ID: 992671341

View in Genome Browser
Species Human (GRCh38)
Location 5:79063979-79064001
Sequence CAGAATCATTATATGGAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 220}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992671341 Original CRISPR CAGAATCATTATATGGAATG GGG (reversed) Intronic
901344157 1:8524143-8524165 AAGCAACATTATATGGTATGGGG + Intronic
901522609 1:9796863-9796885 CAGAATGAACAGATGGAATGTGG + Intronic
905305700 1:37016333-37016355 CAGATTCCTTATCTGGAAAGTGG + Intronic
905910380 1:41649386-41649408 CAGAATCATGGTGGGGAATGAGG - Intronic
906869852 1:49466228-49466250 GAGAATCATTTTATAGAATTTGG + Intronic
909940138 1:81602086-81602108 CAGAATCTATATATGGAGAGAGG - Intronic
912503729 1:110141232-110141254 CAGAATCTTTATTTGGAAAATGG - Intergenic
913369793 1:118085384-118085406 CAGAGACATTATCTGGAAAGAGG - Intronic
913453012 1:119005171-119005193 CAGAATCATTCTAAGGAGTTTGG + Intergenic
916317351 1:163464581-163464603 CAGAATCAGGATATAGGATGTGG + Intergenic
917403074 1:174673763-174673785 CAAAATTCTTATATGGACTGGGG + Intronic
917646109 1:177030051-177030073 CAGAATCATAACCTGTAATGAGG - Intronic
918100303 1:181366969-181366991 CAGAATCACAAAATGGAAAGAGG - Intergenic
920175904 1:204101715-204101737 CAGATTCATTGTCTGAAATGGGG - Intronic
920492152 1:206424783-206424805 CAGAAACATTATAAGGAGAGAGG + Intronic
921255618 1:213336530-213336552 TAGAGTCATTATTTGGTATGGGG + Intergenic
922770433 1:228179230-228179252 CAGACACATCACATGGAATGAGG + Exonic
923021653 1:230168923-230168945 CATAATCACTAACTGGAATGTGG - Intronic
924079694 1:240381856-240381878 AGGCAACATTATATGGAATGGGG + Intronic
924655235 1:245968765-245968787 CAGAATTATTAAATGGAATATGG - Intronic
1064837717 10:19553122-19553144 CACATACATTATATGGAATAAGG - Intronic
1064892459 10:20193049-20193071 CAGAATAATTCTAGGGAAGGGGG - Intronic
1067722500 10:48739677-48739699 CAGAGTCATTATCTAAAATGGGG - Intronic
1069096133 10:64262082-64262104 GAGAAACTTTATAAGGAATGGGG + Intergenic
1069227701 10:65964405-65964427 CTGAGTCATTATATAAAATGAGG - Intronic
1070036835 10:72733959-72733981 CAGAAGCTTTAAAGGGAATGTGG + Intronic
1070055746 10:72932977-72932999 CAGACTAATTATAGGGAATTTGG + Exonic
1072362172 10:94670270-94670292 CAGAATCCTTCAATGCAATGAGG - Intergenic
1073785083 10:106880120-106880142 CAGTATCATTATTTGGAACCTGG + Intronic
1075172003 10:120124269-120124291 CAGAACAAGTAAATGGAATGTGG - Intergenic
1076151942 10:128169509-128169531 CAGAATTTTTTAATGGAATGTGG + Intergenic
1078620100 11:12899329-12899351 CAGAAACACAAAATGGAATGGGG - Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078806892 11:14715050-14715072 TACAATCTTTATTTGGAATGAGG - Intronic
1080088741 11:28318151-28318173 CATAAACAATATTTGGAATGTGG - Intronic
1080096665 11:28416483-28416505 CAGAACCTTTACATGGAGTGAGG - Intergenic
1080774735 11:35375202-35375224 AAGTATCATTAAATGTAATGAGG - Intronic
1081800763 11:45857676-45857698 CAGAAGAATTATATTGAAGGAGG + Intronic
1084420648 11:69058919-69058941 AAGAATCCTTATATGAAATTAGG + Intronic
1087705318 11:101483846-101483868 CAGATTCTTTATATGAAATACGG + Intronic
1089094672 11:115909799-115909821 CAGAATCATAGTATCCAATGTGG - Intergenic
1094079810 12:26521482-26521504 CAGATTCATTATATGCAGTCAGG + Intronic
1102386077 12:112511417-112511439 AAGAAGGATTATGTGGAATGAGG - Intergenic
1105414980 13:20203452-20203474 GAGAATTATTATATTTAATGTGG - Intergenic
1106182288 13:27380160-27380182 CACAATCATCAGAAGGAATGTGG - Intergenic
1107313787 13:39109028-39109050 CATAATCATAATATAGAATGGGG + Intergenic
1109624479 13:64957683-64957705 CAGAATGATTTTATTGAAGGGGG - Intergenic
1110854454 13:80280736-80280758 TAGAATCATTATAAGAAATGTGG + Intergenic
1112534453 13:100237703-100237725 CAGTATTATTATATCCAATGAGG - Intronic
1113214981 13:108029414-108029436 GAGAATCATTAAATGGGTTGGGG + Intergenic
1116330082 14:43584901-43584923 TATAATTATTATATGTAATGTGG + Intergenic
1116611268 14:47075185-47075207 CAGACTCATTACATGAATTGGGG - Intronic
1117328409 14:54689591-54689613 CAGAATGATAATATGGCGTGGGG - Intronic
1117780919 14:59230897-59230919 AAGCATTATTATATGGCATGTGG + Intronic
1120360939 14:83501237-83501259 TAGAAGCAGTATATTGAATGAGG + Intergenic
1121116985 14:91350778-91350800 CAGAATTACTCTATGGAATATGG - Intronic
1121132084 14:91456923-91456945 CAGAAACATTACTTGGCATGGGG + Intergenic
1122239270 14:100351305-100351327 TTGAATCATTGTATGGAATGGGG + Intronic
1123509129 15:20978351-20978373 CAGCATCAGTATGTGGAAGGTGG - Intergenic
1123566351 15:21552098-21552120 CAGCATCAGTATGTGGAAGGTGG - Intergenic
1123602615 15:21989384-21989406 CAGCATCAGTATGTGGAAGGTGG - Intergenic
1125642706 15:41244654-41244676 CAGAATAATTATTTGTCATGGGG - Intronic
1126075855 15:44908609-44908631 CAGATTCATTCTTTGGCATGTGG - Intergenic
1126669929 15:51106720-51106742 GAGAATCATTATATATAATTTGG - Intergenic
1126962497 15:54013286-54013308 CAGAATCATTAAATGAACTAAGG + Exonic
1131420993 15:92305227-92305249 AAGAATCGTAATAGGGAATGGGG - Intergenic
1131621929 15:94077785-94077807 CAGGCTCCTTATATGGAAAGCGG + Intergenic
1202974720 15_KI270727v1_random:279186-279208 CAGCATCAGTATGTGGAAGGTGG - Intergenic
1133540631 16:6749485-6749507 CAGTATCCTTATCTGGAAAGTGG - Intronic
1133889983 16:9869647-9869669 CAGTTTCCTTATATGTAATGTGG + Intronic
1135507845 16:23054248-23054270 CAGGATAATTAAATGCAATGTGG + Intergenic
1141236134 16:82218878-82218900 CATAGTCATTATAAAGAATGAGG + Intergenic
1141902978 16:87004868-87004890 CAGCTTCATTATTTGGCATGTGG - Intergenic
1145181525 17:20757138-20757160 TAGAAACATTATATGGAAAATGG + Intergenic
1147357668 17:39910453-39910475 CAGTATCTTTACATGGAAAGTGG - Intronic
1149841414 17:59968088-59968110 TAGAAACATTATATGGAAAATGG + Intronic
1149987129 17:61355764-61355786 CAGACTAATTATTTGGAATGAGG + Intronic
1151446759 17:74171332-74171354 CAGGTTGATTATATGGAAAGGGG + Intergenic
1153157181 18:2163005-2163027 AATAATCATTATATAAAATGTGG + Intergenic
1156203094 18:34856370-34856392 CAGAGTCATTAAATGAAATGAGG - Intronic
1157323824 18:46655139-46655161 CAGCATCATGAGATGAAATGGGG + Intronic
1159213378 18:65359148-65359170 CAGAATTTCTATATGGAAAGAGG - Intergenic
1159235328 18:65663925-65663947 AAGAATCATCATATCTAATGGGG + Intergenic
1159663789 18:71131747-71131769 CAGACTCATTATGTGGAATTGGG + Intergenic
926162333 2:10497896-10497918 CAGGATCATTGCAGGGAATGTGG - Intergenic
927324385 2:21786639-21786661 CAGAAACATAATTTGGAATTTGG + Intergenic
930731112 2:54728882-54728904 CAGAGTCATCATATGGCAAGTGG - Intronic
931710397 2:64985197-64985219 CAGACTCAATAGATGCAATGTGG + Intergenic
932841368 2:75085840-75085862 GAGAATGAGTTTATGGAATGAGG - Intronic
937608797 2:123835405-123835427 CAGAAACATCATATGAAATGAGG + Intergenic
938176588 2:129137933-129137955 CTGAATCATTATATTTAATATGG + Intergenic
942772720 2:179541758-179541780 CAGAATCATTAACTAGAAGGAGG - Intronic
942835576 2:180293136-180293158 CAGAACAATTAAATGTAATGTGG - Intergenic
944068277 2:195642427-195642449 CAGAACCATTTTAAGGATTGGGG + Intronic
944191611 2:197009943-197009965 CAGTATGATTATATGGAATTGGG - Intronic
944299075 2:198101908-198101930 CATAATCATTATCGGGTATGTGG - Intronic
944477479 2:200122367-200122389 CAGAATCAAAAAATGGAATGAGG - Intergenic
944715683 2:202374923-202374945 CAGAACCAGTTTAAGGAATGTGG + Intergenic
945909228 2:215628270-215628292 CACAATAATTAAATGTAATGTGG + Intergenic
946482954 2:220074222-220074244 CAAAAACATTTTAAGGAATGTGG + Intergenic
947104589 2:226655354-226655376 CAGAAGCATGAGCTGGAATGTGG - Intergenic
1169958443 20:11131855-11131877 CAGTATCCTCAGATGGAATGAGG + Intergenic
1174515547 20:51089520-51089542 TGGAATCATTCTGTGGAATGAGG + Intergenic
1174631547 20:51962648-51962670 CAGAATAATAATAGGGGATGGGG + Intergenic
1177209838 21:18057438-18057460 CAGAATGTTGATATGGAATGAGG - Intronic
1177446387 21:21201968-21201990 GAGAATCAGTATCTGGGATGAGG + Intronic
1178287029 21:31334473-31334495 CAGCATCAATATGTGTAATGAGG - Intronic
1178630342 21:34254048-34254070 CACAATAATTAAATGCAATGTGG - Intergenic
1178685147 21:34704860-34704882 CAGAATAATTATATTGCACGGGG - Intronic
1179030989 21:37719183-37719205 CAGAGTCATCACAGGGAATGGGG + Intronic
1179086396 21:38221732-38221754 TTTAATCATTATATTGAATGTGG + Intronic
1181713186 22:24704519-24704541 CATAGTCATTGTATGAAATGTGG + Intergenic
1183990272 22:41593295-41593317 CAGTTTCTTTATATGTAATGAGG + Intergenic
949809773 3:7993777-7993799 TTGAATCATTTTATGGAAAGAGG + Intergenic
953848590 3:46448629-46448651 CAGGATTATTATAAGGAATTTGG - Intronic
954992388 3:54852592-54852614 CAGAATCCATGTTTGGAATGGGG - Intronic
956528822 3:70194192-70194214 TACAATCTTTATATAGAATGAGG - Intergenic
960024581 3:112993821-112993843 GAGAATCATTTTATGAAGTGAGG - Intronic
961520926 3:127467034-127467056 CAGTTTCCTTATCTGGAATGTGG - Intergenic
962192432 3:133325792-133325814 TAAAATCAATATATGGAATATGG + Intronic
962296742 3:134196400-134196422 CAGAATTATTATGTGGGAAGTGG - Intronic
962951178 3:140220391-140220413 CAGGACCATTATTTGGAATTTGG + Intronic
964470482 3:157048330-157048352 TAGAATCATGATCTGCAATGAGG + Intergenic
966237072 3:177713717-177713739 CTGAATCATTAAAGGGAAGGGGG - Intergenic
966356956 3:179090728-179090750 CAGCACCATTTTATTGAATGAGG - Intergenic
968859969 4:3159957-3159979 CATAATCAGTATCTGGTATGTGG - Intronic
971142872 4:23944002-23944024 CATAATGATTAAATGAAATGTGG + Intergenic
971784545 4:31083859-31083881 CAGCATCATTGAATGGACTGGGG - Intronic
974090737 4:57308043-57308065 CAGCATCATGCTAGGGAATGAGG + Intergenic
974118105 4:57605804-57605826 CAGAAAAAATATATGGCATGAGG - Intergenic
975078925 4:70251381-70251403 AAGAATCAAAATATTGAATGTGG - Exonic
975249290 4:72159498-72159520 CATAATCCTTACATGGTATGAGG + Intergenic
975497475 4:75050806-75050828 AAGAGTCAAGATATGGAATGAGG + Intergenic
977436660 4:97005307-97005329 CACAATGATTAAATGCAATGTGG - Intergenic
977760939 4:100736143-100736165 CAGAATAGTTACATGGGATGAGG - Intronic
978588727 4:110301125-110301147 AAGAAGCATTATATAGACTGAGG + Intergenic
978731542 4:112032977-112032999 GAGAAGCTTTATATGGACTGAGG + Intergenic
978996326 4:115158797-115158819 CAGAATGGTAATATGCAATGTGG + Intergenic
979225280 4:118278062-118278084 CATAATGATTAAATGTAATGTGG - Intergenic
979820811 4:125168010-125168032 AAGCATGATTATATGGTATGAGG + Intergenic
980171355 4:129293986-129294008 AAGAATGAATATATGGAGTGTGG + Intergenic
980739703 4:136933214-136933236 GAGATTCAATATATGGCATGAGG + Intergenic
982654077 4:158124150-158124172 CAGAAAAATTATATGAAACGTGG - Intergenic
983082693 4:163406577-163406599 GAGAATCATACTATGGAAAGAGG + Intergenic
983206573 4:164916747-164916769 CAGAATAATTATATTGTATTGGG + Intergenic
983212050 4:164968801-164968823 CAGAATAATTATATTGTATTGGG - Intronic
984089457 4:175353726-175353748 CAGTAACATCATATTGAATGGGG + Intergenic
984457484 4:179988591-179988613 CAGAATCATTTAAAGGTATGTGG - Intergenic
986002827 5:3643435-3643457 CATTGTCATTATATGGACTGTGG + Intergenic
987192653 5:15494632-15494654 CAGAATCAGTGTTTGGTATGCGG + Intergenic
987841185 5:23224553-23224575 CAGATTTATTATATGTAATTTGG - Intergenic
988181818 5:27805309-27805331 AAAAATGATTATAAGGAATGTGG + Intergenic
988335321 5:29900066-29900088 CAGAATCATAAAATGAAATATGG - Intergenic
989991265 5:50769866-50769888 CAGGCTCATTATATAAAATGTGG - Intronic
990492292 5:56314409-56314431 CTGAATCCATATATGGAAAGAGG + Intergenic
992671341 5:79063979-79064001 CAGAATCATTATATGGAATGGGG - Intronic
992863051 5:80931461-80931483 CACACTCATTTTATAGAATGTGG - Intergenic
994493306 5:100476336-100476358 CAGAATCAATATTTGGAAAATGG + Intergenic
997050315 5:130372638-130372660 CAGGGTCATTATAAGGAACGAGG + Intergenic
997275684 5:132586148-132586170 CAGAATCTTAATATGATATGAGG + Intronic
999831829 5:155327541-155327563 CAGAATCAGAATATTGAAAGTGG + Intergenic
1000682314 5:164200576-164200598 CACAATGATTACATGCAATGTGG - Intergenic
1002385688 5:178864922-178864944 CAGAAACATTTTTTTGAATGGGG + Intronic
1002404138 5:179015950-179015972 CACAATAACTAAATGGAATGTGG - Intergenic
1004095162 6:12547010-12547032 CAGAATGATTTTATTCAATGTGG + Intergenic
1006198804 6:32267240-32267262 CAGAGTCATTTTAAGGGATGAGG + Intergenic
1007955931 6:45917908-45917930 CAGAGTAATTATGTGGAGTGAGG - Intronic
1011909362 6:92416544-92416566 CAGAATCTTTCTATTGATTGTGG + Intergenic
1016709942 6:147158353-147158375 CATAATCATTATTTGTTATGTGG + Intergenic
1017098881 6:150830201-150830223 CACAATCATTTTATGAAATTAGG - Intronic
1017342644 6:153343681-153343703 CAGAATCCTCATTTGCAATGAGG + Intergenic
1020561675 7:9735873-9735895 CAGTATCAAAATATGGAAGGGGG + Intergenic
1021159513 7:17254677-17254699 CAGTATCATTATATGAATTTTGG - Intergenic
1022636465 7:32140888-32140910 CAGAATAATTATATGCTAAGTGG + Intronic
1024117877 7:46210148-46210170 CAGATTCATTATGTGCACTGGGG + Intergenic
1024277698 7:47692392-47692414 TAGAATTATTATTTGGAAAGTGG + Intergenic
1024370552 7:48578930-48578952 CAGATTCATTGTCTGGCATGTGG - Intronic
1025269159 7:57492889-57492911 CGGAATCATTGAATGGAATCGGG + Intergenic
1026402056 7:70024131-70024153 CAGAATTATAATGGGGAATGGGG - Intronic
1027471149 7:78575827-78575849 CATAATAATTATATGTAATGTGG + Intronic
1028677654 7:93485279-93485301 CAGAAACATTTTATGGCTTGTGG - Intronic
1029044356 7:97612408-97612430 GAGAATCTGTATATAGAATGAGG - Intergenic
1031766857 7:125789595-125789617 CAGCCTCATTACATGGAATAAGG + Intergenic
1031935181 7:127728767-127728789 CACAAGCAATATATGGAATTAGG - Intronic
1032512906 7:132486312-132486334 CAGAATTATTACAAGGAAAGGGG + Intronic
1032941089 7:136793020-136793042 CAAAATAATTATATGGTTTGTGG - Intergenic
1035343492 7:158181047-158181069 AACCAACATTATATGGAATGGGG - Intronic
1036014972 8:4772848-4772870 CTGAATCATTCCATGAAATGTGG + Intronic
1036817346 8:11912107-11912129 CCCAATGATTATATGGTATGAGG - Intergenic
1037234657 8:16703781-16703803 AAGAATCATTATATGGTTTTGGG - Intergenic
1037414218 8:18631494-18631516 CAGCATTATTCTTTGGAATGAGG - Intronic
1038651351 8:29406732-29406754 CAGAATTATTATGTGGAAGAGGG - Intergenic
1038897947 8:31807765-31807787 CAGAATCAAATTGTGGAATGGGG - Intronic
1039199535 8:35074104-35074126 TAGTATCATTATATGGAAATAGG - Intergenic
1039585200 8:38701335-38701357 CAGAATCATTTTAGGTAAGGTGG - Intergenic
1041396627 8:57398281-57398303 CAGAATCATTTTCTGAAATACGG + Intergenic
1042639773 8:70921037-70921059 CTGATTGAGTATATGGAATGAGG - Intergenic
1043089501 8:75879914-75879936 CAAAACTATTAAATGGAATGGGG + Intergenic
1043390879 8:79790552-79790574 CAGGATCATTATTAGTAATGGGG - Intergenic
1043551821 8:81382255-81382277 CAGTTTCATTCTTTGGAATGTGG + Intergenic
1044107592 8:88230593-88230615 AAGAATCAATATATAGTATGGGG - Intronic
1046560919 8:115836388-115836410 CAGAATTATAATATTTAATGTGG + Intergenic
1048215454 8:132490001-132490023 CAAAAACACTTTATGGAATGAGG - Intergenic
1050715450 9:8519394-8519416 CAGAATCATTGTTTAGAATAAGG - Intronic
1050867539 9:10521865-10521887 CATAATCATTATATGAAATGGGG + Intronic
1051062287 9:13058517-13058539 CAGTTTCTGTATATGGAATGTGG + Intergenic
1051820992 9:21168086-21168108 CTGAGTCCTTAAATGGAATGAGG + Intergenic
1051822853 9:21189008-21189030 CTGAGTCCTTAAATGGAATGAGG + Intergenic
1051824408 9:21203605-21203627 CTGAGTCCTTAAATGGAATGAGG + Intergenic
1051824745 9:21208570-21208592 CTGAGTCCTTAAATGGAATGAGG + Intronic
1051825839 9:21218608-21218630 CTGAGTCTTTAAATGGAATGAGG + Intronic
1052170980 9:25396171-25396193 CAGAATCATTTTCTGTAAAGTGG + Intergenic
1053867873 9:42459039-42459061 CAGATTCCTTATACGGAATATGG + Intergenic
1056010102 9:82320011-82320033 AAGAATCACTACATGGAATAAGG - Intergenic
1056541219 9:87572983-87573005 CAGAATCAGCATCTGGAAGGTGG - Intronic
1057332824 9:94131568-94131590 CAGAATGAATAAATGTAATGTGG + Intergenic
1058060943 9:100495312-100495334 CAGGATCATTATAAAGAATTTGG - Intronic
1059620493 9:115999531-115999553 AAGAATGATTATATGGTGTGAGG + Intergenic
1059887117 9:118758427-118758449 CTGAATCATTCTTTGGAATCTGG + Intergenic
1185723563 X:2401455-2401477 CACAATCATTATAGAAAATGAGG + Intronic
1186680352 X:11867164-11867186 CTGAATCATGATATGAAATCTGG + Intergenic
1186942041 X:14520121-14520143 AAGAGGCATTTTATGGAATGGGG + Intergenic
1187323233 X:18260771-18260793 CAGAATTATTGTATGTAATATGG - Intronic
1187730879 X:22253089-22253111 CAGAACCATAATATGGAAGGAGG - Intergenic
1188251145 X:27896486-27896508 AAGAAGAATTATTTGGAATGAGG + Intergenic
1189348723 X:40261702-40261724 CAGAGTCAATACATGGGATGTGG + Intergenic
1190035781 X:47022447-47022469 CAGGTTCATTATTTGGAATCAGG + Intronic
1191665192 X:63695266-63695288 CAGAAACATAGTATTGAATGGGG - Intronic
1193142102 X:78038280-78038302 CAGAGTCATCATATGGTATTAGG + Intronic
1193958132 X:87888110-87888132 CACAATTATTAAATGCAATGTGG + Intergenic
1194579727 X:95657026-95657048 CAGAGTGATTAAATGGTATGTGG - Intergenic
1195551030 X:106171257-106171279 CATAATCCTTACATGAAATGTGG - Intronic
1197137189 X:123075226-123075248 CAGAATCAATATATTCAATAAGG - Intergenic
1198363051 X:135914831-135914853 CAGAATCAATATGTGAGATGGGG - Intergenic
1199253714 X:145694544-145694566 CAAAATCCTAATATGGAATAGGG - Intergenic