:351035-351057 GATGAACTAGGAAATCAAGGAGG + Intronic
1092712305 12:11352053-11352075 AATTAGGGAGGAAACACAGGAGG - Intronic
1092716041 12:11391773-11391795 AATTAGGGAGGAAACACAGGAGG - Intronic
1093727058 12:22526117-22526139 AAATAACTAGGAAACAAAGCTGG - Intronic
1094799920 12:34021729-34021751 GATTTAGTAGGAAAAACAGAAGG + Intergenic
1095095142 12:38143300-38143322 GATTCCCTAGGAAACAAGGGAGG - Intergenic
1095112709 12:38316037-38316059 GATTTAGTAGGAAAAACAGAAGG + Intergenic
1095434632 12:42174008-42174030 GTTTAAGCAGGAAACAAAGGAGG - Intronic
1097996720 12:65895997-65896019 GTTTAACCAGGAAACTCAGCAGG + Intronic
1098389283 12:69952034-69952056 GATGAACTAGGTCACACATGGGG + Intronic
1106023581 13:25936984-25937006 GAGTAACTTGGAAACACTGAAGG - Intronic
1106367705 13:29098900-29098922 GATTAACTAGGTTAGAAAGGAGG + Intronic
1106609134 13:31261948-31261970 GGAAAGCTAGGAAACACAGGGGG - Intronic
1107995943 13:45861119-45861141 GAGAAACCAGGAGACACAGGTGG - Intergenic
1108212161 13:48150009-48150031 GATTCACTGGGAAACACAGGAGG + Intergenic
1109388273 13:61661889-61661911 CACTAATTAGCAAACACAGGTGG - Intergenic
1109566537 13:64122950-64122972 TATCAACAAGGAAACACATGAGG - Intergenic
1109963170 13:69658619-69658641 CACCAACTATGAAACACAGGTGG - Intergenic
1112071788 13:95860665-95860687 GAGTATCAAGGAAACAGAGGTGG + Intronic
1112550936 13:100419723-100419745 GATTAACTAAGAAGCAGAGAGGG + Intronic
1113135400 13:107083420-107083442 GAGTAACTTGGAAACACTTGAGG - Intergenic
1113183932 13:107664468-107664490 CATTAAATAGGAAACAATGGAGG - Intronic
1115959520 14:38819787-38819809 GTTTTGTTAGGAAACACAGGCGG + Intergenic
1120821221 14:88913484-88913506 GATTACCTAGGAAAGAAATGCGG + Intergenic
1123128627 14:105968031-105968053 GAGTGATTAGGACACACAGGAGG + Intergenic
1123409159 15:20044196-20044218 GAGTGATTAGGACACACAGGAGG + Intergenic
1123518490 15:21050904-21050926 GAGTGATTAGGACACACAGGAGG + Intergenic
1132094180 15:98969799-98969821 TATTAATTAGGAGACACTGGTGG - Intronic
1133066957 16:3214853-3214875 GAATGTCTTGGAAACACAGGCGG - Intergenic
1134837580 16:17375011-17375033 GACCAACTAGGACACACTGGTGG + Intronic
1135505760 16:23034747-23034769 GATCAAGGAGTAAACACAGGGGG - Intergenic
1136734530 16:32452754-32452776 TATTAAATAAGAAACACATGGGG - Intergenic
1137782509 16:51109534-51109556 GTTGAACTATGAAACACTGGTGG - Intergenic
1203018549 16_KI270728v1_random:376848-376870 TATTAAATAAGAAACACATGGGG + Intergenic
1203036884 16_KI270728v1_random:650006-650028 TATTAAATAAGAAACACATGGGG + Intergenic
1147134043 17:38425178-38425200 GATGAGGAAGGAAACACAGGCGG - Intergenic
1150634095 17:66900592-66900614 AATTAAATAGGAAGCACTGGAGG - Intergenic
1151937315 17:77270529-77270551 GATTAACCAGGAAAAACAGAGGG - Intergenic
1153846838 18:9057874-9057896 GATGAACCAAGAATCACAGGGGG + Intergenic
1155374776 18:25144790-25144812 GCTTAACTGGAAAACGCAGGAGG + Intronic
1159328473 18:66955263-66955285 TATCAACAAGGAAACACATGAGG + Intergenic
1160061392 18:75532065-75532087 GCTTAATTAGTAAACTCAGGCGG - Intergenic
1160996432 19:1884248-1884270 AATTAAGGAGGAAGCACAGGAGG + Intronic
1167763802 19:51466016-51466038 GAGTAACTAGGAAAAAAAGAGGG + Intergenic
929325224 2:40602104-40602126 GGGTAACTAGGAAACAAAAGAGG + Intronic
937393653 2:121515597-121515619 TATTAACTGGAAAACAAAGGGGG + Intronic
938993855 2:136657035-136657057 TAATAACTAGCAAACACAAGTGG - Intergenic
939740145 2:145896408-145896430 TATTAACTATAAAACACAGTGGG - Intergenic
940059921 2:149553669-149553691 GAGAAGCTAGGAAGCACAGGTGG - Intergenic
944427576 2:199599404-199599426 GATTAAGTTGGAAACACAGAAGG - Intergenic
947045859 2:225982503-225982525 GTTTAACTTTGAAACAAAGGTGG - Intergenic
1170084857 20:12517709-12517731 GATTGACTAGAAAAGACAGGAGG - Intergenic
1171019889 20:21575579-21575601 AATTAACTAGGCAACTTAGGAGG - Intergenic
1172728501 20:37066411-37066433 AAATAATTAGGAAAAACAGGAGG - Intronic
1173671697 20:44803626-44803648 GATTCACTCGGAAACTGAGGAGG - Intronic
1174538738 20:51273194-51273216 ACTGAGCTAGGAAACACAGGAGG + Intergenic
1178767598 21:35468977-35468999 TATTATCTAGGAAACACCAGAGG + Intronic
1180352591 22:11816803-11816825 GAGTAACTGGGAGCCACAGGAGG + Intergenic
1180352958 22:11819042-11819064 GAGTAACTGGGAGCCACAGGAGG - Intergenic
1180385283 22:12173315-12173337 GAGTAACTGGGAGCCACAGGAGG + Intergenic
1180385663 22:12175554-12175576 GAGTAACTGGGAGCCACAGGAGG - Intergenic
1183520862 22:38295374-38295396 GATGAACTAGGTAACGCAGTCGG - Intronic
955092543 3:55766956-55766978 TATGACCTGGGAAACACAGGTGG - Intronic
955426411 3:58795861-58795883 GGAAAACTAGGAAACTCAGGTGG + Intronic
955655952 3:61245121-61245143 GATAAACAAGGAAACAGAGCAGG + Intronic
955840279 3:63105466-63105488 GAGTAACTTGGATAAACAGGTGG + Intergenic
955924146 3:63989413-63989435 GATAACCTAGGAGAGACAGGAGG - Intronic
956263550 3:67372280-67372302 CATTAACTACGAAACTCAAGAGG + Intronic
957421196 3:79974027-79974049 TAATAACTAGGAATCACAGTGGG - Intergenic
958557088 3:95693184-95693206 GATTATATATGAAACACAGCTGG - Intergenic
959390313 3:105764333-105764355 GATTATCTAAGAAAAACAGCTGG + Intronic
961377678 3:126477065-126477087 GATGAACTGGGAAAAAGAGGTGG - Intergenic
965634389 3:170766747-170766769 ACTAAACTTGGAAACACAGGTGG - Intronic
967595824 3:191326038-191326060 GATGAGCTAGGAAGCACTGGGGG + Intronic
967715488 3:192757843-192757865 GATGAACTGGGAACCTCAGGTGG - Intronic
969002037 4:3990191-3990213 GCTTAAAAAAGAAACACAGGTGG - Intergenic
969811878 4:9654618-9654640 GCTTAAAAAAGAAACACAGGTGG + Intergenic
971272860 4:25167106-25167128 GAGGAACTGGGAAAAACAGGAGG - Intronic
976144712 4:82031357-82031379 CATTAACTAGGAACCCCAGAGGG + Intronic
977272117 4:94929889-94929911 TACTAATTAGGGAACACAGGAGG - Intronic
977365682 4:96065490-96065512 GATATACTGGGAAACACACGGGG + Intergenic
977549269 4:98423217-98423239 CGTTAACTAGGAATCTCAGGAGG + Intronic
978696681 4:111588606-111588628 AATTAACTTAGAAACACAAGCGG + Intergenic
981406431 4:144375083-144375105 GATTATCCAGGACACACAGGGGG - Intergenic
984943601 4:184954505-184954527 CCTTAACGAGAAAACACAGGTGG + Intergenic
985251703 4:188031101-188031123 GATTAACTAGGAAGGGCATGAGG + Intergenic
986225443 5:5807583-5807605 GATTCCCATGGAAACACAGGGGG - Intergenic
992666552 5:79015164-79015186 GATTAACTAGGAAACACAGGTGG - Intronic
994941831 5:106333708-106333730 GATTAAGTAAGAAAGAGAGGAGG + Intergenic
996131858 5:119791197-119791219 AATTAATTAGCTAACACAGGTGG - Intergenic
996468264 5:123828615-123828637 GATAAACTGGAAAACACAGGAGG + Intergenic
997604011 5:135160510-135160532 GATTATCTAGGAATGACTGGTGG - Intronic
1003974618 6:11330464-11330486 GGCTAACTAGGATACACTGGGGG + Intronic
1004823817 6:19399041-19399063 GATTAAGAAGGAAACAAAAGAGG - Intergenic
1005189046 6:23197535-23197557 AATTAGCTAAGAAACACAGCAGG - Intergenic
1008201913 6:48601202-48601224 CATTAACTAGATAACACAAGGGG - Intergenic
1008481777 6:51993542-51993564 TATTAACTAGGAAACAGCTGAGG - Intronic
1008917532 6:56805501-56805523 GCTTAACTAGGAAATACTGAAGG - Intronic
1009481443 6:64162686-64162708 GATTAACTGGGAGAAACAAGGGG - Intronic
1010709018 6:79150930-79150952 GAATAACTACAAAACAAAGGTGG - Intergenic
1010977718 6:82334893-82334915 TATAAATTAGAAAACACAGGTGG - Intergenic
1012516196 6:100062818-100062840 GATTAAGTAGCAAGCAAAGGAGG - Intergenic
1013203534 6:107925311-107925333 GATAAACTAGGAAAAACAATTGG + Intronic
1020329058 7:6999841-6999863 GAGTTTCTAGGATACACAGGGGG - Intergenic
1022953217 7:35358130-35358152 GATTAAATAGAAAACCCAAGAGG + Intergenic
1024842403 7:53602812-53602834 GATCACCTAGGAAACACTGCAGG + Intergenic
1027799589 7:82734755-82734777 GATTAACTAGCAAACACCTTAGG - Intergenic
1028781851 7:94746247-94746269 GAGTACCCAGGAAATACAGGAGG - Intergenic
1029495850 7:100895278-100895300 GATTAACTAGGAAACCCGAGTGG + Intronic
1029836992 7:103322214-103322236 GATGAACTCGGAAAGACAGCTGG + Intronic
1031887695 7:127258141-127258163 GCTAACGTAGGAAACACAGGGGG + Intergenic
1034369374 7:150581485-150581507 GTTTAACTGGGAAACATTGGAGG - Intergenic
1034478449 7:151302321-151302343 GACTGGCTCGGAAACACAGGTGG + Intergenic
1035440031 7:158889383-158889405 TATGAACTAGGAAAAACAGGAGG - Intronic
1038284420 8:26194145-26194167 TCTTACCTAGGAAACATAGGGGG + Intergenic
1041040448 8:53841304-53841326 GAATAAGTGGGAAACATAGGAGG - Intronic
1045910372 8:107400474-107400496 TGTCAACTAGGAAAAACAGGAGG + Intronic
1049854893 8:144855239-144855261 TATAAACTAGGCAAGACAGGGGG + Intergenic
1050316302 9:4404977-4404999 GAGTAACTAGGAAAAAAAGAGGG + Intergenic
1052785232 9:32822161-32822183 GACCAACTAGGAAACACTGATGG + Intergenic
1058690760 9:107518618-107518640 CATTCACTTGGAAACACAGTGGG + Intergenic
1062372063 9:136245251-136245273 GATTAACTGGGAGAGACATGGGG + Intronic
1203479541 Un_GL000224v1:254-276 GAGTAACTGGGAGCCACAGGAGG + Intergenic
1203480507 Un_GL000224v1:6550-6572 GAGTAACTGGGAGCCACAGGAGG + Intergenic
1203481474 Un_GL000224v1:12878-12900 GAGTAACTGGGAGCCACAGGAGG + Intergenic
1203482438 Un_GL000224v1:19187-19209 GAGTAACTGGGAGCCACAGGAGG + Intergenic
1186733637 X:12437694-12437716 GATTACCTATGAGACACAGATGG - Intronic
1186735745 X:12462224-12462246 TATTATCTACAAAACACAGGAGG - Intronic
1188355804 X:29189434-29189456 GAAAAACTAGGAAAAAGAGGGGG - Intronic
1191238014 X:58151732-58151754 GACTAACAAGGAAACAAAAGTGG + Intergenic
1196345625 X:114653646-114653668 GATGAACAAGGAGAAACAGGAGG - Intronic
1196784174 X:119407769-119407791 CATTCATTAGGGAACACAGGAGG - Intronic
1198419010 X:136450154-136450176 GAATAACTAGGAATGACTGGTGG + Intergenic
1198601541 X:138289250-138289272 GAATAGCTAGGAAACAGAGAGGG + Intergenic
1200681698 Y:6220641-6220663 GATTAACAAAGAAAAAAAGGAGG - Intergenic