ID: 992666561

View in Genome Browser
Species Human (GRCh38)
Location 5:79015217-79015239
Sequence TTCACATGCAGTCCCTCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992666553_992666561 27 Left 992666553 5:79015167-79015189 CCTGTGTTTCCTAGTTAATCCAC 0: 1
1: 0
2: 0
3: 7
4: 118
Right 992666561 5:79015217-79015239 TTCACATGCAGTCCCTCATGTGG No data
992666555_992666561 8 Left 992666555 5:79015186-79015208 CCACAGTTCATTAACATCCTCCT 0: 1
1: 0
2: 2
3: 13
4: 175
Right 992666561 5:79015217-79015239 TTCACATGCAGTCCCTCATGTGG No data
992666552_992666561 30 Left 992666552 5:79015164-79015186 CCACCTGTGTTTCCTAGTTAATC 0: 1
1: 0
2: 1
3: 11
4: 148
Right 992666561 5:79015217-79015239 TTCACATGCAGTCCCTCATGTGG No data
992666554_992666561 18 Left 992666554 5:79015176-79015198 CCTAGTTAATCCACAGTTCATTA 0: 1
1: 0
2: 1
3: 9
4: 147
Right 992666561 5:79015217-79015239 TTCACATGCAGTCCCTCATGTGG No data
992666556_992666561 -9 Left 992666556 5:79015203-79015225 CCTCCTCTCACCCCTTCACATGC 0: 1
1: 0
2: 6
3: 40
4: 571
Right 992666561 5:79015217-79015239 TTCACATGCAGTCCCTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992666561 Original CRISPR TTCACATGCAGTCCCTCATG TGG Intronic
No off target data available for this crispr