ID: 992666553

View in Genome Browser
Species Human (GRCh38)
Location 5:79015167-79015189
Sequence GTGGATTAACTAGGAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992666553_992666561 27 Left 992666553 5:79015167-79015189 CCTGTGTTTCCTAGTTAATCCAC 0: 1
1: 0
2: 0
3: 7
4: 118
Right 992666561 5:79015217-79015239 TTCACATGCAGTCCCTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992666553 Original CRISPR GTGGATTAACTAGGAAACAC AGG (reversed) Intronic
905410628 1:37765626-37765648 GGGGATGAGCTAGGAGACACCGG - Intergenic
908570991 1:65409992-65410014 GCGGATTAGCTGGGAAACAGAGG + Intronic
914227535 1:145733541-145733563 TTGAATTAACTAGGAACCATAGG - Intronic
916389139 1:164311323-164311345 GTGTGTTAAGTAGGAAAAACAGG - Intergenic
919235404 1:194835026-194835048 GTGAATTATTTAGGAAAAACTGG + Intergenic
921497736 1:215861639-215861661 GGGTATTAACCAGAAAACACTGG - Intronic
921994680 1:221405309-221405331 GAGGATTAAAAAGGAAATACAGG - Intergenic
1064852168 10:19720912-19720934 GTGAGTTACATAGGAAACACAGG + Intronic
1065709680 10:28503472-28503494 TTTGATTAATTAGGAAATACTGG + Intergenic
1067495378 10:46756595-46756617 GTGGACTAAACAGGAACCACTGG + Intergenic
1067599275 10:47583793-47583815 GTGGACTAAACAGGAACCACTGG - Intergenic
1067948938 10:50710378-50710400 GTGGACTAAACAGGAACCACTGG - Intergenic
1070884256 10:79875370-79875392 GTGGACTAAACAGGAACCACTGG - Intergenic
1071650810 10:87391670-87391692 GTGGACTAAACAGGAACCACTGG - Intergenic
1074615919 10:115068002-115068024 GGGGCTTGACTAGAAAACACTGG + Intergenic
1078270028 11:9786753-9786775 GTGGATTAAATAGGATACGAAGG + Intronic
1079994175 11:27277925-27277947 GTGGATTGACTGGGATTCACTGG + Intergenic
1086726701 11:90195009-90195031 GTGCAGTAACTAGGAAAAAATGG + Intergenic
1098512635 12:71335899-71335921 TTGGACTAACTGGGAAAAACAGG - Intronic
1100177021 12:92042518-92042540 TTGCATTAACTAGCTAACACAGG + Intronic
1100481549 12:94984219-94984241 GTGGACAAGCTAGGAAACATGGG - Intronic
1101733663 12:107446719-107446741 GTGGATTATCTGGTAGACACAGG + Intronic
1107123725 13:36821709-36821731 GTGAATTAAGTATGACACACTGG - Intronic
1109495266 13:63162065-63162087 GTGGAGAAAATAGAAAACACAGG - Intergenic
1110235095 13:73209516-73209538 GTGCACTAAAAAGGAAACACAGG - Intergenic
1113183933 13:107664471-107664493 TTGCATTAAATAGGAAACAATGG - Intronic
1113543462 13:111127031-111127053 GTGGACTGATTAGGAAAAACGGG + Intronic
1116769172 14:49107271-49107293 ATAGATTAACTAGGATTCACAGG - Intergenic
1126458367 15:48889317-48889339 GTGGATTCTCTAGGTGACACTGG + Intronic
1132416326 15:101622015-101622037 TTGGAATAACTGGGAAACTCAGG + Intronic
1134340800 16:13343915-13343937 GTGGATTAACAAGGAGAGAAAGG + Intergenic
1135823768 16:25707985-25708007 GTGGAGTAACTATGGAATACAGG - Intronic
1138789120 16:59881499-59881521 CTGGATTCATTAGGAAGCACAGG + Intergenic
1139759880 16:69176317-69176339 CTCGAGTAGCTAGGAAACACAGG - Intronic
1139822348 16:69730460-69730482 GTGGGTTGATTGGGAAACACAGG + Intergenic
1140497493 16:75402025-75402047 CTATATTCACTAGGAAACACTGG + Intronic
1143767890 17:9149619-9149641 GAGGGTAAACTAGGAAACCCTGG + Intronic
1144469852 17:15528927-15528949 GATGATTAACTAGGAAAAAGAGG - Intronic
1149636527 17:58175129-58175151 ATGGAGTGACTAGGAAAGACTGG - Intergenic
1151863835 17:76786461-76786483 GGGGATTCACTAGGACTCACAGG + Intergenic
1152656804 17:81523633-81523655 GTGGAGTACCTGGGAATCACTGG + Intronic
1154303565 18:13215331-13215353 GAGGACTGAGTAGGAAACACAGG + Intergenic
1157385790 18:47259406-47259428 TTGGCTTCTCTAGGAAACACTGG - Intergenic
1157808738 18:50678242-50678264 ATGGATTAATTAGGAAGCACTGG + Intronic
1159311018 18:66709086-66709108 GTTGATTATTTAGGAAACATTGG + Intergenic
1168368922 19:55814782-55814804 CTGGATTATCTAGGACACACGGG + Intronic
928407663 2:31027098-31027120 GATGAGAAACTAGGAAACACAGG + Intronic
929874162 2:45782597-45782619 GTACATTATCTTGGAAACACTGG - Intronic
931485199 2:62683721-62683743 GTGGAAAAACTAGGAAAGAAGGG + Intronic
931826411 2:66004943-66004965 TTTGATTAACTGGGAGACACCGG - Intergenic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
932170880 2:69554937-69554959 GTGGAGGAACTAAGAAGCACAGG - Intronic
932437753 2:71712647-71712669 GAGGAGTATGTAGGAAACACAGG + Intergenic
933946742 2:87293140-87293162 GTTGAATAACTAGGAACAACAGG + Intergenic
936092086 2:109507957-109507979 GTGGGTTCACTAAGAAACGCTGG + Intergenic
936333448 2:111568396-111568418 GTTGAATAACTAGGAACAACAGG - Intergenic
936433947 2:112487022-112487044 GTTGTTTCAGTAGGAAACACTGG + Intronic
939928903 2:148207564-148207586 GTGGAAGAATGAGGAAACACTGG + Intronic
941122089 2:161542142-161542164 GAAGATTAATAAGGAAACACTGG + Intronic
1171367109 20:24632784-24632806 GTGGCTTTACAAGGAAACAAGGG + Intronic
1173911099 20:46671569-46671591 GTGGGTTCTCTAGGAAACAGGGG + Intronic
1181118183 22:20647230-20647252 GTGGATTAACTAGGTGCTACTGG + Intergenic
1182736307 22:32533963-32533985 GTGGATTCACATGGAAAAACAGG + Intronic
949601104 3:5598631-5598653 GTTGACTAACTTGCAAACACGGG + Intergenic
951100389 3:18681529-18681551 TTGGTTTTACTAAGAAACACAGG - Intergenic
955000423 3:54922385-54922407 GTGGATTAAATTGTAAGCACAGG - Intronic
956453110 3:69393376-69393398 GTTGATTAACTAGTAAAAATGGG - Intronic
958931866 3:100215992-100216014 GTGGATTAAAAAGGACACAAAGG - Intergenic
960363250 3:116739879-116739901 TTGAATTAACCAGGAAACACAGG + Intronic
960714947 3:120565658-120565680 GAAGAGTAGCTAGGAAACACAGG + Intergenic
969918449 4:10513121-10513143 GGGGGTTAACTAGGATATACAGG - Intronic
977577690 4:98692207-98692229 GTGGAATAAGTATGAAATACTGG - Intergenic
978948785 4:114530775-114530797 GAGAATTAATAAGGAAACACTGG + Intergenic
979618744 4:122774617-122774639 GTCCATTAACTAGAAACCACTGG + Intergenic
980564036 4:134514808-134514830 GTGGAGCAAATAGGAAATACAGG + Intergenic
982531093 4:156544987-156545009 GGGGATTAGGAAGGAAACACAGG - Intergenic
989042661 5:37245431-37245453 TTGGTTTAACTAGGAAAAATAGG - Intronic
990410053 5:55533507-55533529 GTGGAATAACTAGGAACTACTGG + Intronic
991221157 5:64219846-64219868 GTAGTTTCACTATGAAACACTGG - Intronic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
993846509 5:92951113-92951135 GAAAATTAACAAGGAAACACTGG - Intergenic
994582913 5:101670411-101670433 GTGCATTAACTAGGGAATAAGGG - Intergenic
996767878 5:127053094-127053116 GTGGACTGATTAGGAAAAACAGG - Intronic
997620662 5:135290510-135290532 GTGGCTTAACTAGGTACCTCAGG - Intronic
998825605 5:146098309-146098331 GATGATTAACTTGGAAACAAAGG + Intronic
1000004148 5:157167343-157167365 GGGGATTTACTGGGAACCACAGG + Intronic
1002075311 5:176705042-176705064 GTGGCTTCTCTAGGAAACACAGG - Intergenic
1002306966 5:178289284-178289306 GTGGATTAACTGGGATTTACCGG + Intronic
1004726341 6:18314685-18314707 TTGGATTAACTAGGGAGCAATGG + Intergenic
1016127321 6:140420735-140420757 GTAGCTTAATTAGGAAACATTGG - Intergenic
1017107790 6:150904414-150904436 CTGAATTCACTAGGAGACACAGG + Intronic
1021209565 7:17830534-17830556 GTAGATTATCTTGAAAACACTGG + Intronic
1023725436 7:43138420-43138442 GTAAATTAATTAGGAACCACCGG + Intronic
1024603397 7:51006528-51006550 GTGAATTCAACAGGAAACACTGG + Intergenic
1029866702 7:103639181-103639203 GTAGTTTTACTAGAAAACACAGG + Intronic
1030372017 7:108711391-108711413 GTGGATTAACATGGACATACTGG - Intergenic
1030837192 7:114303568-114303590 AGAGATTAACTAGGAAACAAAGG - Intronic
1031740913 7:125429548-125429570 GTGGATTAAGTATGAAAACCTGG - Intergenic
1037548847 8:19950496-19950518 ATTGCTTAACTTGGAAACACTGG + Intronic
1041373491 8:57189370-57189392 GTGGTATAGCTAGGAAACAGTGG + Intergenic
1043390976 8:79791321-79791343 GTGGCTTCACTTGGATACACCGG + Intergenic
1043405699 8:79930219-79930241 CTTAATTAACTAGGCAACACAGG + Intronic
1047104463 8:121718256-121718278 ATGGAATAACAAAGAAACACAGG - Intergenic
1051816681 9:21116510-21116532 GTGCATAAACTAGAAAACATAGG - Intergenic
1052358670 9:27530154-27530176 GTGGATTTACTAGAACACACTGG + Intergenic
1053234946 9:36444956-36444978 GTGGATTAACCAGAAATCTCTGG - Intronic
1053302706 9:36963163-36963185 GCAGATTAACCAGAAAACACTGG + Intronic
1055536863 9:77256526-77256548 GTAGATTAATAAGGAAACAGGGG - Intronic
1056565722 9:87771073-87771095 GTGGACTAAACAGGAACCACTGG + Intergenic
1056574187 9:87842747-87842769 GTGGACTAAACAGGAACCACTGG + Intergenic
1057769353 9:97953624-97953646 GTGGATTGACTTGTAAACAAAGG - Intergenic
1060328964 9:122647044-122647066 GAAAATTAACTAAGAAACACTGG + Intergenic
1061556963 9:131376600-131376622 TTGTGTTAACAAGGAAACACAGG - Intergenic
1185948970 X:4409265-4409287 GTGGATTCACTAAAATACACAGG - Intergenic
1186270935 X:7887230-7887252 ATGAATTTACTAGGAAGCACTGG + Intergenic
1191184803 X:57598474-57598496 GTGGATTAGATGGGAAAGACCGG + Intergenic
1191909149 X:66128783-66128805 GTGCATAAACTAGAAAACAGAGG - Intergenic
1192804936 X:74500210-74500232 TTGGATGAAGGAGGAAACACGGG + Intronic
1193093554 X:77521804-77521826 GTAAATTAAATAGGAAAGACTGG - Intronic
1195476067 X:105287240-105287262 GAGCATTAACTAGGAAAGACAGG + Intronic
1201922738 Y:19252440-19252462 GTTGCTTATCTAGGAAAAACAGG + Intergenic
1202160598 Y:21931243-21931265 GGGAATTATCTAGCAAACACAGG + Intergenic
1202230758 Y:22655132-22655154 GGGAATTATCTAGCAAACACAGG - Intergenic
1202312400 Y:23541033-23541055 GGGAATTATCTAGCAAACACAGG + Intergenic
1202558403 Y:26129561-26129583 GGGAATTATCTAGCAAACACAGG - Intergenic