ID: 992674293

View in Genome Browser
Species Human (GRCh38)
Location 5:79090309-79090331
Sequence TGGATTTGAACCCATGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992674288_992674293 17 Left 992674288 5:79090269-79090291 CCTGAGGTCACACAACTAGTAAA 0: 2
1: 17
2: 178
3: 890
4: 2888
Right 992674293 5:79090309-79090331 TGGATTTGAACCCATGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992674293 Original CRISPR TGGATTTGAACCCATGGGGC TGG Intronic
No off target data available for this crispr