ID: 992666554

View in Genome Browser
Species Human (GRCh38)
Location 5:79015176-79015198
Sequence TAATGAACTGTGGATTAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992666554_992666561 18 Left 992666554 5:79015176-79015198 CCTAGTTAATCCACAGTTCATTA 0: 1
1: 0
2: 1
3: 9
4: 147
Right 992666561 5:79015217-79015239 TTCACATGCAGTCCCTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992666554 Original CRISPR TAATGAACTGTGGATTAACT AGG (reversed) Intronic
900072533 1:783631-783653 AAATGAACTGTATATTAATTTGG - Intergenic
905908391 1:41636503-41636525 TTTTTAACTGTTGATTAACTGGG - Intronic
909168230 1:72256871-72256893 TTAAGATCTGTGGTTTAACTTGG + Intronic
909448401 1:75772812-75772834 TATTTAACTGTGGATTAGCTTGG - Intronic
909527015 1:76636284-76636306 TAATGATCTGTGGTTAAAGTAGG + Intergenic
909542771 1:76809153-76809175 TAATGAAATATGGATTGAATTGG - Intergenic
910575835 1:88762868-88762890 TAAGGAACTGTGGAATAGCCTGG + Intronic
911925700 1:103829419-103829441 TAATGAACTTTTGTTTATCTGGG + Intergenic
914399441 1:147303863-147303885 TAATGCACTTTGAATTTACTTGG - Intergenic
915281368 1:154824542-154824564 CAATCAACTGGGGATCAACTGGG + Intronic
916274387 1:162978126-162978148 TAAAGCACTGTGGACTAACATGG - Intergenic
918353000 1:183677266-183677288 TAATCAATTTTGGATTTACTTGG + Intronic
918710330 1:187719323-187719345 TAATCAACTTTAGATTGACTTGG + Intergenic
919139607 1:193554372-193554394 TAATAAACCGTGGATTTTCTTGG + Intergenic
920803086 1:209207651-209207673 TAATGATTTGGGGTTTAACTCGG - Intergenic
922267476 1:223997590-223997612 AAATGAACTGTATATTAATTTGG - Intergenic
923200265 1:231704424-231704446 TAATGTACTGTGAATAACCTGGG + Intronic
923583654 1:235244593-235244615 TAATCAATTTTGGAATAACTAGG + Intronic
1062782803 10:231591-231613 TAATCAGCTATGGATAAACTTGG + Intronic
1063278449 10:4597581-4597603 TAATGAAAAGTGAATGAACTTGG + Intergenic
1064782813 10:18861110-18861132 TAGTGAACTTTAGATGAACTGGG - Intergenic
1064962987 10:20987058-20987080 AGATGAAATGTGGATTAAATGGG + Intronic
1066030070 10:31411863-31411885 TAATAAACTGTGGAATAACTGGG + Intronic
1066726235 10:38398014-38398036 AAATGAACTGTATATTAATTTGG + Intergenic
1071027232 10:81129594-81129616 TAATCAAGTGTGAATTTACTGGG + Intergenic
1071276381 10:84059455-84059477 TAATGAGATGTAGATGAACTGGG - Intergenic
1073820899 10:107263234-107263256 AAAGAAACTGTGGGTTAACTAGG + Intergenic
1076886157 10:133263562-133263584 TGATTATCTGTGGATAAACTTGG - Intronic
1079430506 11:20385145-20385167 TAATGAACACTTGATTACCTGGG - Intergenic
1084304588 11:68273239-68273261 ACATGAACTGTGGTTGAACTGGG - Intergenic
1085356643 11:75844118-75844140 TACTGAACTGTGGATCTACAAGG + Intronic
1090326560 11:125891620-125891642 TAATGAAGTGTTGATAGACTGGG + Intronic
1091283195 11:134394002-134394024 TAATGAAGTATGGATTGACTGGG - Intronic
1091697205 12:2635909-2635931 AAATGATCTGAGGATTTACTGGG - Intronic
1093176873 12:15922694-15922716 GAATGCACTGTGGTTTATCTGGG + Intronic
1096939473 12:55326235-55326257 TAATAAACGGTGTATTAAGTTGG + Intergenic
1097675041 12:62591036-62591058 TAATAAACTGAGGGTTAATTTGG + Intronic
1098058134 12:66530851-66530873 TAATGAACATGGTATTAACTAGG - Intronic
1098075761 12:66728997-66729019 AAAGGAGCTGTGGGTTAACTAGG + Intronic
1099718500 12:86330239-86330261 CAATAAACTGGGGAGTAACTTGG - Intronic
1100005416 12:89889682-89889704 TAAAGATATGTGGGTTAACTAGG - Intergenic
1101060616 12:100967691-100967713 TAATGAACTGTGATTTTATTTGG - Intronic
1107868127 13:44723457-44723479 TAAGGAACTGTAGAATCACTAGG - Intergenic
1109788048 13:67207692-67207714 AAATTAACTGTGGATTATTTTGG + Intronic
1110482924 13:76002895-76002917 TAATGAACTATAGATTAAGCAGG - Intergenic
1111080050 13:83293546-83293568 CCATGAACTATGGAATAACTGGG + Intergenic
1112641814 13:101283851-101283873 TAAAGAGCTGTGGATTTTCTTGG + Intronic
1116853158 14:49928369-49928391 GCATGAAGTGTGGACTAACTGGG + Intergenic
1120276889 14:82387135-82387157 GAATGAACTGTGGAGTACGTAGG - Intergenic
1123625198 15:22222516-22222538 TAATGAGATGTGGATGAACTGGG - Intergenic
1125247535 15:37658698-37658720 TAATGATGTGTTAATTAACTTGG + Intergenic
1126313922 15:47347827-47347849 TAATTTAGTGTGAATTAACTTGG + Intronic
1126357983 15:47816470-47816492 CAGCGAACTGTGGATTATCTAGG - Intergenic
1131575085 15:93581041-93581063 TAATGAACTGTTGAAAAACTGGG + Intergenic
1135258976 16:20964855-20964877 TCAGGAACTGTGGCTTACCTGGG - Exonic
1144525627 17:15987304-15987326 TGATGGACTGTCGATCAACTAGG + Exonic
1150956368 17:69865066-69865088 TAATGAGCTGTGGATAAAGAGGG + Intergenic
1157694467 18:49709884-49709906 TAATGAGATGTAGATGAACTGGG - Intergenic
1158896361 18:61917674-61917696 TAATGCTTTGTGGAGTAACTAGG - Intergenic
1166057263 19:40299332-40299354 AAATGAACAGTTGATTAAATAGG + Intergenic
1166560636 19:43730230-43730252 TACTGAACGATGGATTAATTTGG + Exonic
1168183722 19:54682802-54682824 TAATGAGATGCGGATGAACTGGG + Intronic
926962225 2:18370245-18370267 TAATGACCTCTTGATTAAATAGG + Intergenic
933024621 2:77240340-77240362 TAATGAATTGATGTTTAACTTGG - Intronic
933613566 2:84461342-84461364 TAATGAGATGTAGATGAACTGGG - Intergenic
939055199 2:137356810-137356832 AAAGTAAGTGTGGATTAACTTGG - Intronic
940235792 2:151509579-151509601 TAATGAAATGCAGATGAACTGGG + Intronic
941352425 2:164453238-164453260 TAATGAAATGTGGACTCATTTGG - Intergenic
941594583 2:167459793-167459815 TAATGAACTTTTGTTTATCTGGG + Intergenic
944559769 2:200924374-200924396 TAAAGAACTGTGGATAAAATGGG + Intronic
1177313104 21:19423189-19423211 TAATGTAATGTTGATTAGCTTGG + Intergenic
1177802491 21:25841546-25841568 TAATGAACTGAGGATAAACCAGG + Intergenic
1178294576 21:31398324-31398346 TGAAGAACTGTGGATAAGCTGGG + Intronic
1178779374 21:35587187-35587209 TATTGAAATGTGGGTTACCTTGG - Intronic
1179283293 21:39953310-39953332 TAATGAGATGTAGATGAACTGGG + Intergenic
1183863795 22:40688374-40688396 TAACGAGATGTGGATGAACTGGG + Intergenic
950975659 3:17240585-17240607 TCATAAATTCTGGATTAACTAGG + Intronic
956417945 3:69052648-69052670 TAATAAGCTCTGTATTAACTTGG + Intergenic
956561695 3:70584387-70584409 TATTGAACTGTGGAATAAATAGG + Intergenic
959344060 3:105170630-105170652 TAATGAACTGTGGGAACACTGGG - Intergenic
959344067 3:105170671-105170693 TCATAAACTGTGGAGTCACTTGG + Intergenic
961122934 3:124388886-124388908 TAATGAACTCAGGATCAAATAGG - Intronic
963279547 3:143369179-143369201 TATTTATCTCTGGATTAACTTGG - Intronic
963884544 3:150566111-150566133 TAATGAGCTGTGGATTTAAAAGG + Intronic
965003707 3:162988698-162988720 TAATAAACTGAGCATTAAGTGGG + Intergenic
966042198 3:175505406-175505428 TTATGGACTGTGGGTTGACTTGG - Intronic
966908316 3:184543615-184543637 TAATGATGTGTGGATTGTCTGGG + Intronic
969624686 4:8296475-8296497 CAAAGAACTTTAGATTAACTGGG - Intronic
969930167 4:10623018-10623040 TATTGCATTGGGGATTAACTAGG + Intronic
970104634 4:12567536-12567558 TAATGAACTCTGAAATACCTAGG - Intergenic
970280060 4:14445100-14445122 TATGGAGCTGTGGGTTAACTGGG - Intergenic
970643962 4:18098104-18098126 TAATGGACTGTGGATTTGCAGGG + Intergenic
970938073 4:21597983-21598005 TTATGAACTGTTGATTCAGTTGG + Intronic
972052636 4:34758578-34758600 AAATAAACTTTGGATTTACTGGG - Intergenic
972056920 4:34815151-34815173 TACTGGTCTGGGGATTAACTGGG - Intergenic
972822906 4:42722870-42722892 TATTGAGCTGTGTATTAATTAGG - Intergenic
973926164 4:55740071-55740093 TAATGAACTTTGGATATAGTAGG + Intergenic
977794582 4:101147674-101147696 GAATGAACTATGGATGAACAAGG - Intronic
979335747 4:119459674-119459696 AAATGAACTGTATATTAATTTGG - Intergenic
980210640 4:129782951-129782973 TTATGAATTATGGATGAACTGGG + Intergenic
980647387 4:135659975-135659997 TTATAAACTCTCGATTAACTAGG - Intergenic
980864672 4:138541050-138541072 AAATGACCTGTGGTTTAAGTAGG - Intergenic
981216936 4:142180849-142180871 TAATGAACTTTGTTTTAATTAGG - Intronic
984736201 4:183110645-183110667 TAATGTACTTTGGTTTCACTAGG + Intronic
986956053 5:13151057-13151079 TAATGAAGTGTGAATTATCAAGG + Intergenic
987838703 5:23195173-23195195 TAATGAACTTTTTATTAAATAGG + Intergenic
988313608 5:29594257-29594279 TAATGAGATGTAGATGAACTGGG - Intergenic
988382841 5:30520504-30520526 TAATGCACTGTGGAATACCATGG - Intergenic
990133961 5:52622136-52622158 TATTGAATTGTGGATTTACTAGG + Intergenic
990546193 5:56824042-56824064 TAATGAATTTTGGATGAAGTAGG - Intronic
992666554 5:79015176-79015198 TAATGAACTGTGGATTAACTAGG - Intronic
993827753 5:92713379-92713401 TAATGAACAGTATTTTAACTCGG + Intergenic
994612753 5:102065577-102065599 TGATGAACTCTGGATCAGCTTGG - Intergenic
995435349 5:112128950-112128972 TAATGTGCTGTGGATTGACGTGG - Intergenic
1000566925 5:162859896-162859918 TCAGGAACTGAGGATTAATTAGG - Intergenic
1001018889 5:168165843-168165865 TAAGCAACTCTGAATTAACTGGG - Intronic
1005339238 6:24827943-24827965 TAATGAACCAGGGATTCACTAGG - Intronic
1005348853 6:24914739-24914761 TGATGAATTGTGTATTTACTAGG - Intronic
1005802426 6:29440594-29440616 TAATGAACTGCAGATTATCCTGG + Exonic
1009381654 6:63038925-63038947 CAATGAACTGTGTATTAGCATGG - Intergenic
1009576156 6:65464144-65464166 GAATGATCTCTGCATTAACTGGG - Intronic
1011629020 6:89306886-89306908 TAACGTACTGTGGATTAGCCTGG - Intronic
1013727057 6:113111804-113111826 TAGTGAATTGAGCATTAACTTGG + Intergenic
1014026757 6:116657235-116657257 AAATGAATTATGGATTAAGTAGG - Intronic
1016153353 6:140771973-140771995 TAAAGAAAAGAGGATTAACTGGG + Intergenic
1020989669 7:15181185-15181207 TAATGAACTGTGAATAATTTAGG - Intergenic
1021287277 7:18796048-18796070 TAATTAAATGTTGATTTACTGGG - Intronic
1023005750 7:35865252-35865274 AAATGAACTGTACATTAATTTGG - Intronic
1024068343 7:45764081-45764103 AAATGAACTGTATATTAATTTGG + Intergenic
1025140568 7:56460064-56460086 TTATGAACTGTGGATGAAACAGG + Intergenic
1031812517 7:126389913-126389935 GAATGGACTATGGATTAAATGGG + Intergenic
1032207075 7:129875890-129875912 TCATGAACTGGGGATTACTTGGG + Intronic
1039769640 8:40671402-40671424 TGATGAACTTTGGATTATTTTGG - Intronic
1041317990 8:56583827-56583849 TAATGAAATGCAGATGAACTTGG - Intergenic
1043950470 8:86303215-86303237 TAATGAACTGTAAGTTCACTAGG + Intronic
1044250553 8:90000466-90000488 TAATGAGATGTCGATGAACTGGG + Intronic
1046591710 8:116215021-116215043 TACTGAAGAGTTGATTAACTTGG + Intergenic
1047330733 8:123884593-123884615 TAATGATGTGTGCATTAGCTGGG + Intronic
1047767904 8:128004319-128004341 TCAAGAACTATGGATTTACTGGG + Intergenic
1048658035 8:136564339-136564361 TAAGAATCTGTGGATTAATTTGG - Intergenic
1051412911 9:16809615-16809637 TAATGTACTGAGTATTAGCTGGG + Intronic
1051552729 9:18348196-18348218 TAATGAACTTTTAGTTAACTTGG + Intergenic
1055528635 9:77160505-77160527 TAATGAACTGTGGATTGTTATGG - Intergenic
1055969156 9:81894463-81894485 TGATGAACTGATGATCAACTGGG + Intergenic
1056277708 9:85009320-85009342 TGAGGGACTGGGGATTAACTGGG - Intronic
1057853490 9:98583652-98583674 TCATGCACAGTGGATTAACTTGG - Intronic
1059290316 9:113217530-113217552 TAATGGACTCTGCATCAACTTGG + Intronic
1186613065 X:11157466-11157488 TAATGTACTGTGGATGGATTAGG - Intronic
1189095747 X:38137177-38137199 TAATGAACTGTGGAATGCATTGG + Intronic
1189802127 X:44701195-44701217 TACTGAACTGTGTATTAAAAGGG - Intergenic
1189899286 X:45689424-45689446 TCATGATCTGTTGAATAACTGGG + Intergenic
1192156950 X:68753722-68753744 TAATTAACTTTGGAGGAACTTGG + Intergenic
1194191595 X:90843107-90843129 TAATGAATTTTGCATCAACTTGG - Intergenic
1197799974 X:130338783-130338805 TTATGAGGTTTGGATTAACTGGG + Intergenic
1198830587 X:140745797-140745819 AAATGACCAGTGGATAAACTAGG - Intergenic
1200538236 Y:4425540-4425562 TAATGAATTTTGCATCAACTTGG - Intergenic
1201459238 Y:14203847-14203869 TAATACACTATGAATTAACTAGG + Intergenic
1201927986 Y:19311032-19311054 TAAGTATCTGTGGATTATCTTGG + Intergenic