ID: 992666555

View in Genome Browser
Species Human (GRCh38)
Location 5:79015186-79015208
Sequence AGGAGGATGTTAATGAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992666555_992666561 8 Left 992666555 5:79015186-79015208 CCACAGTTCATTAACATCCTCCT 0: 1
1: 0
2: 2
3: 13
4: 175
Right 992666561 5:79015217-79015239 TTCACATGCAGTCCCTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992666555 Original CRISPR AGGAGGATGTTAATGAACTG TGG (reversed) Intronic
900201266 1:1407644-1407666 ACGAGGATGTTCAGGAACCGAGG + Intergenic
905912632 1:41664372-41664394 AGGAGGATGTCATTCAACTTGGG - Intronic
908405915 1:63814279-63814301 AGGAGTATGTGCAAGAACTGTGG - Intronic
910093450 1:83492774-83492796 AGTAGGACATTAATGAAATGGGG + Intergenic
913192016 1:116420870-116420892 GGGAGCTTGTCAATGAACTGGGG - Intergenic
914684046 1:149962363-149962385 AGGAGGAGGATAATGAACTGGGG - Intronic
916250159 1:162730191-162730213 AGAAGGAAGATAATGAACCGAGG + Intronic
917487891 1:175471476-175471498 CGGAGCATGTTACTGTACTGAGG + Intronic
918465811 1:184820446-184820468 AGTAGGATGTTTATGAGCAGAGG - Intronic
923726104 1:236506821-236506843 AGCAGTATGTTAATGAGCAGAGG + Intergenic
1065896825 10:30170357-30170379 AGGAGGATGGAAATGGAGTGAGG + Intergenic
1066542395 10:36461409-36461431 AGGAAGATGTTAATGAATATAGG - Intergenic
1068911691 10:62384970-62384992 AACAGGATGTGAATGAACGGTGG + Intronic
1070392805 10:75985778-75985800 AGGAGGATGTGAATGCACACTGG + Intronic
1070745427 10:78930905-78930927 AGGTGAATTTTAATGAACAGAGG - Intergenic
1071365429 10:84894872-84894894 ACAAGGATTTTACTGAACTGTGG + Intergenic
1071746511 10:88425899-88425921 AGTAGGGGGTCAATGAACTGTGG + Intronic
1071785411 10:88894138-88894160 AGGAGGTTGATAATGAATAGGGG - Intronic
1072984509 10:100128124-100128146 AGGCAGCTGTTAAAGAACTGTGG + Intergenic
1074084991 10:110203139-110203161 ATGGAGATGTTAAAGAACTGGGG + Intergenic
1074473228 10:113746023-113746045 ACGAGGAGGTCAAGGAACTGAGG - Intergenic
1075834977 10:125445361-125445383 AGGAAGATGTAGATGGACTGGGG - Intergenic
1075859374 10:125661582-125661604 AGGTGCATGTTAATGAGCTGTGG + Intronic
1077522199 11:3043090-3043112 AGGAGGAGGTGACTGCACTGAGG - Intronic
1079247388 11:18762556-18762578 AGGGGGATGGGAAAGAACTGGGG - Intronic
1079890905 11:26051670-26051692 AGGAGGAAGTTACTGCAATGTGG + Intergenic
1081371412 11:42308876-42308898 AGGAGATTGTTCATTAACTGCGG + Intergenic
1082234921 11:49813312-49813334 AGGTGGATGTACATGCACTGCGG - Intergenic
1087143371 11:94788465-94788487 AGGAGGATGTTAATCCACTGTGG - Intronic
1089580692 11:119480401-119480423 AGGAAGATGTTGAGGAATTGGGG - Intergenic
1091045118 11:132318473-132318495 AAGAGGATGTAAAGGGACTGTGG - Intronic
1093444181 12:19235872-19235894 AGGAGAAATTTAATGCACTGAGG + Intronic
1094150242 12:27274891-27274913 AGCAGGATATGACTGAACTGGGG - Intronic
1094360071 12:29621051-29621073 AAGAGGATTTTCATGAATTGAGG + Intronic
1098334118 12:69383952-69383974 AGAGGGATGGTAATGAAGTGGGG + Intronic
1099790913 12:87332326-87332348 AGGATGATGTCAATGAGATGAGG - Intergenic
1101323683 12:103696304-103696326 ATGAGGATGTTAATAAGATGGGG - Intronic
1102487782 12:113269785-113269807 AGGAGGATGTCCATGAAGGGCGG - Exonic
1104513777 12:129404997-129405019 GGGTGGATGTGAATGAAATGAGG + Intronic
1106216248 13:27703288-27703310 AGCAGAATATTAATGAACTGTGG - Intergenic
1109166534 13:59041773-59041795 AAGAGGATGTTAAAGTACTTAGG + Intergenic
1113441802 13:110334957-110334979 AGGAGGAAGATAAAGAGCTGGGG + Intronic
1116109068 14:40551911-40551933 GGGAGGATGTAAATGATTTGTGG + Intergenic
1117999887 14:61513147-61513169 TGGTGGATGCTAAGGAACTGAGG - Intronic
1118314069 14:64714945-64714967 AGGAGGTTGTTACTGAGTTGAGG + Intronic
1121602982 14:95219748-95219770 GGGAGGCTTTTAATGAACAGGGG + Intronic
1122030881 14:98910861-98910883 AAGAGGATTTTAATGAACCTGGG + Intergenic
1123962363 15:25417738-25417760 AATATGATGTTAATGACCTGTGG + Intronic
1124725299 15:32151248-32151270 AGCAAGATGTTAAAGTACTGAGG - Intronic
1125033100 15:35092722-35092744 AGGAGGTTTTTATAGAACTGGGG + Intergenic
1125262070 15:37837728-37837750 AGGAGGAGGATAATAAACTATGG + Intergenic
1126111893 15:45180050-45180072 AGGAGGTTGTAAAGGAGCTGAGG - Intronic
1126368722 15:47922982-47923004 ATGAAGATGTTAATGAAATGGGG + Intergenic
1126567967 15:50119599-50119621 AGGAGGATGAAAATGAACAATGG + Intronic
1127592985 15:60445827-60445849 AGTAGGAAGTTAAAGAAATGAGG + Intronic
1127976553 15:64001494-64001516 AGGAGGATGGGAAGGAAGTGGGG + Intronic
1128035932 15:64526561-64526583 AATATGATGTTAATTAACTGTGG + Intronic
1130197059 15:81789707-81789729 AGGAGGATCTAAATGATATGAGG + Intergenic
1131827569 15:96333059-96333081 AGCAGGATGTTAATCCACGGAGG - Intronic
1133633975 16:7648813-7648835 AGGAGAATTTAAATGAATTGAGG + Intronic
1135470679 16:22727235-22727257 AGGAGGAGGTTAAGCAATTGTGG + Intergenic
1135951758 16:26920728-26920750 AGGAGAATGATAATGAAGAGTGG + Intergenic
1138228631 16:55322238-55322260 AAGAGGATGTTGAGGAACAGTGG - Intergenic
1139835950 16:69838671-69838693 AGGAGTATGGGAAGGAACTGAGG - Intronic
1141053596 16:80795541-80795563 AGAAGCATGACAATGAACTGAGG + Intronic
1143271371 17:5677807-5677829 AGGAAGATGTTATTGAACAATGG + Intergenic
1143684287 17:8501588-8501610 GGGAGGATGTTAGTTAATTGCGG - Intronic
1145723588 17:27095864-27095886 AGGAGTAGATTAATGAAATGTGG + Intergenic
1145921493 17:28613486-28613508 AGAAAGAGGTTGATGAACTGAGG + Exonic
1146990530 17:37266966-37266988 AGGAGGATGTTAATGAAGACTGG - Intronic
1148095096 17:45047029-45047051 AGGAGGACCTAAAAGAACTGTGG + Intronic
1148767728 17:50048989-50049011 AGGAGAATGTTAACGAACAAGGG + Intergenic
1149908519 17:60549101-60549123 AAGAGGATTTTAATGAAAGGAGG + Intergenic
1155878204 18:31112449-31112471 GGGAGGAACTTAAGGAACTGAGG - Intergenic
1155979617 18:32166694-32166716 AGGAAGATGGTAATGAAGTAAGG - Intronic
1156753111 18:40485207-40485229 AGGAGAAAGTGAAGGAACTGAGG + Intergenic
1158300895 18:56051618-56051640 ATGAGGCTGTCAAAGAACTGGGG + Intergenic
1165767621 19:38361044-38361066 AGGAGGAGGTGTATGCACTGTGG + Intronic
1167745376 19:51347747-51347769 AGGAGGTTGTGAATGAAGGGAGG - Intronic
1167830826 19:52020923-52020945 AGGAGGATGGTACTGCACAGGGG - Intronic
925595127 2:5548023-5548045 AGGAGGGTGTGCATGAACTATGG + Intergenic
927478935 2:23435096-23435118 AGGAGGATGTGAATTCACTGGGG + Intronic
929581233 2:43082843-43082865 AGGGGGGTGTCTATGAACTGGGG - Intergenic
932298737 2:70648117-70648139 AGGAGGATGTTAAGGCAAGGAGG + Intronic
933008654 2:77028405-77028427 AGAAGTGTGTTAATGAAGTGAGG - Intronic
933620188 2:84530281-84530303 AAGAGGTTGTGAATTAACTGGGG + Intronic
934153402 2:89171903-89171925 AGGAAGATGTTGGTGAACTCAGG - Intergenic
934213834 2:90010028-90010050 AGGAAGATGTTGGTGAACTCAGG + Intergenic
935380887 2:102449904-102449926 AGGAGGATATAAAAGAGCTGAGG - Intronic
936838019 2:116731699-116731721 TGCAGGATGGTAATGAACCGTGG + Intergenic
939072848 2:137564595-137564617 AGTAGTATGTAAATGAGCTGTGG + Intronic
939771596 2:146326735-146326757 AGGAGGGTTTTATTGACCTGGGG + Intergenic
941055569 2:160784085-160784107 AAGATGATGTTACAGAACTGGGG + Intergenic
941611927 2:167672194-167672216 AGGAGGGTGTCCATGAAATGAGG - Intergenic
945404433 2:209427246-209427268 AGGAGGATAGTATTGATCTGGGG - Intronic
945557374 2:211296080-211296102 AGGATGATGTAAAAGAAGTGGGG + Intergenic
947728830 2:232417136-232417158 GGGAGGATGGTGCTGAACTGAGG - Intergenic
947740795 2:232483956-232483978 AGGAGGATGGTGCTGAACTGAGG - Intronic
1169709128 20:8541611-8541633 AGGAAGATAGTAATGAAATGTGG + Intronic
1170408793 20:16066650-16066672 AGAAGGAAGGTAATGAACTGAGG + Intergenic
1173146734 20:40531270-40531292 AGGAGGATGGAAATGAAAGGAGG + Intergenic
1173626243 20:44475254-44475276 GGGCGGATCTTAATGGACTGGGG + Intergenic
1175627378 20:60500630-60500652 ATGAGGATGGTGATCAACTGAGG + Intergenic
1175627451 20:60500974-60500996 ATGAGGATGGTGATCAACTGAGG + Intergenic
1177049857 21:16219833-16219855 AGGAAAATGTTCATGAACTTTGG - Intergenic
1179905924 21:44423361-44423383 AGGGGGAGGTGAGTGAACTGAGG - Intronic
1181403500 22:22665946-22665968 AGGAGGCTTATACTGAACTGAGG + Intergenic
1181408506 22:22701930-22701952 AGGAGGCTTATACTGAACTGAGG + Intergenic
1182687483 22:32132392-32132414 AGCAGCTTGTTGATGAACTGTGG - Intergenic
1183448518 22:37876657-37876679 ATCAAGATGTTAATGATCTGAGG - Intronic
1184279800 22:43430464-43430486 AGGAGGAGGTCACTGAGCTGGGG + Intronic
949107058 3:212161-212183 AGAAGGGTGGTAATAAACTGAGG + Intronic
949381689 3:3454020-3454042 AGGAGGGTGTTTATGGACTGAGG - Intergenic
949956373 3:9272122-9272144 AGGGGGCTGTGAATGACCTGTGG - Intronic
950290443 3:11779817-11779839 AGGAGGATGGTGATGAATTCGGG - Intergenic
950365851 3:12483674-12483696 AGGAGGATGGCAAGGAAGTGTGG - Intergenic
950908801 3:16566168-16566190 AGGTGGAGGTGAATGAACAGAGG - Intergenic
953489106 3:43333104-43333126 AGGTGGATGTTTAAGAACTTAGG + Intronic
953953720 3:47213905-47213927 AGGAAGATGTTCATGAACTATGG - Intergenic
958936371 3:100260543-100260565 AGCAGGAAATTACTGAACTGTGG + Intergenic
959962048 3:112308496-112308518 AGGAGGATGAGAAAGACCTGGGG - Intergenic
962952888 3:140235734-140235756 AGGAGAATGTTTATGAACCCTGG - Intronic
962971236 3:140403873-140403895 AGCAGCATGTGAATGAAGTGGGG - Intronic
963395358 3:144725498-144725520 AAGAGGGTGTTAATGTACTATGG - Intergenic
964516591 3:157516095-157516117 AGGAGAATCTTTATGAACTTGGG - Intronic
966139780 3:176743321-176743343 AGGAGAATCTTCATGACCTGGGG - Intergenic
967416397 3:189223352-189223374 ATCAAGATGTTAATGACCTGTGG + Intronic
968864050 4:3196327-3196349 AGGAGGATGAGGATGAACTTGGG - Intronic
975790425 4:77943942-77943964 AGGGGGATGTTTAAGAACTTTGG + Intronic
976853188 4:89572842-89572864 AGGAGGGTTATAATTAACTGAGG - Intergenic
977356117 4:95949141-95949163 AGGAAGAAGCTAATGAATTGGGG + Intergenic
977377291 4:96222075-96222097 TTGTGGATGTTAATGAACAGAGG - Intergenic
977961276 4:103088152-103088174 AAGAGGATCATAATGAAATGGGG + Intronic
981600892 4:146487333-146487355 CAGAGGTTGGTAATGAACTGGGG - Intronic
983099648 4:163609311-163609333 ATGTTGATGTTAATGAACAGAGG - Intronic
983396669 4:167206061-167206083 AGAAGTATGTTTATGAACTTTGG + Intronic
983954353 4:173679712-173679734 AGAAGGATCTTAAAGAACTTGGG - Intergenic
985899860 5:2780049-2780071 AGGAGGCTGTTAAAGGACAGAGG + Intergenic
989709879 5:44385619-44385641 AGGAAAATGTTACTGAAATGTGG + Intronic
991470178 5:66959757-66959779 AACAGAATATTAATGAACTGTGG + Intronic
991483202 5:67105952-67105974 AGGAGGATGTCAGTGAGTTGAGG - Intronic
992588361 5:78265555-78265577 AGGAGCATGATAATTTACTGAGG - Intronic
992666555 5:79015186-79015208 AGGAGGATGTTAATGAACTGTGG - Intronic
992987938 5:82252890-82252912 AGGAGGAAGTTACAGAACAGAGG + Intronic
994225744 5:97249971-97249993 AGGAAGAAGTTCATGAATTGTGG - Intergenic
994483544 5:100365966-100365988 AGGAAAATGTTTATGAAATGGGG - Intergenic
995983997 5:118145860-118145882 AGGAAGATAATAATGCACTGAGG - Intergenic
996563950 5:124860139-124860161 AGGAGGATGCTGATGACCTTAGG - Intergenic
997855816 5:137371625-137371647 AGGAGGTTGTTTATGATTTGGGG - Intronic
1000803787 5:165761942-165761964 AAGAGGAGGTTAAGGAACTGAGG + Intergenic
1000937040 5:167314329-167314351 AGTAGGTTGTTAATAAAATGAGG + Intronic
1009297294 6:61968355-61968377 AGGAGTATGTGACAGAACTGTGG - Intronic
1010777769 6:79906602-79906624 AAGAGGCTGTTAATAAACAGAGG - Intergenic
1011427647 6:87247951-87247973 AAGAGGGAGTTAATGAACAGAGG + Intronic
1011849591 6:91609875-91609897 GGGAGGATTTCAATGAAATGAGG + Intergenic
1014203564 6:118630548-118630570 AGGTGAATGTTGATAAACTGTGG + Intronic
1015504697 6:133971076-133971098 AAGAGGATGAGAATGAACGGAGG - Intronic
1017359247 6:153546680-153546702 AGGAGGATTTTTATAAACTCTGG + Intergenic
1024403773 7:48953882-48953904 AGGAAAATTTTAATGAGCTGGGG - Intergenic
1025962894 7:66239316-66239338 AGGAGCATGTAATTGACCTGAGG - Intronic
1027828218 7:83143842-83143864 AGGTGTGTGTTAATCAACTGAGG - Intronic
1030497194 7:110314945-110314967 AGGAGAATTTTAAAGAACGGTGG - Intergenic
1032779461 7:135152173-135152195 AGAAGGATGTTAAGTAACTAAGG + Intronic
1034140584 7:148811754-148811776 AGGAGGGTGAAAATGGACTGGGG + Intronic
1035964398 8:4174167-4174189 AGGAGAATGTTAAACTACTGAGG + Intronic
1037827739 8:22169264-22169286 AGGAGGTTCTTAGTGGACTGAGG - Intronic
1041618545 8:59936744-59936766 AGGAAGAAGTTAAAGAACGGTGG + Intergenic
1042395581 8:68287964-68287986 AGGAGGATGGTATTTAACTGCGG + Intergenic
1042878693 8:73463787-73463809 ACGAGGATATTCATGAACTGTGG + Intronic
1044618728 8:94168074-94168096 AGGAGAATGTAAATACACTGGGG + Intronic
1048416249 8:134230678-134230700 AAGATGATGTGATTGAACTGGGG - Intergenic
1049566294 8:143340858-143340880 ACGAGGATGTAAAAGAAGTGTGG - Intronic
1051236719 9:15008019-15008041 AGGAGGATGGCACTGAAATGGGG + Intergenic
1052346302 9:27413135-27413157 AGAAGGAAGTTGAGGAACTGAGG + Intronic
1053054825 9:34988142-34988164 AGGAGGATGGAAAGGAAGTGGGG - Intergenic
1054864795 9:69989119-69989141 AGGAGCATGTGAGTGAAATGAGG - Intergenic
1055570765 9:77614776-77614798 GAGAGAATGCTAATGAACTGAGG - Intronic
1061394444 9:130336195-130336217 GGGAGCAAGTTAATAAACTGTGG + Intronic
1186648633 X:11535016-11535038 AGGAGGATGATGGTGAAATGGGG - Intronic
1187083073 X:16011468-16011490 AGGAGGATATTCCTGTACTGGGG + Intergenic
1187228313 X:17395561-17395583 AGGCTGGTGTAAATGAACTGTGG + Intronic
1188567620 X:31544572-31544594 AGGGGAATGGTAATAAACTGGGG - Intronic
1191177201 X:57516922-57516944 AGGAGGGTGTGGATGGACTGAGG + Intergenic
1192339568 X:70252162-70252184 AGAAGGAAGTAAATGTACTGGGG - Intergenic
1192909169 X:75584967-75584989 AGGAGGGTTTTGATGCACTGTGG - Intergenic
1193231155 X:79048324-79048346 AGATGGATTTTATTGAACTGAGG - Intergenic
1195409496 X:104554584-104554606 AGGAGGATCTTAAAGAAATGAGG - Intergenic
1196188195 X:112766898-112766920 AAGCGGAGATTAATGAACTGTGG + Intergenic
1196626454 X:117882556-117882578 AGGAGGATGTTGAATAACAGTGG - Intergenic
1197220600 X:123909651-123909673 AGAAGAATTTTAATGAAGTGCGG - Exonic
1199725156 X:150572781-150572803 AGGAGGATGGTACAGACCTGGGG - Intronic