ID: 992671296

View in Genome Browser
Species Human (GRCh38)
Location 5:79063636-79063658
Sequence TGAGCTCTGATTTCTCCAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992671293_992671296 -6 Left 992671293 5:79063619-79063641 CCAGGTAGATCCAGCCGTGAGCT 0: 1
1: 0
2: 0
3: 5
4: 54
Right 992671296 5:79063636-79063658 TGAGCTCTGATTTCTCCAGCAGG 0: 1
1: 0
2: 1
3: 26
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992671296 Original CRISPR TGAGCTCTGATTTCTCCAGC AGG Exonic
902518976 1:17005149-17005171 TGATTTCTGCCTTCTCCAGCAGG - Intronic
903190393 1:21652645-21652667 TGGGCTCTGAGTTCTGCAGCAGG + Intronic
903461730 1:23525238-23525260 TGTGGTTTGATTTCCCCAGCAGG - Intronic
903545672 1:24121977-24121999 TGGGCTCTGGTTTCTCCAGGAGG + Intronic
904476069 1:30765291-30765313 TGACCTCTGCTTTCCCCACCTGG - Intergenic
904900603 1:33854377-33854399 TAACCTCTGCTTTCACCAGCAGG - Intronic
905433396 1:37940760-37940782 TAAGCTCTGCTGTGTCCAGCTGG + Exonic
905656288 1:39688150-39688172 AGAGCTCTGATTTTCCCAGAGGG - Intronic
905863035 1:41362933-41362955 TGAGATCTGAGTTCTCCATGGGG + Intronic
907725057 1:57012392-57012414 TGAGCTGCAATTTCTCCATCTGG - Intronic
910142633 1:84043023-84043045 TGAGCACTAGATTCTCCAGCAGG + Intergenic
910173632 1:84404377-84404399 TGAACACAGATTTTTCCAGCAGG + Intronic
910617759 1:89218187-89218209 TGAGCTCTCATTTCCTCAGCTGG - Intergenic
916263007 1:162861250-162861272 AGAGCTCTGGCCTCTCCAGCAGG - Intronic
916447315 1:164885234-164885256 TGAGCTCTGATTTCTCTCGTTGG - Intronic
916890643 1:169109087-169109109 CATGCTGTGATTTCTCCAGCAGG - Intronic
917947349 1:179988450-179988472 TGTGGTCTGATTGCTCTAGCTGG + Intronic
918251700 1:182708734-182708756 TGAGCTCTGATTCCCCCATGCGG - Intergenic
919594415 1:199544440-199544462 TAACCTCTAATTTCTACAGCAGG + Intergenic
920030947 1:203037076-203037098 TGAGCTCTGAATTTTCAAGCTGG + Intronic
921217047 1:212946745-212946767 AGAGCTCAGTTTTCTCCAGAGGG + Intergenic
924037332 1:239950564-239950586 TGAGCTCTGCTTCTCCCAGCAGG + Intergenic
924566309 1:245201662-245201684 TTAGCTTTGATTTCTTCAGGTGG - Intronic
1067662786 10:48249127-48249149 TCAGCCCTGCTTTCTGCAGCTGG - Exonic
1067945756 10:50687050-50687072 TGAGTTCTGATTCCTCCCCCAGG + Intergenic
1070280072 10:75042197-75042219 TGAGCCTTGGTTTCTCCATCCGG - Intronic
1070867272 10:79713923-79713945 TGAGTTCTGATTCCTCCCCCAGG + Intronic
1070881064 10:79852047-79852069 TGAGTTCTGATTCCTCCCCCAGG + Intergenic
1071634185 10:87236146-87236168 TGAGTTCTGATTCCTCCCCCAGG + Intronic
1071647635 10:87368363-87368385 TGAGTTCTGATTCCTCCCCCAGG + Intronic
1071840476 10:89465666-89465688 CCAGCTCTGTCTTCTCCAGCAGG - Intronic
1072281537 10:93870262-93870284 TGACCACTGATTTCTCAAGTGGG + Intergenic
1072393128 10:95009789-95009811 TGAGCTCTGGGTGCTTCAGCAGG - Intergenic
1073955442 10:108866000-108866022 TAAGCCTTGATTTCTTCAGCTGG + Intergenic
1074459942 10:113627513-113627535 GGGGCTCTGATTGCTCCACCTGG + Intronic
1074472054 10:113736083-113736105 GGTGCACTGACTTCTCCAGCTGG + Intergenic
1075267847 10:121020033-121020055 TGAGCCTTGATTTCTCTATCAGG + Intergenic
1075603037 10:123784673-123784695 TGAGCTCTTAAGTCTCCAGAGGG - Intronic
1076427326 10:130376802-130376824 TGAGCTGTCACTTCTCCAGCAGG - Intergenic
1076576704 10:131474339-131474361 TGTGCTGAGTTTTCTCCAGCAGG + Intergenic
1078145777 11:8721078-8721100 AGACCTCTGGCTTCTCCAGCTGG - Intronic
1078344784 11:10537540-10537562 TGCTCTCTGAGGTCTCCAGCTGG + Intronic
1078857488 11:15218406-15218428 ATACCTCTGATTTCTCCTGCTGG - Intronic
1079621776 11:22564502-22564524 TCATCTCTGATTTCTTGAGCAGG + Intergenic
1080230138 11:30011586-30011608 TGTGCCCTGAGTTCTCCAGATGG + Exonic
1081156050 11:39692363-39692385 TGAACACGGTTTTCTCCAGCAGG - Intergenic
1083010617 11:59394722-59394744 TGGACACTGTTTTCTCCAGCAGG - Intergenic
1084589400 11:70081668-70081690 TGGGCTCTGGTTTCTTCCGCTGG - Intronic
1084860614 11:72015558-72015580 TCAGCTCTGCCTTCTCCCGCTGG + Exonic
1085029019 11:73258468-73258490 TGAGCTCTGGTTCTCCCAGCTGG - Intergenic
1085787548 11:79468180-79468202 TGGGCTCTGTTTTCTCCACAAGG - Intergenic
1085873270 11:80375766-80375788 TCATCTCTGATTTCTCCATCAGG + Intergenic
1085917737 11:80910342-80910364 AGAGCTAGGCTTTCTCCAGCAGG + Intergenic
1087965500 11:104407978-104408000 AGAGCTCTGGTTTCTCCATAAGG - Intergenic
1088375233 11:109133552-109133574 TGAGCACTGCTTCCTCCAGAGGG - Intergenic
1091424813 12:378310-378332 TGACCTCTGATTGCACCACCTGG - Intronic
1094019435 12:25898304-25898326 TCAGTTCTCATTTCTCTAGCTGG + Intergenic
1094736092 12:33235555-33235577 TGAGCTGTGTTTACTCCAGGGGG + Intergenic
1097206126 12:57322696-57322718 TGAGCTTTGGTTTCTTCAACTGG - Intronic
1098813174 12:75122083-75122105 TGACCTGTGATTTCTCCAGATGG - Intronic
1099101601 12:78448279-78448301 TGAACTCTGTTTGCTCCTGCAGG - Intergenic
1099325353 12:81208335-81208357 GGAGCTCTGATTTATAGAGCTGG + Intronic
1099650864 12:85426305-85426327 TGAGGTCTGAACTCTGCAGCCGG - Intergenic
1099876147 12:88407977-88407999 TGAGCTCTTATTTCCCCATTTGG - Intergenic
1102944984 12:116978907-116978929 TGAGCTCTTATGACTCCACCGGG + Intronic
1102992273 12:117323523-117323545 TGAGCCCTGGTTTCGCCATCAGG + Intronic
1104468951 12:129013270-129013292 TGAGCTCAGATATCTCCAGAGGG - Intergenic
1108023287 13:46151296-46151318 TGTGCTTTGTTTTCTCCATCTGG - Intronic
1108301601 13:49082895-49082917 TGAGCTCTGATTCCCCATGCTGG - Intronic
1109179963 13:59202036-59202058 TGGGCTGTGATGGCTCCAGCTGG + Intergenic
1109184156 13:59249042-59249064 TGTATTCTGATTTATCCAGCTGG - Intergenic
1112688951 13:101867115-101867137 TGAGATCTGATTTCTGCATGCGG + Intronic
1113487655 13:110666142-110666164 CGAGCACTGATTTCCACAGCCGG - Intronic
1115428896 14:33293140-33293162 CGAACCCTAATTTCTCCAGCTGG + Intronic
1119149562 14:72345953-72345975 TCAGCTCTGATTTCTGCCTCTGG + Intronic
1119654693 14:76408833-76408855 TGAGCTCTTACTTCTCCACATGG - Intronic
1121004349 14:90479077-90479099 TGAACACAGTTTTCTCCAGCAGG + Intergenic
1122087044 14:99315002-99315024 TGAGCTCTGCTGTTTCCTGCTGG + Intergenic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1126338586 15:47614528-47614550 TAAGGTCTCATGTCTCCAGCTGG - Intronic
1127601724 15:60544242-60544264 TGAACTCTCATTTCCCCAACAGG + Intronic
1127934524 15:63624107-63624129 TGAGCTGTGATTTTTTCAGATGG - Intronic
1128108641 15:65062354-65062376 TGAGCTGTGGTTTCCCCATCTGG - Intronic
1129114113 15:73355524-73355546 AGAGCCCTGAGTTCTCAAGCTGG - Intronic
1129704016 15:77784262-77784284 TGAGTTCTGCTCTCTCCTGCTGG - Intronic
1129771346 15:78205265-78205287 TGAGCTCTGAGCTCTCCAGATGG - Intronic
1132975146 16:2707214-2707236 TGGGCTCTGTTTTCTGGAGCAGG + Intronic
1133796841 16:9053134-9053156 GGGGCTCTGCTTTCTCCATCAGG + Intergenic
1134560517 16:15205371-15205393 TGATAACTGATTTCTCCAACTGG + Intergenic
1134604450 16:15559318-15559340 AGAGCTCTGATTTGTCCAGGAGG - Intronic
1134921055 16:18116986-18117008 TGATAACTGATTTCTCCAACTGG + Intergenic
1137674856 16:50299179-50299201 TGAAGTCTGAATCCTCCAGCAGG - Intronic
1138104619 16:54281331-54281353 TGAGCTATGATTGTACCAGCTGG + Intergenic
1138129689 16:54469328-54469350 TGCTCTCTGATTCCACCAGCTGG + Intergenic
1140748467 16:78002003-78002025 TGACATTTGATTTCTCCAGGAGG + Intergenic
1140987464 16:80172040-80172062 TAAGCCCTTCTTTCTCCAGCTGG + Intergenic
1141255296 16:82396626-82396648 TGCCCTCTGTTTTCTCCACCAGG - Intergenic
1141589920 16:85061664-85061686 AGAGCTGTGGCTTCTCCAGCAGG - Intronic
1144058590 17:11561770-11561792 AGAGCTCTGATTTTTAGAGCTGG - Exonic
1145242730 17:21249158-21249180 TGACCTCTGCTTTCTCCACTCGG + Intronic
1145398310 17:22512707-22512729 AGGGCTCTGCTTCCTCCAGCAGG + Intergenic
1145993401 17:29092438-29092460 TGAACTCTGACTCCTCCAGCTGG + Exonic
1146413603 17:32611125-32611147 TCTGCTCTGATTTCTCAGGCCGG - Intronic
1146896329 17:36544792-36544814 TGGGCGCAAATTTCTCCAGCGGG + Intergenic
1147326638 17:39672820-39672842 TGTCCTCTGATTCCTTCAGCAGG + Exonic
1148806287 17:50265604-50265626 GGAGCTGTGGTTTCTCCTGCTGG - Intergenic
1149423010 17:56528975-56528997 TCAGCTTTGGTTTCTCCACCAGG - Intergenic
1149477443 17:56974971-56974993 AGAGATCTGATTTCACCAACCGG + Intergenic
1153312412 18:3690139-3690161 TGAGCTGTGATTGCACCAGAGGG - Intronic
1155569571 18:27177061-27177083 TGAGATTTTATTACTCCAGCAGG - Intronic
1155582514 18:27325239-27325261 TCAGCTCTGAAATCTCCAGTTGG - Intergenic
1156909506 18:42394143-42394165 GGAGCTCTGAGTTCCACAGCTGG + Intergenic
1158181032 18:54715022-54715044 TGAGGTCTGTTTCCTCAAGCTGG + Intergenic
1159203135 18:65214709-65214731 TGAGCTTTAATTTCTGCATCCGG + Intergenic
1160425502 18:78776272-78776294 TGAGCTCATCTGTCTCCAGCTGG + Intergenic
1164721965 19:30439015-30439037 TGAGCTCTTATGTCTGCAGCTGG + Intronic
1166551013 19:43666115-43666137 TGAGCTATGATTGCCCCAGCTGG - Intronic
1167572887 19:50300866-50300888 TGAGCTGGGATTTCACCAGCTGG + Intronic
925599969 2:5598286-5598308 AGTGCTCAGATTTCCCCAGCAGG + Intergenic
925746877 2:7051124-7051146 TTTGCTCTGACTTCTCCTGCAGG - Intronic
925926094 2:8671623-8671645 TGAGTCCTGAATTCTCCAGGAGG - Intergenic
927641561 2:24848886-24848908 TGAGCTCTGCTTACTGCAGGTGG + Intronic
929355813 2:41022911-41022933 AGAACACAGATTTCTCCAGCAGG - Intergenic
930245667 2:48980805-48980827 TGGGTTCTGATTTCTTCAGTTGG + Intronic
931776753 2:65547608-65547630 GGAGCTCTCATTTTTCCATCTGG - Intergenic
931927463 2:67088824-67088846 TGAACTCTGATTTCAACAGGAGG + Intergenic
932589955 2:73059288-73059310 TGAGCTCAGCTTTGCCCAGCTGG - Intronic
933235451 2:79859332-79859354 TGAGCTCAGATTTGTTCAGTAGG + Intronic
933317712 2:80735864-80735886 TGACCACTGATGGCTCCAGCTGG + Intergenic
935069679 2:99682918-99682940 TAATCTCAGATGTCTCCAGCAGG - Intronic
935595012 2:104871709-104871731 TGGGCTTTAATTTCTCCAGATGG + Intergenic
937559413 2:123203529-123203551 TGTTCTCTGATTGCTCTAGCTGG + Intergenic
940383706 2:153046043-153046065 TGTGCTCTGATGCTTCCAGCTGG - Intergenic
940560343 2:155287757-155287779 TTACCTCTGTTTTCTCAAGCAGG - Intergenic
944153400 2:196586091-196586113 TGAGCTCTTATTCTTCTAGCAGG + Intronic
945035301 2:205699299-205699321 TGGGCTCTGATTCCTCTGGCTGG + Intronic
945191434 2:207192005-207192027 TGGGCTGTGATGTCTTCAGCTGG - Intergenic
945491996 2:210466859-210466881 TGAACCCAGTTTTCTCCAGCAGG - Intronic
946119327 2:217495727-217495749 TGAGCTCTGGCTTCTGCTGCAGG - Intronic
946292181 2:218753754-218753776 TGAGATCAGCATTCTCCAGCTGG + Intronic
946532837 2:220590981-220591003 TGAGCTATGATTGCACCACCTGG + Intergenic
946955816 2:224929035-224929057 TGAGTTCTGAGTTCTCAAGAAGG - Intronic
1169001673 20:2172473-2172495 TGAGCTCTGGTCTCTTGAGCTGG + Intronic
1169035718 20:2450415-2450437 TGAATTCTGATTTCCCCAGGAGG + Intergenic
1171035769 20:21711661-21711683 TTAGCAATGATTTCTCAAGCTGG + Intronic
1171339848 20:24419365-24419387 GGGGCTCTGGTTTCTCCAGGTGG - Intergenic
1172033492 20:31996890-31996912 TGAGCGCGGCGTTCTCCAGCAGG - Exonic
1173390699 20:42629924-42629946 TCAGCTGTGATTTCTACTGCCGG + Intronic
1174570511 20:51497886-51497908 TGAGCTCTGAGTTCCCCCGGGGG - Intronic
1178350082 21:31866612-31866634 TGATGTGTGCTTTCTCCAGCAGG + Intergenic
1179432116 21:41328943-41328965 TGTGCCCAGTTTTCTCCAGCAGG + Intronic
1181922839 22:26333863-26333885 TGTGCTCTGAATTCTCCACCTGG - Intronic
1182037832 22:27213412-27213434 AGAGCTCAGATTTGTCCTGCTGG - Intergenic
1184286540 22:43474988-43475010 TCAGCTCTGGTCTCACCAGCAGG - Intronic
1184291023 22:43498283-43498305 TGAGGTTCCATTTCTCCAGCAGG - Exonic
1185237294 22:49721552-49721574 TGAGCCCTTAGTTCTCCACCCGG - Intergenic
949726785 3:7057710-7057732 TGAGCCTCCATTTCTCCAGCTGG - Intronic
949841418 3:8324224-8324246 TGAGCTCTGAAGCCTCCAGTTGG - Intergenic
950719856 3:14875189-14875211 TGACTTCAGAATTCTCCAGCTGG + Intronic
951159054 3:19393678-19393700 TCATCTATGATTTCTCAAGCTGG - Intronic
953858554 3:46521871-46521893 GGAGCTCTCATTTCCCCATCAGG - Intronic
955915355 3:63902352-63902374 TGAGCCGTGATTGCACCAGCTGG + Intronic
956119809 3:65955024-65955046 TGGGCTCTGATTTCACAAACAGG - Intronic
956242399 3:67145055-67145077 TCAGCTCTGGTTTCTCTATCAGG - Intergenic
956468053 3:69538019-69538041 TGAGCTATGATTTGCCCAGTTGG - Intronic
958645690 3:96870332-96870354 GGAGCTCTGATTTCTAAAGGCGG + Intronic
959254900 3:103996770-103996792 TGAGCTCTGATGAAGCCAGCTGG + Intergenic
960848386 3:122026133-122026155 TGAAGTCTTAGTTCTCCAGCTGG - Intergenic
961716079 3:128858377-128858399 AGAGCTCAGATTTCTCCCTCTGG + Intergenic
962921919 3:139958037-139958059 TGAGCTCTGACTTCATCTGCAGG - Intronic
966953506 3:184847805-184847827 TCACCTCTGATTTCTCCAGGAGG - Intronic
967294454 3:187951502-187951524 TGAGCTCTATTTTCTTCATCTGG + Intergenic
968554225 4:1239187-1239209 AGAGCCCTTATTTCTCCAGTTGG - Intronic
972456664 4:39262297-39262319 TGAGCTCTGATTGTGCCACCTGG - Intronic
975446866 4:74475459-74475481 TGAGCTATGATTTCTCTATTTGG + Intergenic
976555731 4:86449284-86449306 GAAGCTCTGAGTTCACCAGCAGG + Intronic
976802350 4:89006833-89006855 GAAGCTCTGCTGTCTCCAGCTGG + Intronic
977317480 4:95468539-95468561 TGGGCACAGTTTTCTCCAGCAGG + Intronic
977986019 4:103384538-103384560 TCAAGTCTGATTACTCCAGCTGG - Intergenic
981165116 4:141548836-141548858 TGTTCTCTGATTTCTTCAGAGGG - Intergenic
981170467 4:141616827-141616849 TGAACGCAGTTTTCTCCAGCAGG + Intergenic
983210597 4:164954048-164954070 TGTTCTCTGATTGCTCCTGCAGG - Intergenic
986207906 5:5643613-5643635 TGTGCCCTGATTTTTCCAACTGG - Intergenic
986969100 5:13311246-13311268 TGAGTTCCTAGTTCTCCAGCTGG - Intergenic
987188429 5:15449087-15449109 TGAACTCTGATTTCAGTAGCAGG + Intergenic
987691900 5:21278099-21278121 TAAGCTTTGATTTCCCCAGGTGG - Intergenic
991275162 5:64838632-64838654 TTAGCTCTGCTTTCTCCCTCTGG - Intronic
991748486 5:69771995-69772017 TAAGCTTTGATTTCCCCAGGTGG + Intergenic
991800066 5:70351840-70351862 TAAGCTTTGATTTCCCCAGGTGG + Intergenic
991828534 5:70658199-70658221 TAAGCTTTGATTTCCCCAGGTGG - Intergenic
991892421 5:71351271-71351293 TAAGCTTTGATTTCCCCAGGTGG + Intergenic
992671296 5:79063636-79063658 TGAGCTCTGATTTCTCCAGCAGG + Exonic
993669472 5:90742867-90742889 TGAGCCCTAATTTCTGCAACTGG + Intronic
997940420 5:138152452-138152474 TGAGCTCTTATTTCCAAAGCTGG - Intronic
998051436 5:139039268-139039290 TGTACTCTGATTCCTCCACCAGG - Intronic
999689447 5:154134152-154134174 TGAGCTCTGAGTTTTCCTTCTGG - Intronic
1000133946 5:158326204-158326226 TTAACTCTGGTTTCTCCAGCAGG - Intergenic
1000179557 5:158794763-158794785 TGAGGACTGCTGTCTCCAGCAGG + Intronic
1001110180 5:168889308-168889330 TAAGCTCTGGTACCTCCAGCTGG + Intronic
1003849664 6:10208908-10208930 TGTGCTCTGACCTCCCCAGCTGG + Intronic
1004456460 6:15796288-15796310 GGAGCTCAGAGTCCTCCAGCAGG + Intergenic
1004715191 6:18210058-18210080 TGTGCCCTAATTTCTCCAGAAGG - Intronic
1005338631 6:24822034-24822056 TGAGCTATGATTGCACCACCTGG + Intronic
1006422303 6:33942729-33942751 TGACCTGTGATCTCTGCAGCTGG + Intergenic
1006681065 6:35797117-35797139 TGACCTCTGATGTCTCCACCTGG - Intronic
1007754787 6:44092276-44092298 AGAGCTTTTATTTCTCCAGCAGG - Intergenic
1011097446 6:83682114-83682136 TGGGCTCTCATTCCTGCAGCAGG + Intronic
1011629105 6:89307662-89307684 AGGGCTCTGGTTTCTTCAGCAGG - Intronic
1013504509 6:110786438-110786460 TGGGCACTGTTTTCTCCAGCAGG + Intronic
1014989261 6:128053530-128053552 TGGGCTCTGATTTCCCAAGGTGG + Intronic
1015025608 6:128529184-128529206 AAAGCTCTCATTGCTCCAGCAGG - Intergenic
1017216876 6:151918384-151918406 TGAGCAATGATTTCTCCTGGGGG - Intronic
1017604043 6:156114040-156114062 TTATCTCTGATGTCTCCAGATGG - Intergenic
1018353605 6:162989193-162989215 ACAGCTCTGACTTCTACAGCTGG + Intronic
1018977196 6:168574595-168574617 AGAGCTCGGATTTCTCCTGAAGG + Intronic
1023472830 7:40543212-40543234 TGATCTCTGCTTCCTACAGCAGG - Intronic
1023556512 7:41429136-41429158 TTAGCTCTGAATTATTCAGCTGG + Intergenic
1029534019 7:101145275-101145297 TGAACTCTCAGATCTCCAGCTGG + Intergenic
1029976340 7:104838046-104838068 TAAGCTCTGATTACTGGAGCTGG - Intronic
1030608736 7:111666389-111666411 TGAGATCTGATAGCTCCATCTGG - Intergenic
1030658061 7:112190225-112190247 TCAGCTTTGATTTCTCTAGAGGG - Intronic
1032656236 7:133933416-133933438 TGAGTTCTGATTTCTGCTCCTGG + Intronic
1034222638 7:149458590-149458612 TGAGCTCTGATTTGTCTAGCTGG - Intronic
1035749393 8:1985186-1985208 AGAGCTCTGCCTTCTCCTGCCGG - Intronic
1035771530 8:2151161-2151183 TCATCTCTCATTTCTCCATCTGG + Intronic
1035939979 8:3888559-3888581 TTAGCTCAGCTTTCTCCAGCTGG - Intronic
1036617296 8:10398451-10398473 TGAGCACAGTTTTCTCCTGCAGG + Intronic
1036813274 8:11882400-11882422 TGAGCCTTGATTTCTTCTGCAGG + Intergenic
1037882935 8:22581677-22581699 TGGGCTCTGCTTCCTGCAGCAGG + Intronic
1038329340 8:26595767-26595789 AGAGCTCTCTTCTCTCCAGCCGG + Intronic
1038565982 8:28620396-28620418 AGAGCTCTGAGTTCTTCAGCAGG + Intronic
1039831366 8:41217745-41217767 TGTGCCATGATTTCTCCAGAGGG - Intergenic
1040722566 8:50344313-50344335 TTAGCTCAGAGATCTCCAGCTGG + Intronic
1040996351 8:53406764-53406786 TGAGCTCTGTTTTCATCAGATGG + Intergenic
1041814179 8:61949176-61949198 TGAGCTCTAAGATCTCCATCTGG - Intergenic
1043470534 8:80557986-80558008 TGATCTCTGTTCTCTCCTGCTGG - Intergenic
1044538448 8:93383699-93383721 TGGGGTTTGGTTTCTCCAGCTGG - Intergenic
1045423658 8:102041731-102041753 TGAGCTCAGAATTCTCCACTTGG + Intronic
1045503152 8:102758605-102758627 TGCGCACTCTTTTCTCCAGCTGG - Intergenic
1046094026 8:109537368-109537390 TTTGTTCTGACTTCTCCAGCTGG - Intergenic
1047265958 8:123309478-123309500 TGTGCTCTGATTGCTCCTCCTGG - Intergenic
1050115752 9:2261478-2261500 TGAGTTGGAATTTCTCCAGCTGG - Intergenic
1050364549 9:4862196-4862218 TAAGCAATGTTTTCTCCAGCTGG - Intronic
1055685839 9:78773791-78773813 TGGGCTCTGTTTTCTCATGCTGG - Intergenic
1056247571 9:84711399-84711421 TGAGCTCTGATTTTGCCATTCGG - Intronic
1056710461 9:88988728-88988750 TGTGTGCTGATTTGTCCAGCTGG + Intergenic
1058535902 9:105959755-105959777 TGAGTTGTGATTTCTGGAGCTGG + Intergenic
1058764172 9:108165259-108165281 TGAGCTCTGGCTTCTCATGCTGG + Intergenic
1059644664 9:116252617-116252639 TAAGTTCTGACTTCTACAGCTGG + Intronic
1060605703 9:124912026-124912048 TGATCTCTGCTTTCACCTGCAGG - Exonic
1060828552 9:126700014-126700036 TGAGCCTTGACTTCCCCAGCAGG - Exonic
1061247642 9:129409118-129409140 TGAGCTCCCATGTCTCCACCGGG + Intergenic
1061276684 9:129572767-129572789 TGAGGTCTGTTTACTGCAGCTGG - Intergenic
1061543184 9:131289259-131289281 TGAGCTCTGATTTCCACCGGAGG - Intergenic
1185883743 X:3763400-3763422 TAAACTCTGATTCCTCCAGCTGG - Intergenic
1186065137 X:5755316-5755338 GGAGGTCTGATTATTCCAGCAGG - Intergenic
1186782060 X:12922694-12922716 TGAGCTCTGATTGCTTCAGTTGG + Exonic
1188827829 X:34858191-34858213 TGAGGTCTGATGTCACCAGCTGG - Intergenic
1189270414 X:39747598-39747620 TGAGCACTGAATTCACCAACCGG + Intergenic
1194184112 X:90751087-90751109 TCATCTCTGATTTTTTCAGCAGG - Intergenic
1194395339 X:93376769-93376791 TATGCTCTGATATCTCCAGTTGG + Intergenic
1195626535 X:107009787-107009809 TGAGCTCTGACCTCTCCCCCAGG - Intergenic
1195655354 X:107327094-107327116 TGAGCTCTGACCTCTCCCCCAGG - Intergenic
1197716683 X:129713377-129713399 TGAGCTGTAATTAATCCAGCTGG - Intergenic
1197869066 X:131048838-131048860 TTACCTCTGATTTCTCCTTCTGG - Intergenic
1201291284 Y:12421941-12421963 TGAGCTCTGCTTTCTCCTCTGGG - Intergenic