ID: 992666556

View in Genome Browser
Species Human (GRCh38)
Location 5:79015203-79015225
Sequence GCATGTGAAGGGGTGAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 618
Summary {0: 1, 1: 0, 2: 6, 3: 40, 4: 571}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992666556_992666561 -9 Left 992666556 5:79015203-79015225 CCTCCTCTCACCCCTTCACATGC 0: 1
1: 0
2: 6
3: 40
4: 571
Right 992666561 5:79015217-79015239 TTCACATGCAGTCCCTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992666556 Original CRISPR GCATGTGAAGGGGTGAGAGG AGG (reversed) Intronic
900120331 1:1046101-1046123 GGATGTGAAGGGGAGTGGGGAGG + Intronic
901088675 1:6627302-6627324 CCATGTGCTGGGGTGACAGGCGG - Intronic
901195943 1:7439770-7439792 GCAGATGAAGGGGTGAAGGGAGG + Intronic
901761931 1:11477501-11477523 CCATGTGAGAGGGTGGGAGGAGG - Intergenic
902404530 1:16175529-16175551 ATATGTGAGGGGGTGGGAGGGGG + Intergenic
902777253 1:18682771-18682793 GCCTGGGAAGGGGAGAGAGGAGG + Intronic
902931402 1:19734202-19734224 GCATGTGAGGTGGAGAGAGGCGG + Intronic
903604846 1:24568052-24568074 GGATGTGAACGGGTCACAGGCGG - Intronic
904807273 1:33140862-33140884 GAAGGAGAAGGGGAGAGAGGAGG - Intergenic
905616820 1:39407278-39407300 GTATCTGAAGGGCTGAGACGTGG - Intronic
905687306 1:39917782-39917804 GGAGGTGAAGAGGGGAGAGGAGG + Intergenic
905801854 1:40849349-40849371 GGATGTGAGGGGAGGAGAGGAGG - Intergenic
905957045 1:42006222-42006244 GCATGTGTTGGTGTGAGGGGTGG + Intronic
907791220 1:57666694-57666716 GCATGAGAAATGGTGAGAAGTGG - Intronic
911384234 1:97154741-97154763 TTAGGGGAAGGGGTGAGAGGGGG + Intronic
912073472 1:105842631-105842653 GCCTGTCAGGGGGTGGGAGGAGG - Intergenic
912253886 1:108039634-108039656 GCCTGTGGTGGGGTGAGGGGAGG - Intergenic
912474930 1:109929152-109929174 GCATGGAAGGGAGTGAGAGGAGG - Exonic
913140919 1:115940709-115940731 GCAAGTGAGAGGGTGGGAGGAGG + Intergenic
913199106 1:116482048-116482070 GGGTGTGAAGGGATGAGGGGAGG - Intergenic
914899933 1:151706457-151706479 GCACCTGCAGGGCTGAGAGGTGG + Intronic
915512044 1:156391800-156391822 CCATGTAAAGGGGTGAGGGAAGG - Intergenic
915725971 1:158017970-158017992 GAATGTGAAGGGGGAGGAGGAGG + Intronic
916170061 1:161995247-161995269 AAATGCCAAGGGGTGAGAGGAGG - Intronic
916828465 1:168466393-168466415 GCATGTGTAAGAGTGGGAGGTGG - Intergenic
916962817 1:169906193-169906215 GCCTGTTGTGGGGTGAGAGGAGG + Intergenic
916998475 1:170328284-170328306 GGATGTGATGGGCTGAGAAGAGG + Intergenic
917441587 1:175073627-175073649 GCATGTTAAGGAGAGAGAAGTGG - Intronic
917980251 1:180264837-180264859 GGGTGTGAGGGGCTGAGAGGTGG - Intronic
918114421 1:181484305-181484327 GCATGTGAAGGGAGTAGGGGTGG - Intronic
918518646 1:185389929-185389951 GCATTGGAAGATGTGAGAGGTGG + Intergenic
919941227 1:202287784-202287806 GCAGTGGAAGGGGTGAGACGTGG - Intronic
920006370 1:202836476-202836498 GGATGTGATGGGGTGAAAGAGGG - Intergenic
920302106 1:204995487-204995509 GCGTGCGGAGGGGTGAGCGGTGG - Intronic
920849269 1:209617710-209617732 GCAGAAGGAGGGGTGAGAGGTGG - Intronic
920868288 1:209771493-209771515 GCATGTGAAGGTGTGTGTGAAGG + Intronic
921126508 1:212182677-212182699 GCAGTTGAAGGTGTGGGAGGTGG - Intergenic
921395610 1:214666053-214666075 GCAAGTGAGAGGGTGAGGGGAGG - Intergenic
921758039 1:218882018-218882040 TCATGTGGCGGGGTGAGTGGAGG - Intergenic
922341002 1:224655118-224655140 GGGTGTGAAGGGGTAAGGGGAGG + Intronic
922722640 1:227906501-227906523 GGGTGGGAAGAGGTGAGAGGAGG - Intergenic
922997039 1:229972526-229972548 GCAGGTGATGAAGTGAGAGGAGG - Intergenic
923104154 1:230841590-230841612 CCATGCGAAGGGGTATGAGGTGG - Intronic
923460928 1:234208643-234208665 GCATGTGAGGAGTTGGGAGGAGG + Intronic
923620263 1:235573316-235573338 GCCTGTCAAGGGGTGGGGGGAGG + Intronic
923687567 1:236163950-236163972 GCATGGGGAGGTGTGGGAGGTGG - Intronic
923819103 1:237415869-237415891 GCATGTGGAGGGGTAAGTAGAGG + Intronic
923870543 1:237988778-237988800 GCCTGTCATGGGGTGGGAGGAGG + Intergenic
924584838 1:245353240-245353262 GTATGTGAAAGAGGGAGAGGGGG - Intronic
1062948113 10:1476112-1476134 TCCTTTGAAGGGGTGAGAGAAGG + Intronic
1063391629 10:5653286-5653308 GCAGGGGCAGGGGTGGGAGGTGG - Intronic
1063664620 10:8053895-8053917 GGATGAGAAGGGGGGAGGGGAGG - Intronic
1064535219 10:16351224-16351246 GCAGGTGGAGGGGTGCGGGGTGG - Intergenic
1064831793 10:19476639-19476661 GTATGTGAATAGGTTAGAGGTGG + Intronic
1065241425 10:23708871-23708893 GAAGGTGAAGTGGTGAGAAGTGG + Intronic
1065510222 10:26471002-26471024 GCATGTGAAGTGCTTACAGGAGG - Intronic
1065759089 10:28965014-28965036 GCAAGAGGAGGGGAGAGAGGAGG - Intergenic
1065817306 10:29493764-29493786 GCATGGGGAGGGGTGACATGGGG + Intronic
1065924908 10:30426812-30426834 ATATGTAAAGGAGTGAGAGGAGG + Intergenic
1065955547 10:30690713-30690735 GCATGGGGAGGGGTGACATGGGG - Intergenic
1066361602 10:34737110-34737132 GCGGGTGAAGGGGAGAAAGGGGG + Intronic
1067477398 10:46576060-46576082 GAATCTGAAGAGCTGAGAGGAGG + Intergenic
1067617342 10:47765724-47765746 GAATCTGAAGAGCTGAGAGGAGG - Intergenic
1067829213 10:49600407-49600429 GCTCCTGCAGGGGTGAGAGGAGG + Intergenic
1068164390 10:53309382-53309404 GCATGTGAGTGGGAGAGAGCAGG + Intergenic
1068441456 10:57060511-57060533 GAATAAGAAGGGGTGAGAGAGGG - Intergenic
1069122082 10:64579117-64579139 GCCTGTCGTGGGGTGAGAGGAGG + Intergenic
1069373123 10:67767857-67767879 GAAAATGATGGGGTGAGAGGGGG - Intergenic
1069588885 10:69630087-69630109 GCGTGGGAAGGAGTGGGAGGTGG - Intergenic
1069650887 10:70047419-70047441 GCCTGTCATGGGGTGGGAGGAGG + Intergenic
1069949498 10:72009390-72009412 GGATGTGGATGGGTCAGAGGAGG - Exonic
1070410342 10:76133838-76133860 GGATGGGAAGGGGGGAGATGAGG + Intronic
1070455240 10:76608371-76608393 GGATGTGAAGGGGTGAAGTGGGG + Intergenic
1070610175 10:77927111-77927133 GCCTGGGGAGGGGAGAGAGGAGG - Intergenic
1070630623 10:78082087-78082109 GCATTCGAGGGGGTGGGAGGAGG - Intergenic
1070656996 10:78278518-78278540 GCATCTGAAAGGGATAGAGGTGG - Intergenic
1071740258 10:88350380-88350402 GCATGTCATGGGGTGGGAGGAGG - Intronic
1071943330 10:90612341-90612363 GCAGGTGAAGTGGTGAGCAGAGG + Intergenic
1072533502 10:96341694-96341716 GCATCTGAAGGGCAGAGAGGAGG + Intergenic
1072835842 10:98710945-98710967 GCCAGTGAAGGGTTGAGAGATGG + Intronic
1073088561 10:100912773-100912795 GCATGTGACGGGGTGGGAGGGGG + Intronic
1073117461 10:101099606-101099628 GCAGGTGGAGGGATGGGAGGTGG + Intronic
1074179788 10:111049107-111049129 GCCTGTTATGGGGTGGGAGGAGG + Intergenic
1074253526 10:111777588-111777610 ACATGAGAAGAAGTGAGAGGTGG + Intergenic
1074468867 10:113708627-113708649 GCATTTGGAGGGTTGAGATGGGG + Intronic
1074866971 10:117550340-117550362 GAATATGAAGGGGAAAGAGGAGG + Intergenic
1075935913 10:126341053-126341075 GCATGCGAAGGTTTGAGAGTAGG - Intronic
1075994300 10:126864563-126864585 GCCTGTCAAGGGGTGGGGGGAGG + Intergenic
1076764753 10:132627017-132627039 GGAGGTGATGGGGTGAGATGAGG + Intronic
1076861590 10:133140491-133140513 TCCTGTGAAGGAGTGTGAGGGGG - Intergenic
1077394853 11:2315801-2315823 GCTGGTGGAGGGGTGTGAGGGGG - Intronic
1077803714 11:5568600-5568622 GCTTGTGAAGAGCTGCGAGGAGG + Intronic
1078604470 11:12762935-12762957 GGATTTGATGGGGTGAGAAGGGG + Intronic
1078632514 11:13016158-13016180 GCATGGGAATGGATGAGAAGGGG - Intergenic
1079232862 11:18664748-18664770 GCCTGTCATGGGGTGGGAGGAGG + Intergenic
1079629580 11:22657542-22657564 GCATGTGAGTGTGTGTGAGGGGG - Intronic
1080387018 11:31816369-31816391 GCATGAGAAGGCGACAGAGGAGG + Intronic
1080772558 11:35355333-35355355 GGGTGTGAAGGGTTGGGAGGAGG - Intronic
1081105323 11:39060136-39060158 GCATGTTGAGGGGTTAGGGGAGG + Intergenic
1081484989 11:43520645-43520667 GGATGTGAAAAGGTGAGAGCAGG - Intergenic
1081931760 11:46876455-46876477 CCATGAGATGGGGTGAGAGCTGG - Exonic
1083128475 11:60597989-60598011 GCCTGTCATGGGGTGAGGGGAGG + Intergenic
1083399126 11:62411797-62411819 GAGTGGGAAGGTGTGAGAGGTGG - Intronic
1083743902 11:64724720-64724742 GCCTGTGAAGGGGTAAGAGGGGG + Intergenic
1084210093 11:67616823-67616845 GCATGGGAAGGTGGGAGGGGAGG + Intergenic
1084398440 11:68929978-68930000 GTATGGGGAGAGGTGAGAGGGGG - Intronic
1084440366 11:69169325-69169347 GAATGTGGTGGGGTGAGAGAGGG + Intergenic
1084708474 11:70829599-70829621 GCCTGTGCAGGGGTGAGGGGCGG + Intronic
1084721143 11:70906417-70906439 GCAAGTGATGAGGAGAGAGGTGG - Intronic
1084776416 11:71379890-71379912 GGAAGAGCAGGGGTGAGAGGAGG - Intergenic
1084871938 11:72104198-72104220 GCATGTTCTGGGGTGAGGGGTGG + Intronic
1085121473 11:73970124-73970146 GCTGGAGCAGGGGTGAGAGGAGG + Exonic
1085408832 11:76279854-76279876 GCATGTGAGGGGGTGAAACAGGG + Intergenic
1087093272 11:94297325-94297347 GAAAGTGAAGGGGAGAGATGGGG + Intergenic
1087367221 11:97235544-97235566 GCAAGAGAAGAGGTGACAGGAGG - Intergenic
1087974822 11:104531693-104531715 GCATGTCACGTGGTGAGAGAGGG + Intergenic
1088629746 11:111763316-111763338 GCATGAGAAGAGGTGACAGTAGG - Intronic
1088658537 11:112025155-112025177 GCATCCGAAAGGGTGAGACGGGG - Exonic
1088783182 11:113155870-113155892 GCAAGTTGAGGGCTGAGAGGAGG - Intronic
1089040544 11:115444936-115444958 GCACGTGGAGGGGTGAGGAGAGG + Intronic
1089102472 11:115975113-115975135 GCATGCGACAGGGTGAGAGGTGG + Intergenic
1089286630 11:117411754-117411776 GCATGGCGAGGGGAGAGAGGAGG - Intronic
1089535042 11:119155882-119155904 GCAGGTGAAGGGGAGAGGGCAGG - Intronic
1089619325 11:119713505-119713527 GCAGGGGAAGGGGGGAGACGGGG - Intronic
1089690875 11:120186075-120186097 GGGTGGGAAGGGCTGAGAGGAGG + Intergenic
1089758959 11:120708844-120708866 GCACGGGAGGGGGTAAGAGGTGG - Intronic
1089792461 11:120954673-120954695 GGATGTGGAGGGGAGGGAGGAGG - Intronic
1089950702 11:122523394-122523416 GGATCTGAAGTGGTGGGAGGTGG + Intergenic
1090206606 11:124887689-124887711 GGAAGTGAAGGGGTGAGATAGGG - Intronic
1090430378 11:126641250-126641272 GCAGAGGAAGTGGTGAGAGGTGG - Intronic
1090996288 11:131868728-131868750 GCATGTGAAGGGGAGATTTGAGG - Intronic
1091783111 12:3226156-3226178 GGGTGTGATGGGGTGAGGGGAGG + Intronic
1092433113 12:8424455-8424477 TCATATGCAGGGGCGAGAGGGGG + Intergenic
1094840419 12:34340485-34340507 GCATGGGAGGGGGTGCGTGGCGG - Intergenic
1096413082 12:51391276-51391298 GAACTTGGAGGGGTGAGAGGGGG - Intronic
1096597789 12:52707894-52707916 GCATGTGAGGGGGTGGGATGGGG + Intergenic
1096807047 12:54147240-54147262 GGGTGTGGAGGGGTGAAAGGAGG - Intergenic
1096909212 12:54965339-54965361 TCAGGGGATGGGGTGAGAGGAGG - Intronic
1097151238 12:56981321-56981343 GCAAGTGCAGGGGTGGCAGGCGG + Intergenic
1099486655 12:83237084-83237106 GCCTGTCAGGTGGTGAGAGGAGG - Intergenic
1100580892 12:95939491-95939513 GCAGTGGAAGTGGTGAGAGGTGG + Intronic
1101882386 12:108634239-108634261 GCGTGGGGAGGGGTGGGAGGTGG + Intergenic
1101948742 12:109158054-109158076 GCATGTCTAGGGGGTAGAGGTGG - Intronic
1102685467 12:114721200-114721222 GCATCTGCAGGGGTGCGGGGTGG + Intergenic
1102932948 12:116876530-116876552 GCAGGGGAAGGGGAGAGAGGGGG - Intronic
1104856420 12:131904456-131904478 GCCTTTCTAGGGGTGAGAGGTGG + Intronic
1105214367 13:18275580-18275602 GCCTGTGGTGGGGTGAGGGGAGG + Intergenic
1105649867 13:22364606-22364628 GACTGTGGAGGGGTGGGAGGAGG + Intergenic
1106157302 13:27171210-27171232 GCCTGTGCCGGGGTGAGGGGTGG - Intronic
1106861796 13:33917564-33917586 GCATGTGGAGGGTTGAGAAAGGG - Intronic
1106958123 13:34965747-34965769 GGATGACAAGGGGTGGGAGGAGG + Intronic
1107584906 13:41835073-41835095 GCCTGTCAGAGGGTGAGAGGAGG + Intronic
1107653658 13:42570249-42570271 TCATGTCATGGGCTGAGAGGAGG - Intronic
1108385497 13:49895806-49895828 GCAGGGGCAGGGGTGAAAGGAGG - Intergenic
1108410277 13:50138867-50138889 GCATTTTAGGGGGTGAGTGGTGG + Intronic
1109954207 13:69544609-69544631 TCATGGGAAAGGGTGAGAGGTGG + Intergenic
1111353386 13:87063488-87063510 GCATGTCTTGGGGTGGGAGGAGG - Intergenic
1111729188 13:92051834-92051856 ACATATGAAGGGGTCAGATGTGG + Intronic
1112439389 13:99415172-99415194 GCATGTGCATGGGTGTGAGTGGG - Intergenic
1112927297 13:104692326-104692348 TAATGTGAAGGTGTGAGATGGGG - Intergenic
1112946635 13:104935514-104935536 GCCTGTTATGGGGTGGGAGGAGG + Intergenic
1112955449 13:105051916-105051938 TCATGTGAACTTGTGAGAGGTGG + Intergenic
1113049223 13:106190025-106190047 TCAGGTGAAAGGGTGAGAGAGGG + Intergenic
1113181042 13:107626774-107626796 GGATGGGAAGGGGTGGGAGGAGG + Intronic
1113373159 13:109740873-109740895 TCAGGGGAAGGGATGAGAGGAGG + Intergenic
1113735571 13:112676684-112676706 GGATGTCAAAGGGTGACAGGAGG + Intronic
1113755626 13:112808838-112808860 GCATGTGATGGGCTGATCGGAGG - Intronic
1113765517 13:112878448-112878470 GCATGAGAAGGTGTAAGTGGTGG - Intronic
1113807701 13:113119108-113119130 GCATGGGAGGGAGGGAGAGGTGG + Exonic
1114216657 14:20662270-20662292 GGTTGTGAAGGTGTGAGAGAGGG - Intergenic
1114477876 14:23010348-23010370 GAAAGTGAAAGGGAGAGAGGTGG - Intergenic
1114667044 14:24384265-24384287 GCATGTGAGGTGGGGAGAAGAGG + Intergenic
1114741547 14:25103429-25103451 GCATGTGATTGGGTAAGAGAGGG + Intergenic
1115249239 14:31329012-31329034 GCATGTGAAGGAGGCAAAGGGGG + Intronic
1116136210 14:40927402-40927424 GCCTGTCATGGGGTGAGGGGAGG - Intergenic
1117042301 14:51778305-51778327 GGATGGGAAGAGGAGAGAGGTGG - Intergenic
1117512406 14:56466226-56466248 ACATGAGAAGTGGTGAGAAGAGG + Intergenic
1117582847 14:57170194-57170216 GCCTGTGAAGAAGTGAAAGGTGG + Intergenic
1118236896 14:64014006-64014028 GGATTAGAAGGGGTGGGAGGAGG - Intronic
1118877837 14:69799377-69799399 GAATGGGAAGGAGTGGGAGGAGG - Intergenic
1119913554 14:78373661-78373683 GGATGTGTAGGAGTGGGAGGAGG + Intronic
1120227606 14:81808735-81808757 GCATGTCACATGGTGAGAGGAGG - Intergenic
1120298968 14:82681191-82681213 GCCTGTCATGGGGTGAGGGGAGG - Intergenic
1120967469 14:90180459-90180481 GCAGTTGGAGGTGTGAGAGGTGG - Intronic
1121844590 14:97161575-97161597 GCCTGTCATGGGGTGAGGGGAGG + Intergenic
1122045002 14:99017001-99017023 GCAAGTGAAGGGGTGAGATGGGG - Intergenic
1124717884 15:32083559-32083581 ACATGTGAAGGGATGAGATAAGG + Intronic
1125331469 15:38586704-38586726 GCCTGTTATGGGGTGGGAGGAGG + Intergenic
1125463164 15:39925291-39925313 GCATGTGAGGGTGTGTGATGGGG - Intergenic
1127282108 15:57501541-57501563 GCATGGGATGGGCTGAGAGGTGG + Intronic
1127397627 15:58555339-58555361 GGATGTCAAGGGGTCAGAGCTGG + Intronic
1128326236 15:66725930-66725952 GTAAGTGAAGGGGTGGCAGGTGG - Intronic
1128412212 15:67411022-67411044 GCATGTGCAGGGGTGGGGTGGGG - Intronic
1128545246 15:68562094-68562116 GCATGGGAAGGGGTGGCTGGAGG - Intergenic
1128563619 15:68684628-68684650 GCATATGCAGGGGCGGGAGGGGG - Intronic
1128721734 15:69955309-69955331 ACATGGGAAGGGGTGGGAGTAGG - Intergenic
1129741684 15:77992548-77992570 GCATGTGAGGGGGTCAGGGTGGG + Intronic
1129775748 15:78235187-78235209 GCATGTTAAGGGGGGCGGGGGGG + Intronic
1129843963 15:78759833-78759855 GCATGTGAGGGGGTCAGGGTGGG - Intronic
1130892703 15:88146727-88146749 GCATGTCAAGGGGTTTGGGGAGG - Intronic
1131818365 15:96246169-96246191 GGATGGGAAGAGGTGAGATGGGG + Intergenic
1132323589 15:100946300-100946322 GGAGGGGATGGGGTGAGAGGAGG + Intronic
1132838700 16:1967692-1967714 GCATGAGTAGGGGTGAGTGTTGG - Intronic
1133189107 16:4120282-4120304 GCATGTGAGGGAGGGTGAGGAGG - Intergenic
1133498039 16:6338927-6338949 AAATGGGAAGGGGTGAGGGGTGG + Intronic
1133898178 16:9949085-9949107 GGAGGTGGAGGGGAGAGAGGAGG - Intronic
1134414242 16:14029993-14030015 GCATGGGGAGGGGGGAGGGGAGG + Intergenic
1135538260 16:23311279-23311301 GCATGTGGAGGGGAACGAGGTGG - Intronic
1135630184 16:24030379-24030401 GCATGTGGGTGGGTGGGAGGAGG + Intronic
1136398443 16:30005310-30005332 GCATCTTAGGGGGTGGGAGGGGG - Exonic
1137874184 16:51980083-51980105 GGATGCGATGGGGGGAGAGGAGG - Intergenic
1137935637 16:52632595-52632617 TCATGTGAAGTGGTCAGGGGAGG - Intergenic
1137950953 16:52782811-52782833 GAAGGTGAGGGGGTGAAAGGAGG - Intergenic
1138519892 16:57565000-57565022 GCAGGAGAAGGGCTGAGTGGAGG - Intronic
1138528559 16:57622584-57622606 GCATGTGATTGGGTGAGGGAAGG + Intronic
1138581529 16:57944372-57944394 GGCTGGGGAGGGGTGAGAGGTGG + Intronic
1139510267 16:67424153-67424175 GCCTGTGCAGGGGCGGGAGGGGG - Intergenic
1139591308 16:67934786-67934808 GCCCGTGAAGAGGTGAGAGCTGG - Exonic
1139776523 16:69320120-69320142 GCCTGTGAAGGTGAGAAAGGGGG - Exonic
1141208866 16:81957573-81957595 GCATGTAATGGGGTGCGGGGCGG + Intronic
1142050862 16:87957310-87957332 GGAGGTGAAAGGCTGAGAGGAGG + Intronic
1143419153 17:6775803-6775825 CCAGGTGAAGGGGAGAGGGGCGG + Intergenic
1143963224 17:10737814-10737836 GCACTTGAATGGGTGAGAGAGGG - Intergenic
1144799383 17:17914491-17914513 GCATGAAAAGGGCAGAGAGGGGG + Intronic
1145941593 17:28745721-28745743 GCTTCTGAAGGGGAGAGAGGTGG + Intronic
1146268873 17:31471611-31471633 GCTGCTGAAGGGGAGAGAGGTGG + Intronic
1146674130 17:34761227-34761249 CCACGGGAAGGGGTGTGAGGGGG - Intergenic
1147057713 17:37846932-37846954 GCATGGGAAGGGGTGTCAGGTGG - Intergenic
1147318082 17:39630372-39630394 GGATGAGCAGGGGTGGGAGGTGG - Intronic
1147608798 17:41789246-41789268 GCATGTGTGGAGGTGGGAGGTGG - Intergenic
1147614688 17:41821024-41821046 GCATGTGTGTGGGAGAGAGGCGG + Exonic
1147757611 17:42779415-42779437 GCAGCTAAAGGGGTGGGAGGAGG - Exonic
1148186269 17:45646514-45646536 GGATGTGAAGGGCGGAGAGGTGG + Intergenic
1148649390 17:49238818-49238840 GCAGGTGGAGGGGTGAGAGGAGG - Intergenic
1148657478 17:49298577-49298599 GGATGTGCAGGTGTGAGAAGGGG + Exonic
1148763354 17:50021052-50021074 GTATCTGAAAGGGTGTGAGGGGG - Intergenic
1148784447 17:50139178-50139200 GCATGTGCAGGTGTGAGGGTAGG + Intronic
1149803847 17:59595843-59595865 GCCTGGGAAGGGGTGAGATAAGG + Intronic
1149842645 17:59979635-59979657 GCCTGGGAAGGGGTGAGATAAGG - Intergenic
1150596061 17:66605931-66605953 GCATTTGAAGGGGATTGAGGAGG + Intronic
1150643002 17:66962339-66962361 GCAAGTGGAGGAGTGAGAGCTGG + Intergenic
1150911495 17:69392386-69392408 TCAGGGGAAAGGGTGAGAGGTGG - Intergenic
1151080589 17:71324583-71324605 ACTTGTGACTGGGTGAGAGGAGG - Intergenic
1151357727 17:73570393-73570415 GCATGTGAGGGTGGGTGAGGTGG + Intronic
1152245732 17:79183727-79183749 GCGTGTGTAGCGGTGGGAGGGGG + Intronic
1152361562 17:79835404-79835426 ACGGGTGCAGGGGTGAGAGGAGG + Intronic
1152635425 17:81428805-81428827 CCATGTGAGGGGCTGAGAAGTGG - Intronic
1153094545 18:1385364-1385386 GCCTGTCATGGGGTGGGAGGAGG + Intergenic
1154280283 18:12996289-12996311 GCACGTGATGGGGTGTGAGAGGG + Intronic
1155195621 18:23471400-23471422 GGATGTGAATGGGAGAGAGGGGG + Intronic
1155384409 18:25261579-25261601 GAAAGTGAAGGAGGGAGAGGAGG - Intronic
1156108938 18:33700114-33700136 GCATGTTAAGGAGAGAGATGGGG + Intronic
1157173175 18:45426955-45426977 GCATCTGAAGAGGTGAAAGGAGG - Intronic
1157845868 18:51003535-51003557 GCCTGTCATGGGGTGAGGGGAGG + Intronic
1158552776 18:58450644-58450666 GTAGGTGAAGAGGTGAGAGTTGG + Intergenic
1159092642 18:63867048-63867070 GGCTGTGAAGGGGAGGGAGGAGG + Intergenic
1159723070 18:71917733-71917755 GCATCCTAATGGGTGAGAGGTGG + Intergenic
1159748476 18:72270053-72270075 GCCTGTGATGGGGTGGGGGGAGG + Intergenic
1159764667 18:72473955-72473977 GCATGGGAAGTGGAGAGAGGAGG - Intergenic
1159926023 18:74269757-74269779 GCAGGGGAAGTGGTGAGAGGTGG - Intronic
1161377719 19:3948773-3948795 CCTTGGGAAGGGGTGAGCGGAGG + Intergenic
1161668400 19:5590589-5590611 GCAGCTGTAGGGGTGCGAGGAGG - Intronic
1161932270 19:7348946-7348968 GCATGCGCAGGGCTGAGGGGTGG + Exonic
1162548787 19:11346755-11346777 GGATGGGACGGGGAGAGAGGAGG + Intronic
1163638476 19:18448880-18448902 GGCTGTGAAGGGGAGAGATGGGG - Intronic
1163817840 19:19477746-19477768 GCATTTGGACGGGAGAGAGGTGG + Intronic
1164395898 19:27862652-27862674 GCCTGTTATGGGGTGGGAGGAGG - Intergenic
1164568914 19:29354304-29354326 GCCTGTTATGGGGTGGGAGGAGG + Intergenic
1165078143 19:33292046-33292068 GCAAGTAAAGGGGTGAGGGTGGG - Intergenic
1165182625 19:33985789-33985811 GCATGTGAATGTATGTGAGGAGG + Intergenic
1165256192 19:34578430-34578452 GCAGCTGTAGGGGTGGGAGGGGG - Intergenic
1165275132 19:34744004-34744026 GCAAGTGAAGGGGTGTGATATGG + Exonic
1165957655 19:39511663-39511685 GCAAGGGAGGGAGTGAGAGGGGG + Intergenic
1166197105 19:41214292-41214314 GCATGTGAAGAACTGTGAGGAGG - Intergenic
1166399448 19:42467482-42467504 TCATGTGAGGGGTTGGGAGGTGG + Intergenic
1166562207 19:43740351-43740373 CCATGTCAGGGGGTGGGAGGCGG + Intronic
1166755168 19:45186154-45186176 GCATGGGAGGGGGTGAGACTGGG + Intronic
1166828212 19:45622372-45622394 GCAAATGAATGGATGAGAGGTGG - Intronic
1166956242 19:46467302-46467324 GCATGTGTAGAGGAGAGAGCAGG - Exonic
1167246570 19:48376531-48376553 GGATGGGAGGTGGTGAGAGGCGG + Intergenic
1167264754 19:48478044-48478066 GAAAGGGAAGGGGTGGGAGGGGG - Intronic
1167599415 19:50445691-50445713 TCAGGTGAAGGGGAGAGAGAGGG - Intronic
1168305702 19:55433853-55433875 GGATGTGACGAGGTGGGAGGGGG - Intronic
925463872 2:4088949-4088971 TCATGGGAAGGGGTGTGAGGAGG + Intergenic
925609683 2:5692638-5692660 GAAGGTGGAGGGGTGGGAGGGGG + Intergenic
926582744 2:14649183-14649205 GCATGTGTAGGGGTTGGGGGAGG + Intronic
926629488 2:15123660-15123682 GCATGTCACAGGGTGAGAGTGGG - Intergenic
927110889 2:19863128-19863150 GCAGGTGAGAGGGAGAGAGGGGG + Intergenic
927584799 2:24292402-24292424 GCCTGTGTAGGGGTGAGGTGGGG + Intronic
928293428 2:30060551-30060573 GCAGGGGAATGGGAGAGAGGTGG - Intergenic
928429154 2:31203558-31203580 GCCTGTGATGGGGTGGTAGGGGG + Intronic
929315398 2:40471983-40472005 GCTTGTGAAAGGAGGAGAGGAGG + Intronic
929457294 2:42075029-42075051 GCACATGGAGGGGTGGGAGGAGG - Intergenic
929570778 2:43021773-43021795 ACATGTGCAGGGGAGAGAGACGG - Intergenic
931838813 2:66127777-66127799 CCTTGGGAAAGGGTGAGAGGCGG + Intergenic
931860262 2:66347033-66347055 GCCTGTCATGGGGTGAGGGGAGG - Intergenic
931996929 2:67847709-67847731 GTAGGTGAAGTTGTGAGAGGAGG - Intergenic
932115456 2:69042733-69042755 GCAGGTGAAGGGTGGGGAGGAGG - Intronic
932462198 2:71889678-71889700 GCAGGTGGAGGGGAGAGAGCCGG + Intergenic
932490700 2:72118250-72118272 GCTTGTGAAGAAGTGAGAGCTGG + Intergenic
932521391 2:72417259-72417281 GGAGGTGGAGGGGTGAGAAGAGG - Intronic
932711418 2:74067133-74067155 GCATGTGAAGAGGTGGGGAGAGG - Intronic
933085381 2:78048415-78048437 TCAGGGGAAAGGGTGAGAGGCGG - Intergenic
934117422 2:88810675-88810697 GAATGTGAGGGGGTGAGTGCAGG + Intergenic
935071576 2:99699251-99699273 ACAGGTGAAGGGGTGGAAGGTGG - Intronic
935308368 2:101759570-101759592 GAATGGGGAGGGGAGAGAGGAGG - Intronic
935658816 2:105448025-105448047 GCAGGAGAAGGGCTGAGAAGTGG - Intergenic
936271257 2:111050872-111050894 GAAGGTGAAATGGTGAGAGGAGG - Intronic
937358964 2:121215862-121215884 GCATGTCACAGGGTGAGAGAGGG - Intergenic
938360881 2:130685267-130685289 GAAGGTGCAGGGGTGAGAGCAGG + Intergenic
938590598 2:132732284-132732306 GCCTGTCAAGGGGTGGGGGGAGG + Intronic
938987767 2:136596288-136596310 CCAAGGGAAGGGGTGAGAGATGG + Intergenic
939373133 2:141328837-141328859 GCACCTGAGGGGGTGGGAGGTGG + Intronic
939795264 2:146635281-146635303 GAATGCGAAGGGGAGTGAGGAGG - Intergenic
940120992 2:150265494-150265516 GCATGTAAAGGGGGAAGAGGGGG + Intergenic
940472599 2:154117416-154117438 GCAGGGTAAAGGGTGAGAGGAGG - Intronic
940602429 2:155878619-155878641 GCCTGTCATGGGGTGAGGGGAGG + Intergenic
940620510 2:156107056-156107078 GCCTGTCATGGGGTGGGAGGAGG + Intergenic
940980500 2:159997158-159997180 GAATGGTAAGGTGTGAGAGGAGG + Intronic
941674957 2:168333970-168333992 ACATGTGAGGGTGGGAGAGGGGG + Intergenic
942407895 2:175675338-175675360 ACATGTGAAGGGGTTGGGGGTGG - Intergenic
944096332 2:195972989-195973011 GGATGTGAAGTAGTGAGAGGTGG + Intronic
946949314 2:224855587-224855609 GCATGTGAGTGGGAGACAGGTGG - Intronic
946959738 2:224971365-224971387 GCAGGTGAAGAGAGGAGAGGAGG + Intronic
947592102 2:231391741-231391763 TCCTTTGAAGGGGTGGGAGGAGG - Intergenic
947917705 2:233844946-233844968 GGATGTGATGGCATGAGAGGTGG - Intronic
947976804 2:234373640-234373662 GAATGGGAGGGGGAGAGAGGAGG + Intergenic
948301407 2:236909821-236909843 GCATGTGAAGTGCTGTGAGCAGG - Intergenic
948420727 2:237858835-237858857 TTATGTAAAGTGGTGAGAGGAGG - Intergenic
1168759697 20:341454-341476 ACATTTGAAGAGGTCAGAGGAGG - Intergenic
1169423344 20:5476982-5477004 GCCTGTCATGGGGTGAGGGGAGG + Intergenic
1170081521 20:12482007-12482029 GCATGTCACGTGGTGAGAGAGGG - Intergenic
1170506507 20:17031172-17031194 GTATGAGTAGGGGTGGGAGGGGG + Intergenic
1170589584 20:17761768-17761790 GAATGTGAATGGGAGTGAGGTGG - Intergenic
1171370979 20:24661701-24661723 GCATGAGAAGGGGAGACACGAGG + Intronic
1171444740 20:25195641-25195663 GCATGCGCAGGCGGGAGAGGAGG - Intergenic
1171852053 20:30316020-30316042 GCATGTGTATGGGAGGGAGGAGG + Intergenic
1172368651 20:34369777-34369799 GCATGTGTAGGATTAAGAGGTGG + Intronic
1172592786 20:36129138-36129160 GCATGGGTGGGGGTGAGGGGTGG + Intronic
1172637089 20:36417228-36417250 GTATGTGAAGTGTTGAGGGGTGG + Intronic
1172961465 20:38803259-38803281 GCATATGAATGGGGGTGAGGGGG + Intergenic
1175331369 20:58166921-58166943 GCAGGAGAACAGGTGAGAGGAGG + Intergenic
1175500996 20:59450696-59450718 GCATGGGAAGTGGAGAGGGGGGG + Intergenic
1175744710 20:61447681-61447703 GCATGGGAAGGGAGGAGAAGAGG + Intronic
1175944585 20:62552733-62552755 GCACGTGCGGTGGTGAGAGGTGG - Intronic
1176165087 20:63668586-63668608 GCAAGGGAAGAGGTGAGTGGGGG + Intronic
1177348173 21:19900313-19900335 GCATGTGTAGGGTGGAGGGGCGG - Intergenic
1177384953 21:20396885-20396907 GCAGGTGAACGAGTGAGTGGGGG + Intergenic
1177769558 21:25499383-25499405 GAAGGTGGGGGGGTGAGAGGAGG + Intergenic
1179451981 21:41473903-41473925 GAAGGTGAAGGGGTGAGTGAGGG + Intronic
1179554353 21:42162923-42162945 GGCTGTGCAGGGGTGAGTGGGGG + Intergenic
1179628157 21:42660114-42660136 GCAGGTGATTGGGTGAGAGAGGG - Intronic
1180017138 21:45094722-45094744 TCATGTTGAGGGGAGAGAGGGGG + Intronic
1180551056 22:16541730-16541752 GCCTGTTGTGGGGTGAGAGGAGG - Intergenic
1180595484 22:16970213-16970235 GAAGGGGCAGGGGTGAGAGGAGG + Intronic
1181538060 22:23557057-23557079 GCATTTGAAGAAGGGAGAGGAGG + Intergenic
1181560671 22:23697767-23697789 GCATGGGAAGGGGTGGGGTGGGG + Intronic
1181909373 22:26226325-26226347 GCTTGAGCAGTGGTGAGAGGTGG - Intronic
1182705444 22:32275366-32275388 GCCTGTCATGGGGTGAGGGGAGG - Intergenic
1183040596 22:35174956-35174978 GCATGGTGAGGGATGAGAGGAGG - Intergenic
1183847664 22:40555455-40555477 GCATGTCACAGGGTGAGAGCAGG - Intronic
1184128863 22:42505366-42505388 GCATGTGCTTGGGAGAGAGGCGG - Intergenic
1184137658 22:42558681-42558703 GCATGTGCTTGGGAGAGAGGCGG - Intronic
1184518035 22:44975157-44975179 GATGGAGAAGGGGTGAGAGGAGG - Intronic
1184806101 22:46795931-46795953 GCCTCTGAAGGAGGGAGAGGGGG + Intronic
1184997885 22:48223660-48223682 GAAAGAGGAGGGGTGAGAGGAGG - Intergenic
1185149435 22:49155552-49155574 GCATTGGAGGGGGTGAGGGGAGG + Intergenic
1185277216 22:49955005-49955027 GAATGTGCAGAGGTGAGAGTGGG - Intergenic
949913977 3:8942316-8942338 GCATGTCATGTGGTGAGAGTGGG - Intronic
949961600 3:9316849-9316871 GCATCTGAAGGCGGGAGAGGAGG + Intronic
950160208 3:10754832-10754854 GCATGTGACATGGTGAGAGTGGG - Intergenic
950710298 3:14809281-14809303 GGAGGTGAAGGAGGGAGAGGTGG - Intergenic
952566481 3:34665436-34665458 GCCTGAGAAGGGTAGAGAGGAGG - Intergenic
952716414 3:36484853-36484875 GCATGTTAATGGGAGACAGGAGG + Intronic
952845250 3:37682846-37682868 GCAGCTGAGGGGGTGAGAAGGGG - Intronic
953535821 3:43775983-43776005 GCTTGTGGAGGGATGAGAGATGG + Intergenic
953567601 3:44046162-44046184 GCATGCGAGGGGGTGAATGGTGG + Intergenic
953660286 3:44886989-44887011 CCATGTGAAGAGCTGAGAGCAGG + Intronic
953878781 3:46681028-46681050 CCATGAGGAGGGGTGAGGGGCGG + Intronic
953906345 3:46870217-46870239 GCTTGAGGATGGGTGAGAGGTGG - Intronic
954122276 3:48506328-48506350 GCATGGGCAGGAGTGAGTGGAGG + Intergenic
954462147 3:50633452-50633474 GCATATGTAGGGGTATGAGGAGG - Intronic
955027724 3:55186603-55186625 TCAAGGGAAGGGATGAGAGGAGG + Intergenic
955693605 3:61614119-61614141 ACAGGCGAAGAGGTGAGAGGCGG - Intronic
955972997 3:64454418-64454440 GCAGGGGAGGGGGCGAGAGGAGG + Intergenic
956277253 3:67515964-67515986 GAATGTGAAGGAGAGAGTGGGGG - Intronic
957923705 3:86780129-86780151 GAAGGTGAAAGGGTGAGAGAGGG + Intergenic
959339846 3:105114820-105114842 TCATGTGTTGGGGTGGGAGGAGG + Intergenic
959951862 3:112188384-112188406 GCCTGTCATGGGGTGAGGGGAGG - Intronic
960829417 3:121830728-121830750 GCAGGTGAAAGGAGGAGAGGAGG - Intronic
961201411 3:125048587-125048609 GCAAGAGAAGGTGAGAGAGGTGG + Intronic
961863047 3:129933503-129933525 GCATGTGAGTGTGTGTGAGGAGG + Intergenic
962038524 3:131680817-131680839 GCAGGGGAAAGGGTGGGAGGGGG - Intronic
962065042 3:131970782-131970804 GTATGTGTAGGGGTTAGTGGAGG + Intronic
962203291 3:133416744-133416766 GCAAGTAAAGGGGTGAGTAGAGG - Intronic
962745583 3:138395437-138395459 GCGTGTGAAGGATGGAGAGGAGG - Intronic
963112924 3:141701578-141701600 GCCTGAGAACGGGTGAGGGGCGG + Intergenic
963305913 3:143652865-143652887 GCAGTTGAAGGGTTGGGAGGGGG - Intronic
963498948 3:146100717-146100739 GCATGTGTAGGGTTGGGAGTGGG + Intronic
963846152 3:150159852-150159874 GGCAGGGAAGGGGTGAGAGGGGG + Intergenic
965184046 3:165439882-165439904 GCATGTGAAAGGGAAAGGGGTGG + Intergenic
966664466 3:182455152-182455174 GCATGTGAAGAGGTGACACATGG + Intergenic
967256476 3:187597868-187597890 GCACGTGCAGGGGTGTAAGGGGG - Intergenic
968255889 3:197271186-197271208 CCAAGTGAGGGGGTGAGAGGAGG - Intronic
968517517 4:1021131-1021153 GCAGGGGAAGGGGTGAGGTGGGG + Intronic
968878529 4:3286790-3286812 GCATGTGCAGGGTTGTGAGAGGG + Intergenic
969131084 4:4991524-4991546 GTATGTGAAAGGGTGAGTGTGGG - Intergenic
969680612 4:8641325-8641347 CCATGTGCAGGGGAGAGCGGAGG + Intergenic
970478228 4:16446612-16446634 GCCTGTCATGGGGTGAGGGGAGG - Intergenic
971455691 4:26841579-26841601 GCATGCGAGCTGGTGAGAGGGGG + Intergenic
971706442 4:30049232-30049254 GCCTGTGGTGGGGTGAGGGGAGG + Intergenic
971944391 4:33255255-33255277 GCTTCTGAATGGGTAAGAGGTGG + Intergenic
974569241 4:63623548-63623570 GCATGAGGAGGGGCTAGAGGAGG + Intergenic
975474787 4:74811329-74811351 GGCTGTGAAGGGGTGGGGGGTGG - Intergenic
975885877 4:78964108-78964130 GCATGGGAAGGAGTAAGAAGGGG - Intergenic
975955731 4:79835895-79835917 TCAGGAGAAAGGGTGAGAGGGGG - Intergenic
976435496 4:85013165-85013187 GCCTGTCATGGGGTGGGAGGAGG - Intergenic
981092137 4:140742863-140742885 GCAGGGGCAGGGGAGAGAGGAGG + Intronic
981208499 4:142072328-142072350 GCCTGTCATGGGGTGAGGGGAGG + Intronic
981669676 4:147273927-147273949 GTTTGTGGCGGGGTGAGAGGGGG + Intergenic
982710959 4:158758272-158758294 GGATTTGAAGAAGTGAGAGGTGG + Intergenic
982752917 4:159183890-159183912 GCCTGTCATGGGGTGAGAGGAGG - Intronic
983787753 4:171755289-171755311 GGTTGTGAGGGGATGAGAGGAGG + Intergenic
984758261 4:183343193-183343215 GAGTGTGGAGGGGAGAGAGGAGG - Intergenic
985976192 5:3420459-3420481 GCAGGTGATGGGGTCACAGGGGG + Intergenic
985976235 5:3420600-3420622 GCAGGTGATGGGGTCACAGGGGG + Intergenic
985976265 5:3420694-3420716 GCAGGTGATGGGGTCACAGGGGG + Intergenic
986682867 5:10249802-10249824 GCATGAGAAGGGGTGCGGGCGGG - Intronic
986787623 5:11129356-11129378 GCATGTGGAAGGGCGTGAGGTGG + Intronic
986908201 5:12520619-12520641 GCATGTCAGGTGGTGAGAGTGGG - Intergenic
986912800 5:12577299-12577321 GCCTGTCATGGGGTGGGAGGAGG + Intergenic
986969502 5:13315622-13315644 GGGTGAGAGGGGGTGAGAGGTGG - Intergenic
987106585 5:14645745-14645767 GGATGTGAAAGGGAAAGAGGGGG + Intergenic
989779491 5:45247195-45247217 ACAGGTGAAACGGTGAGAGGAGG + Intergenic
989817434 5:45752994-45753016 GCATGTGTGGGGGTGAGAGGGGG - Intergenic
990023462 5:51157323-51157345 GGAAGTTAAGGTGTGAGAGGAGG + Intergenic
990065070 5:51702070-51702092 GCCTGTCATGGGGTGAGGGGAGG + Intergenic
990546072 5:56822881-56822903 GAATCTGACGAGGTGAGAGGAGG - Intronic
992453190 5:76891765-76891787 GCAGGGGAAGAGGAGAGAGGTGG + Intronic
992666556 5:79015203-79015225 GCATGTGAAGGGGTGAGAGGAGG - Intronic
992967823 5:82021281-82021303 GTATGTGGAGGGGTGAAAGAGGG + Intronic
992999519 5:82366473-82366495 GCAAGAGAAGGGCAGAGAGGAGG + Intronic
994064927 5:95528611-95528633 GAATGTGACAGGGTGAGGGGTGG - Intronic
994232146 5:97318874-97318896 GAAGGTGAAGGGGAGAGATGGGG + Intergenic
994454878 5:99993140-99993162 GCATGTAAAGTGGTTAAAGGTGG + Intergenic
994877582 5:105445797-105445819 TCATGGAAAGGGGTGAGAGGTGG + Intergenic
995203287 5:109450260-109450282 GCATATGAAGCAGTGTGAGGTGG + Intergenic
996383445 5:122885480-122885502 GCATTAGAAGGGGGGAAAGGAGG - Intronic
997438137 5:133889900-133889922 GCATGTGGAGGAGTCAGAGAAGG - Intergenic
997475084 5:134138122-134138144 GCAGGTGCAGGGGTGGGATGTGG - Exonic
997756980 5:136408575-136408597 GCATGTTCAGGGATGAGAGAAGG + Intergenic
998034025 5:138898159-138898181 GCAAGAGAAGGGGTGGGGGGGGG - Intronic
998094497 5:139389630-139389652 GCTTGAGAAGGGGTGTGAGCAGG + Intronic
998489296 5:142532214-142532236 GCATATGAAGGGGTGAGAACAGG - Intergenic
999169339 5:149580390-149580412 GCAACTGAAGGGGAGAGGGGTGG - Intronic
1001185467 5:169567365-169567387 GAAGGTCAAGGGGTGGGAGGTGG + Intergenic
1001363294 5:171109964-171109986 GCATATTTAGGGGTGAGATGAGG + Intronic
1001651143 5:173317339-173317361 GCAGGAGAAGGGTGGAGAGGAGG - Exonic
1002633347 5:180595135-180595157 GCATGTGAAGGAGAGTGAGTGGG + Intergenic
1003119185 6:3306118-3306140 GCATGTCACGGGGTGAGAAAAGG + Intronic
1004344533 6:14836575-14836597 GCATGAGAAAGGCTTAGAGGCGG + Intergenic
1005226516 6:23649750-23649772 GCCTGTGAAGGGTGGACAGGTGG - Intergenic
1005354533 6:24969706-24969728 ACAAGTGAAGGGGAGAGTGGAGG - Intronic
1005906016 6:30261703-30261725 GGTAGGGAAGGGGTGAGAGGTGG + Intergenic
1006340926 6:33446571-33446593 GCAGGTGAAGGAGTACGAGGAGG + Exonic
1006521619 6:34574274-34574296 GGATGTGAGGGTGTGAGAGAGGG + Intergenic
1007112714 6:39322309-39322331 GCAGGTGAAGGGGAGCGATGTGG - Exonic
1007176701 6:39902217-39902239 TCATGTGAAGGGGAGATAAGAGG - Exonic
1007287110 6:40755568-40755590 GCAGGTGAAGGGGGAGGAGGAGG - Intergenic
1007418770 6:41706962-41706984 GCATGTGATGGGGTCGGGGGAGG + Intronic
1007756311 6:44101963-44101985 GCCTGTGGTGGGGTGAGAAGGGG - Intergenic
1007845071 6:44747688-44747710 CCAAGGGAAGGGGTGAGAGATGG + Intergenic
1007913430 6:45538352-45538374 GCAAATGAGGGGGTGGGAGGTGG - Intronic
1010475160 6:76277541-76277563 GATTGTGAAGGGTAGAGAGGAGG - Intergenic
1010537934 6:77053865-77053887 GCCTGTCGAGGGGTGAGGGGCGG + Intergenic
1010582910 6:77621485-77621507 CCATGTAAATGGGTGTGAGGTGG + Intergenic
1010936255 6:81865858-81865880 GCATGATGAGTGGTGAGAGGTGG - Intergenic
1011286425 6:85729344-85729366 TCAGGTGAAAGGGTGGGAGGGGG - Intergenic
1012634446 6:101518710-101518732 GCATATTAAGGGGTCTGAGGAGG + Intronic
1012740653 6:103012687-103012709 GCCTGTCAGGGGGTGAGGGGTGG - Intergenic
1015807943 6:137131483-137131505 GTGTGTGATGGGGTGGGAGGTGG + Intergenic
1016225076 6:141724890-141724912 GCATGTCAGGGGGTGGGAGTGGG + Intergenic
1017337734 6:153282111-153282133 GCAGGTGAAGGAGAGAGAGGAGG - Intergenic
1017827057 6:158089390-158089412 GCAGGTGGAGGGGTGACTGGAGG + Intronic
1017890633 6:158635882-158635904 AGAGGTGAAGGGGTGGGAGGTGG - Intergenic
1018264301 6:162005486-162005508 GCATGTGCAAGAGTCAGAGGTGG - Intronic
1018439986 6:163803029-163803051 GCTTGGGATGGAGTGAGAGGAGG + Intergenic
1018755770 6:166848746-166848768 TCACGGGAAGGGGTGGGAGGGGG + Intronic
1018998584 6:168728647-168728669 GGAAGTGAAGAGGTGAGAAGGGG + Intergenic
1019021768 6:168924575-168924597 ACATCTGAGGGGGTGAGAGCAGG - Intergenic
1019066187 6:169300640-169300662 GCATGTGAAGGGGTGTAATGAGG + Intergenic
1019643088 7:2115210-2115232 GCATGTTCCGGGGTCAGAGGAGG + Intronic
1019643183 7:2115526-2115548 GCATGTTCCGGGGTCAGAGGAGG + Intronic
1019715830 7:2538880-2538902 GCATGGGAAGGTGTCAGAGCGGG - Intronic
1019727585 7:2611578-2611600 GCTTGTGAAAGGGAGAGAGGAGG + Exonic
1020150910 7:5680992-5681014 GCATGAGAGGGAGTGAGGGGTGG - Intronic
1020691333 7:11358176-11358198 GCAGGTGAAAGGGTGAGAGGAGG + Intergenic
1020987304 7:15152491-15152513 TCAGGTGAAAGGGTGGGAGGGGG - Intergenic
1021970686 7:25962934-25962956 GTGTGGGAAGGGCTGAGAGGTGG + Intergenic
1022337540 7:29435928-29435950 TCATGAGAAGGGGTGAAAGTTGG + Intronic
1023035674 7:36129377-36129399 GCATGTGCAGGGGAGGGTGGGGG + Intergenic
1023443877 7:40211768-40211790 GAATGTGGTGGTGTGAGAGGTGG - Intronic
1023820231 7:43976802-43976824 CCAGGAGAAGGGGTGGGAGGTGG + Intergenic
1026109006 7:67443863-67443885 ACAGGTGCAGGGGTTAGAGGAGG + Intergenic
1026474709 7:70724994-70725016 GCTTGTGCAGGGGTGGGAGAGGG + Intronic
1026672307 7:72401032-72401054 GCATGCTTTGGGGTGAGAGGAGG + Intronic
1026769606 7:73187094-73187116 GCATGTGATGGAGTGGGAGGTGG + Intergenic
1027010475 7:74740480-74740502 GCATGTGATGGAGTGGGAGGTGG + Intronic
1027077567 7:75205564-75205586 GCATGTGATGGAGTGGGAGGTGG - Intergenic
1027216850 7:76189270-76189292 GCATATCATGGGGTGTGAGGGGG + Intergenic
1028986740 7:97015446-97015468 GTCTGTGAAGTGGTGGGAGGAGG - Intergenic
1029490994 7:100869811-100869833 GGATGGGAGGGGGTGGGAGGGGG + Intronic
1029748519 7:102530323-102530345 CCAGGAGAAGGGGTGGGAGGTGG + Intergenic
1029766466 7:102629407-102629429 CCAGGAGAAGGGGTGGGAGGTGG + Intronic
1030676755 7:112392656-112392678 GCATGTGAAAGGGTAAGGGACGG - Intergenic
1030997900 7:116380797-116380819 TCATGGGAAGGGGTGAGTGTAGG - Intronic
1032880490 7:136084738-136084760 GCATGTGAAGGGGTCAATGGGGG + Intergenic
1033313696 7:140280927-140280949 GGATGCGAAGGAGTGAGACGGGG + Intergenic
1033595137 7:142854126-142854148 GCTAGAGAAGGGGTTAGAGGTGG + Intergenic
1033798850 7:144877979-144878001 GCATCTGAAGCGGAGAGAGGAGG - Intergenic
1034405398 7:150899452-150899474 GCCTGTGCAGGGGATAGAGGAGG - Intergenic
1034435517 7:151061182-151061204 GCATGTGATGGGCTGGGAGGGGG - Intronic
1034451827 7:151141342-151141364 GCAAGTGGATGGGGGAGAGGAGG - Intronic
1034451876 7:151141535-151141557 GGATGTGACGGGGTGCTAGGAGG - Intronic
1035292310 7:157847251-157847273 ACATATGAAGGAGTGAGAGAGGG - Intronic
1035675934 8:1455504-1455526 GCCTGAGCAGGGCTGAGAGGAGG + Intergenic
1035839403 8:2794682-2794704 CCGTGTGCAGGGGTGAAAGGCGG - Intergenic
1036406595 8:8460766-8460788 ACCTGAGAAGGGGAGAGAGGAGG - Intergenic
1036502855 8:9329288-9329310 GTATGTTGAGGGGTGAGAAGCGG + Intergenic
1036555810 8:9859446-9859468 CCAGGGGAAAGGGTGAGAGGGGG + Intergenic
1037229351 8:16636620-16636642 GGATGGGAAGGGGAGAGGGGAGG - Intergenic
1037613698 8:20497906-20497928 GTAGGTGAAGGGGTTTGAGGTGG + Intergenic
1038232827 8:25720667-25720689 GCCTGTTGTGGGGTGAGAGGAGG - Intergenic
1038670136 8:29576640-29576662 GGATTAGAAGGTGTGAGAGGAGG - Intergenic
1038829356 8:31040022-31040044 GCAGCGGAAGTGGTGAGAGGAGG + Intronic
1039382076 8:37095168-37095190 GCAGGAGCTGGGGTGAGAGGTGG - Intergenic
1039473892 8:37829333-37829355 GTAAGTGATGGGGTGAGAAGTGG + Intronic
1039712918 8:40075520-40075542 GCCTGTGAAGAGGTGACAAGAGG + Intergenic
1039886605 8:41657757-41657779 GCAAGAGCAGGGGTGAGATGAGG + Intronic
1040030643 8:42820617-42820639 GCATCCTAATGGGTGAGAGGTGG + Intergenic
1040079821 8:43275058-43275080 GCAGGAGAAGGAGTGGGAGGAGG - Intergenic
1040860952 8:51998925-51998947 GCATGTGGAGGGGTGGCTGGAGG + Intergenic
1041344585 8:56883495-56883517 CCAGGGGAAGGGGTGGGAGGCGG + Intergenic
1041551833 8:59111577-59111599 GCATGTGTATGGGTGTGTGGGGG - Intronic
1041930389 8:63280375-63280397 GGAGGCAAAGGGGTGAGAGGAGG + Intergenic
1042680889 8:71381769-71381791 GTGTGTGTAGGGGTGGGAGGGGG - Intergenic
1043699805 8:83271216-83271238 GCCTGTCATGGGGTGGGAGGGGG + Intergenic
1043805132 8:84662982-84663004 GCCTGTTGAGGGGTGGGAGGAGG - Intronic
1044091143 8:88003285-88003307 GCAGGGGAAGGGGTGGGAGATGG - Intergenic
1044698770 8:94948772-94948794 GAGTGAGGAGGGGTGAGAGGAGG + Intronic
1044743114 8:95347730-95347752 GCATGTGAATGGGAGAATGGTGG + Intergenic
1044994661 8:97827857-97827879 GCAGGGGAAGGGGTCACAGGCGG + Intronic
1046292360 8:112179800-112179822 GCAAGAGAAAGGGAGAGAGGAGG + Intergenic
1047499889 8:125432346-125432368 GGATGGGATGGGGTGGGAGGAGG + Intronic
1049578681 8:143401058-143401080 GGCTGTGCAGGGGTGAGAGGAGG + Intergenic
1049578686 8:143401079-143401101 GGCTGTGTAGGGGTGAGAGGAGG + Intergenic
1049578691 8:143401100-143401122 GGCTGTGCAGGGGCGAGAGGAGG + Intergenic
1051185424 9:14455477-14455499 GTTAGTGGAGGGGTGAGAGGAGG + Intergenic
1051367297 9:16330077-16330099 GCGTGGGAAGGGGTGTGATGGGG - Intergenic
1052056182 9:23910372-23910394 GCCTGTCATGGGGTGGGAGGAGG + Intergenic
1052530882 9:29682623-29682645 GCCTGTCATGGGGTGAGGGGAGG + Intergenic
1052785026 9:32820445-32820467 GCATGTGCAGGTGTGGGAGAGGG - Intergenic
1053215771 9:36269258-36269280 TCATGTTAAGGGGCAAGAGGAGG - Intronic
1053789835 9:41679276-41679298 GCATGTGTATGGGAGGGAGGAGG + Intergenic
1054155305 9:61635480-61635502 GCATGTGTATGGGAGGGAGGAGG - Intergenic
1054178175 9:61890966-61890988 GCATGTGTATGGGAGGGAGGAGG + Intergenic
1054659354 9:67689858-67689880 GCATGTGTATGGGAGGGAGGAGG - Intergenic
1054756327 9:68961947-68961969 GCATGTGTCGGGGTAAGAGGAGG - Intronic
1055775782 9:79765723-79765745 GGATGTGAAGGGGAGAGCTGAGG + Intergenic
1056839631 9:89987976-89987998 GTATGTGATGGGGGGTGAGGAGG + Intergenic
1057181333 9:93032399-93032421 CCATGCTGAGGGGTGAGAGGTGG + Intronic
1057921820 9:99104527-99104549 GCATGTGAAGGGCACTGAGGAGG + Intronic
1058317948 9:103592591-103592613 GCCTGTTATGGGGTGGGAGGAGG - Intergenic
1058849556 9:108997796-108997818 GCATTTGAGGTGGTGAAAGGTGG - Intronic
1059027120 9:110646740-110646762 GCCTGTCATGGGGTGAGGGGAGG + Intergenic
1059141326 9:111855984-111856006 GCTTGTGATGGGATAAGAGGAGG - Intergenic
1059927924 9:119230320-119230342 GGCTGTGAAGGGCTGTGAGGAGG + Intronic
1060120139 9:120981150-120981172 GCATGTGGAGCTGGGAGAGGAGG - Intronic
1061067651 9:128288607-128288629 GAATGTGCAGTGGGGAGAGGTGG - Intronic
1061243926 9:129391506-129391528 GCATTTGAAGAAGGGAGAGGAGG - Intergenic
1061499605 9:130994226-130994248 GCATGTGAAAGGCTCAGAAGCGG - Intergenic
1061678352 9:132230750-132230772 GGAGGTGGAGGGGGGAGAGGTGG - Intronic
1062069181 9:134546263-134546285 GCATGTGAAGGGGACTGAGATGG + Intergenic
1062083339 9:134636092-134636114 GGGTGGGAGGGGGTGAGAGGGGG - Intergenic
1062405825 9:136395791-136395813 GCATGTGACGAGATGAGACGTGG + Intronic
1062697213 9:137881548-137881570 GCAGGTGAAGGGGTGGGGAGAGG - Intronic
1185642412 X:1596090-1596112 GCATGTGGAGGGAGAAGAGGTGG - Intronic
1186999667 X:15162773-15162795 GCATGTGATGGGCTGTGAGCTGG + Intergenic
1187146464 X:16641839-16641861 TCAAGTGTAGGGGTGGGAGGTGG + Intronic
1187405103 X:18996749-18996771 GCACCTGAGTGGGTGAGAGGTGG - Intronic
1188024192 X:25191605-25191627 GCAGGTGAAGGGATGAGCTGCGG - Intergenic
1188221884 X:27550681-27550703 GGATGGGAAGGGGAGAGGGGAGG - Intergenic
1188240789 X:27786805-27786827 CCATCTGAAGCAGTGAGAGGTGG - Intergenic
1189989324 X:46579285-46579307 GCATGTGAAGGCATGTGAGAGGG - Intronic
1190324813 X:49199986-49200008 GCAGGTGAAGGGGAGGAAGGGGG - Intronic
1190475588 X:50823969-50823991 GCATGTGCATGGGTGAAAGAAGG + Intergenic
1190609175 X:52176759-52176781 GCCTGTCATGGGGTGAGGGGAGG + Intergenic
1191745890 X:64486045-64486067 GCCTGTCATGGGGTGAGGGGAGG + Intergenic
1193165465 X:78275573-78275595 GCCTGTCATGGGGTGAGGGGAGG + Intronic
1193281754 X:79659367-79659389 ACAGGGGAAAGGGTGAGAGGGGG - Intergenic
1193296757 X:79842505-79842527 GCCTGTCATGGGGTGGGAGGAGG + Intergenic
1193586546 X:83328985-83329007 GCCTGTTGTGGGGTGAGAGGAGG + Intergenic
1193801554 X:85942909-85942931 GCCTGTTGAGGGGTGAGGGGAGG - Intronic
1194566811 X:95499236-95499258 GCCTGTGGTGGGGTGAGGGGTGG + Intergenic
1195572586 X:106412998-106413020 GCCTGTCATGGGGTGGGAGGCGG + Intergenic
1195574201 X:106431538-106431560 GCATCTGAAGGGGCTGGAGGAGG - Intergenic
1196345915 X:114658689-114658711 GCAGATAAAGGGGGGAGAGGAGG + Intronic
1196913440 X:120508145-120508167 GCATGGGTGGGGGTGAGAGGAGG - Intergenic
1197009002 X:121537444-121537466 GCATGTGAAAGGGAGAGATAAGG - Intergenic
1197263793 X:124344995-124345017 GCATGAAAAGGGGTAAGAGGTGG + Intronic
1198050417 X:132946609-132946631 GCCTGTCATGGGGTGAGGGGAGG + Intronic
1198187407 X:134266950-134266972 GCAGGAGAAGGGGAGAGAAGTGG + Intergenic
1198489222 X:137122186-137122208 AAAGGTGAGGGGGTGAGAGGTGG + Intergenic
1198513342 X:137376910-137376932 CCATGTGTAGAGGTGTGAGGTGG + Intergenic
1198932070 X:141872370-141872392 CCATGTGAGCTGGTGAGAGGAGG + Intronic
1199108324 X:143899294-143899316 TCAGGTGAAGGGGTGTAAGGGGG + Intergenic
1199736492 X:150691192-150691214 GCATGTCAAATGGTGAGAGAAGG - Intergenic
1200140651 X:153901229-153901251 GCAGGTGCTGGGGTGAGGGGCGG - Intronic