ID: 992674518

View in Genome Browser
Species Human (GRCh38)
Location 5:79092333-79092355
Sequence TTGTGGGGATTGAGGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 723
Summary {0: 1, 1: 0, 2: 13, 3: 55, 4: 654}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992674518_992674527 30 Left 992674518 5:79092333-79092355 CCCACCTCCCTCAATCCCCACAA 0: 1
1: 0
2: 13
3: 55
4: 654
Right 992674527 5:79092386-79092408 TCTTCATATGTTATTATAATAGG 0: 1
1: 0
2: 3
3: 28
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992674518 Original CRISPR TTGTGGGGATTGAGGGAGGT GGG (reversed) Intronic
900037383 1:427476-427498 TAGTGGGGGTTGGGAGAGGTGGG + Intergenic
900059013 1:663217-663239 TAGTGGGGGTTGGGAGAGGTGGG + Intergenic
900418644 1:2546240-2546262 GTGTGGGGGGTGAGGGGGGTGGG + Intergenic
900533687 1:3167012-3167034 TTCTGGGGATGGAGGGCAGTTGG - Intronic
901038894 1:6352362-6352384 TTGGAAGGAATGAGGGAGGTGGG - Intronic
901804818 1:11731869-11731891 TTGGGGGGATGCGGGGAGGTGGG - Intergenic
901877590 1:12175662-12175684 GAGTGGGGCTTGAGGGAGCTGGG - Intronic
903184950 1:21623565-21623587 TTCTGGGGCTGGAGGGTGGTGGG - Intronic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903741808 1:25562736-25562758 TTGTGGGTGTGGTGGGAGGTGGG + Intronic
903825908 1:26145724-26145746 ATCTGGTGATTGAAGGAGGTGGG - Intergenic
903976610 1:27154484-27154506 TTCTGGGGGTGGAGGGAGGCTGG + Exonic
904831218 1:33307696-33307718 AGGTGGGGATGGAGTGAGGTTGG - Intronic
904955534 1:34280426-34280448 TTCTGGGAATTGAGGGGTGTAGG + Intergenic
905739311 1:40355850-40355872 TTGGGGGGGCTGAGGCAGGTGGG - Intronic
905928723 1:41771277-41771299 TTTTGGGGGTGGGGGGAGGTGGG - Intronic
906277103 1:44524446-44524468 TTGGGTGGAAGGAGGGAGGTGGG - Intronic
907309412 1:53530730-53530752 CTGTGAGGGCTGAGGGAGGTTGG - Intronic
908682815 1:66681800-66681822 GTGTGGGGAGTGAGGGAGGGAGG - Intronic
909277275 1:73703767-73703789 TTGTGATGATTAAGTGAGGTTGG - Intergenic
909624438 1:77700037-77700059 TGGTGGGGGTTGAGGGATGAGGG + Intronic
909851005 1:80463881-80463903 TTGTAGGGAATGAGGTAGGCAGG + Intergenic
910037672 1:82807564-82807586 TTTTAGGGATTGAGTAAGGTTGG + Intergenic
910503287 1:87919254-87919276 CTGTGGGGAGTAAGGAAGGTAGG + Intergenic
911276418 1:95864977-95864999 TTGTGGGGAGAGAGGAAGGGAGG - Intergenic
911812917 1:102307306-102307328 TTGTGGGGGTCGGGGGAGGGTGG - Intergenic
912863298 1:113234331-113234353 TGGTGGGGATTGAATGAGATAGG - Intergenic
914687209 1:149991217-149991239 TTGTGGGGTTGGTGGGAGGTGGG - Intronic
914929253 1:151915801-151915823 TTGTGGGGATTGATAGAGTGAGG + Intergenic
915121917 1:153634523-153634545 GTGGCGGGATTGATGGAGGTTGG + Intronic
915655126 1:157353027-157353049 CTTGGGGGATTGAGGGAGGAGGG - Intergenic
916859388 1:168786614-168786636 TTGTGGGAATTGTGGTAAGTTGG + Intergenic
917711248 1:177687602-177687624 CTGTGGGAAGTGAGGGAGGTAGG + Intergenic
917711380 1:177688675-177688697 CTGTGGGAAGTGAGGGAGGGTGG + Intergenic
917933252 1:179838972-179838994 GTGTTGGGAGTGGGGGAGGTGGG - Intergenic
918133502 1:181649105-181649127 TTGAGGGTTTTAAGGGAGGTAGG - Intronic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
918450067 1:184649434-184649456 TTGTTGGGTTTGAGTGGGGTGGG - Intergenic
918731411 1:188001834-188001856 TTTTGGGGATTCAGTGAGGGAGG - Intergenic
918914959 1:190623075-190623097 TTGTGGGGGGTGAGGGAGGTGGG + Intergenic
919595745 1:199559991-199560013 GTGGGGGGATGGAGAGAGGTTGG + Intergenic
919910375 1:202107244-202107266 TAGTGGGGATAGGGGAAGGTTGG - Intergenic
920074628 1:203327322-203327344 TCGTGGGGATTGAGGGACGTGGG - Intergenic
920498803 1:206473394-206473416 CAGTGGGCATTGAGGGTGGTGGG + Intronic
922084302 1:222331271-222331293 TTGTGAGGATTAAATGAGGTAGG - Intergenic
922476260 1:225908745-225908767 TTGTGGGGACTGGGGAAGGTTGG + Intronic
922738197 1:228001029-228001051 TTGTAGGCAATGAGGGGGGTAGG - Intergenic
922858880 1:228798502-228798524 TTGGAGGGGTTGAGGGTGGTAGG - Intergenic
923608198 1:235464493-235464515 ATGTGGGAAGTGAGGGAGGGAGG - Intronic
924839588 1:247694877-247694899 TTGTGGGGTTGGGGGGAGGTGGG - Intergenic
1062951679 10:1508221-1508243 TCCTGGGGATGGATGGAGGTCGG - Intronic
1065313855 10:24442699-24442721 TTTTGGGGAATGTGGGAGGAGGG + Intronic
1066092751 10:32041865-32041887 TTGTGAGGCTTGAGGCAGGAGGG - Intronic
1066149596 10:32601484-32601506 TTGTGGGGAGTTTGGGAGTTTGG + Intronic
1066149693 10:32602472-32602494 TTGTGGGGAGTTTGGGAGCTTGG + Intronic
1066391203 10:34978591-34978613 TTGTAGGGATGGAGGGACATGGG + Intergenic
1067061102 10:43078299-43078321 TTGTAAGGAGTGAGGGAGGATGG - Intronic
1067201133 10:44172890-44172912 TTGTGGGGACTGCGGGGGCTTGG + Intergenic
1067471596 10:46541984-46542006 TTGGGGGTATTCAGGGAGATGGG - Intergenic
1068032109 10:51717030-51717052 TTGTCAGGATTGAGGGTGGGAGG + Intronic
1068295502 10:55067220-55067242 TTGTGGGGATGAAGGGAGGTTGG - Intronic
1068777301 10:60881834-60881856 TTGAGGGCATTGAGGGTGTTTGG - Intronic
1069311544 10:67044087-67044109 TTGGGGGGAAAGAGGGAGGAGGG - Intronic
1069592031 10:69648072-69648094 TGGTGGGGAGTGTGGCAGGTGGG + Intergenic
1069917590 10:71797007-71797029 TTGTGGGGATTGGGAGGGTTTGG + Intronic
1069921895 10:71820543-71820565 TGGTGGGGTTAGGGGGAGGTGGG - Intronic
1070444189 10:76478894-76478916 TTGTGGGGTGTGGGGGAGGGGGG + Intronic
1070755259 10:78988050-78988072 GTGTGGGGGTTGAAGGGGGTGGG + Intergenic
1071067263 10:81650741-81650763 TTGTGGGGTTAGAGAGATGTTGG - Intergenic
1071514483 10:86288144-86288166 TTGTGGGGAATGTGGCAGGTGGG - Intronic
1071603498 10:86970266-86970288 TGGTGGGGCTGGAGGGAGGCGGG + Intronic
1071629213 10:87204385-87204407 GGGTGGGGATTGGGGGTGGTGGG + Intergenic
1071755445 10:88533608-88533630 TTGTGAGGATGGAGTGAAGTGGG + Intronic
1072003410 10:91220133-91220155 TTGTGGAGGTTGAGGGTGGGGGG - Exonic
1072482380 10:95821741-95821763 TTCTGGGGATTGAGGTGGATTGG + Intronic
1072800992 10:98392352-98392374 TCGTGGGGATTGAGGGAGCCAGG - Intronic
1073133980 10:101209404-101209426 TTGTGAGGATTAAGTGAGTTAGG - Intergenic
1075216389 10:120539801-120539823 TTGGGAGGAGTGAGGGAGGAAGG + Intronic
1075450189 10:122545830-122545852 TTATGGGAACTTAGGGAGGTTGG - Intergenic
1075656289 10:124163315-124163337 TAATGGGGATGGAGGGAGGGAGG + Intergenic
1075804333 10:125174628-125174650 TGGTGGGGATGGTGGGAGGAGGG - Intergenic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076481901 10:130790244-130790266 ATGTGTGGGTTGAGGGTGGTGGG - Intergenic
1076481908 10:130790296-130790318 ATGTGTGGGTTGAGGGTGGTGGG - Intergenic
1076481921 10:130790400-130790422 ATGTGTGGGTTGAGGGTGGTGGG - Intergenic
1076964109 11:65399-65421 TAGTGGGGGTTGGGAGAGGTGGG + Intergenic
1077283158 11:1754496-1754518 ATGTGGGGATGGAGGGATGGAGG + Intronic
1077428774 11:2503536-2503558 TTGTGGGGTTGGGGGGAGGGGGG + Intronic
1077472211 11:2769391-2769413 TTGGGAGGATGGAGGGAGGCTGG + Intronic
1077906870 11:6541098-6541120 CTGTGTGGAGAGAGGGAGGTGGG + Intronic
1078040378 11:7856110-7856132 TGGTGGGGAGAGAGGGAGGGAGG - Intergenic
1078197309 11:9146696-9146718 TTGTGGGTATGCAGGGAGGGAGG + Intronic
1078228107 11:9411871-9411893 TTCAGGGTATTGAGGGAGGTAGG + Intronic
1078617956 11:12882403-12882425 TTGTGGGGAAGGAGACAGGTAGG - Intronic
1078666358 11:13328938-13328960 CTGTAGGGATTGAAGGAGATTGG + Intronic
1079034312 11:17009021-17009043 TTCTGGGGATTGAGGTACTTTGG - Intronic
1079070310 11:17339496-17339518 TTGTGGGGGTGGGGGGAGGGGGG - Intronic
1079110269 11:17601479-17601501 GTGGGGGGAGTGGGGGAGGTGGG + Intronic
1079803036 11:24895504-24895526 GAGTGGGGAGTGAGGGAGGCAGG - Intronic
1079947474 11:26762072-26762094 ATGTGGGTATTGAGCGGGGTTGG + Intergenic
1080008128 11:27430894-27430916 TTGTGGGGGTTGGGGGAGCTGGG - Intronic
1080617316 11:33955848-33955870 TTGAGGAGATAGTGGGAGGTAGG + Intergenic
1080698648 11:34625013-34625035 CTGTGGTGATTGGGGGTGGTGGG + Intronic
1081662405 11:44896114-44896136 CTGGGTGGATTGAGGGAGGAAGG + Intronic
1081734634 11:45394337-45394359 ATGTGGGGAGTGAGGAAGGCGGG + Intergenic
1083173583 11:60936494-60936516 TTGTGGGGCTGGGGGGAGGTGGG - Exonic
1083674460 11:64317664-64317686 TTGTGGGAGCTGAGGTAGGTAGG + Exonic
1083909564 11:65698176-65698198 TTGAGGGGAGTGAGGGAGGGTGG - Intergenic
1084399738 11:68936719-68936741 TCGTGGGAATTGAGGGAAGGAGG - Exonic
1084453088 11:69251670-69251692 TGGTAGGGACTGAGGGAGGTGGG - Intergenic
1085771319 11:79328604-79328626 GTGTGGGGACCGAGGGAGGCGGG + Intronic
1086245125 11:84742549-84742571 TTGTGGGGACAGAGGTATGTAGG - Intronic
1086971585 11:93086458-93086480 GTGTGGGAATTAAGGGAGATGGG + Intergenic
1087888681 11:103511447-103511469 TTGTGGGGTTGGGGGGAGGGGGG - Intergenic
1087963022 11:104375601-104375623 TTTCTGGGATTGAGGGAGGAAGG + Intergenic
1088818021 11:113434606-113434628 GTGTGGGGATGTGGGGAGGTGGG + Intronic
1089173996 11:116535369-116535391 GGGTGGGGATTGTGGGAGGACGG + Intergenic
1089240495 11:117074331-117074353 TTGTGGGGCTGTAGGGAAGTGGG - Intronic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1089895929 11:121929902-121929924 GTGGGGGGCTTGAGGGAGGGTGG + Intergenic
1090264894 11:125347561-125347583 TTGAGGAGGCTGAGGGAGGTGGG + Intronic
1090373274 11:126271545-126271567 ATGTGGTGATCGTGGGAGGTGGG + Exonic
1092002968 12:5046123-5046145 ATGGGGGGATCGAGGGAGGGAGG - Exonic
1092696272 12:11175192-11175214 TTGGTGGGATTGAGGGATATGGG + Intergenic
1092855767 12:12672387-12672409 TTGTGTGAATGTAGGGAGGTAGG - Intronic
1092913291 12:13167104-13167126 TTATTGGGACTGTGGGAGGTGGG + Intergenic
1094204924 12:27829924-27829946 TAGTGGGCATTGGGTGAGGTTGG + Intergenic
1095288592 12:40447627-40447649 TTCTGGGAATTGAGGGAGTGAGG + Intronic
1095296524 12:40533216-40533238 TTGTGGCTATTGAGAGAGGAGGG - Intronic
1095493826 12:42763773-42763795 TGGATGGGATTGAGGGATGTGGG + Intergenic
1095589351 12:43886779-43886801 TTCTGGGGATGGAGGGTGGGAGG - Intronic
1095975656 12:47939368-47939390 GGGTGGGGCTTGGGGGAGGTGGG - Intronic
1096273655 12:50187239-50187261 TTGTGGTGTGTGTGGGAGGTAGG + Intronic
1096670464 12:53195565-53195587 TTGGGGGAATTGAGAAAGGTTGG + Intronic
1096849921 12:54428814-54428836 TAGTGGGGGTTGTGGGTGGTGGG + Intergenic
1097145366 12:56936053-56936075 GTGGGGGGTGTGAGGGAGGTAGG + Intergenic
1097293921 12:57943060-57943082 TTGTAGAGACTCAGGGAGGTAGG + Intronic
1097298148 12:57989414-57989436 ATGTGGGGATTGAGGGAAAGAGG + Intergenic
1097507125 12:60487989-60488011 AGCTGGGGATTGAGGGTGGTTGG - Intergenic
1098152779 12:67565002-67565024 TGAGGGGGATTGAAGGAGGTAGG - Intergenic
1098177280 12:67805954-67805976 TGGTGGGGAAGGAGGGAGGGAGG - Intergenic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1101741970 12:107507676-107507698 TTGTGGGGATTGTAAGAAGTTGG - Intronic
1101761324 12:107661193-107661215 AGGTGGGGGTGGAGGGAGGTGGG - Intergenic
1102520414 12:113474662-113474684 TTGTGGGGTTTGGGGGAGAATGG - Intergenic
1102738216 12:115182017-115182039 TTGTGGGGAGTTAGGATGGTCGG - Intergenic
1102894523 12:116588003-116588025 TTGTGGGGAGTCAGTGAGGTGGG + Intergenic
1102912562 12:116728760-116728782 CTGTGGGCCTTGAGGGAGTTGGG - Intronic
1103288328 12:119822047-119822069 TTTTGGTGATGGAGGGAGGTTGG - Intronic
1103561659 12:121796051-121796073 TTGTGGTGATGGAGGGGGGCTGG + Intronic
1103605050 12:122079762-122079784 TTGTGGGGATGGAGTGAGATAGG + Intronic
1103699350 12:122840729-122840751 TTGGGGGGACTCAGGCAGGTGGG + Intronic
1104074721 12:125378957-125378979 TGCTGGGGACTGAGGGGGGTGGG - Intronic
1104731754 12:131108989-131109011 AGGTGGGGATGGGGGGAGGTGGG + Intronic
1104968578 12:132520938-132520960 TGGTAGGGACTGTGGGAGGTGGG + Intronic
1105424827 13:20285162-20285184 TTCTGGGGATCGAGGGAAGGAGG + Intergenic
1105649445 13:22358833-22358855 GGGTGGGGAGTGGGGGAGGTGGG - Intergenic
1105818306 13:24057226-24057248 TTGTGGGGTTGGGGGGAGGGGGG - Intronic
1106475952 13:30098322-30098344 ATGAGGGGATTGTTGGAGGTTGG - Intergenic
1106620666 13:31367754-31367776 TTCTGGGGATTGAGGGGAGGAGG + Intergenic
1106656940 13:31756530-31756552 TTGAAGGGAATGAGGGATGTGGG - Intronic
1107404553 13:40100270-40100292 CTGAGGAGATTGAGGGATGTGGG - Intergenic
1107613552 13:42141046-42141068 TTGTGGGGTTGGTGGGAGGGGGG - Intronic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1108052441 13:46459850-46459872 TCTTGGGATTTGAGGGAGGTTGG - Intergenic
1108569765 13:51737778-51737800 TTGTGGGGAATGTTGGTGGTCGG + Intronic
1108703133 13:52960468-52960490 CTGAGGGGTTTGAGGGGGGTGGG + Intergenic
1109447005 13:62454087-62454109 TTGTGGGCATTGAGGGAAAGGGG - Intergenic
1109538832 13:63746251-63746273 TCTTGGGATTTGAGGGAGGTTGG + Intergenic
1109545003 13:63833513-63833535 TCTTGGGATTTGAGGGAGGTTGG - Intergenic
1109737709 13:66508241-66508263 TTGTGGGGATTAGGGGAGGAGGG + Intronic
1110298036 13:73892840-73892862 TTGTGGGAATAGAGGTGGGTAGG + Intronic
1112004950 13:95245881-95245903 TTGTTGGGAATGAGGTGGGTGGG - Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1113865275 13:113517855-113517877 TTGTGGGGAGTGTGGGTGGAGGG + Intronic
1113969107 13:114175203-114175225 TTGTGGGGGATGGGGCAGGTGGG - Intergenic
1114257999 14:21018726-21018748 TTGGGGTGAGTGAGGGAGGAGGG - Intronic
1114683123 14:24503728-24503750 TTGTGGGGTTGGGGGGGGGTAGG + Intronic
1115817293 14:37177056-37177078 TTCTGGAGATTCAGGGACGTTGG - Intergenic
1115955083 14:38768682-38768704 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1117223169 14:53627709-53627731 TGGTGGGGAGTCAGGGAGGGAGG + Intergenic
1117807550 14:59509988-59510010 ATGTGGGGGTAGAGGGAGCTTGG - Intronic
1118279586 14:64416422-64416444 TTTTGGGGGTGGGGGGAGGTGGG - Intronic
1118848324 14:69565182-69565204 TTGTGGGGGCTGGGGGAGGTAGG - Intergenic
1119064638 14:71512967-71512989 TTGAGGGGGTTGGGGGAAGTGGG - Intronic
1120017537 14:79490675-79490697 AAGTGGGGGTTGGGGGAGGTGGG + Intronic
1121132841 14:91464323-91464345 TTTTGGGGGGTGAGGGAGGGGGG - Intronic
1121765010 14:96478735-96478757 TTGTGGGGCTGGGGGGAGGGTGG + Intronic
1121775035 14:96584754-96584776 CTGTGAGGACTGAGGGAGGGTGG + Intergenic
1122122288 14:99561009-99561031 CTGTGGAGACTGAGGGAGGCAGG - Intronic
1122825741 14:104369572-104369594 ATGTGGGGATTGGGGGAGAGGGG + Intergenic
1123207966 14:106731979-106732001 TTGTGGGGGTTGGGGGAGGGGGG - Intergenic
1124797841 15:32799821-32799843 TTGTGAGGCTTGGGGTAGGTGGG - Intronic
1124867509 15:33507634-33507656 TTGAGGGCTTAGAGGGAGGTGGG - Intronic
1126070049 15:44858298-44858320 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1126929889 15:53635687-53635709 TGGGGGGGATGGAGGGAGATGGG + Intronic
1128334619 15:66777980-66778002 TTGGGGGGATGGAAGGAGTTTGG + Intronic
1128856081 15:71016996-71017018 TTGTTGGGCTTGAGGCAGGAGGG + Intronic
1129351769 15:74959462-74959484 ATGCGGGGAGTGAGGGAGGAAGG + Intronic
1129872507 15:78949665-78949687 TTGTGGGGGGTGGGGGAGGGGGG - Intergenic
1129937509 15:79463163-79463185 ATGTGGGCCTTGAGGGAGGCAGG - Exonic
1130368889 15:83266252-83266274 GTGTGGGGAGGGAGGGAGGGAGG + Intronic
1130814279 15:87414526-87414548 TTGTGGGGAATCAGGTGGGTGGG + Intergenic
1131006149 15:88980117-88980139 TTGTGGGGGTTCAGTCAGGTTGG - Intergenic
1131078325 15:89513230-89513252 TTGTAGGGGGTGAGGGAGTTGGG + Intergenic
1131095692 15:89653053-89653075 TTGGAGGGATTGGGGGAGGGTGG + Intronic
1132313086 15:100871200-100871222 TTCTGGGGCTTGAGGAAGGCAGG - Intergenic
1132444442 15:101899784-101899806 TAGTGGGGGTTGGGAGAGGTGGG - Intergenic
1132493604 16:248861-248883 TTTGGGGGACTGAGGCAGGTGGG - Intronic
1132775327 16:1590512-1590534 TTGTGGAGGTTGAGAGAGGGAGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133033572 16:3022819-3022841 TTGTGGGGAAGAAGGAAGGTGGG + Exonic
1134782416 16:16910188-16910210 GTGAGTGGATGGAGGGAGGTAGG + Intergenic
1135583679 16:23650427-23650449 GTGTGGGGAGGGAGGGAGGCAGG - Intronic
1136086827 16:27891090-27891112 TTCTGGGGATGGGGGCAGGTTGG - Intronic
1136369729 16:29828744-29828766 TGGTGGGGACTGTGGTAGGTGGG + Intronic
1136388108 16:29943050-29943072 GTTTGGGCATAGAGGGAGGTGGG + Intronic
1136456979 16:30385653-30385675 TTGTGGGGAGTGAGAGTGGGAGG - Intronic
1137708591 16:50551222-50551244 TTGGGGGAAGTGAGGGAGGGTGG + Intronic
1139308654 16:66009545-66009567 ATGTTGGGATTGTGGGAGTTTGG + Intergenic
1139705852 16:68739855-68739877 TTTGGGAGATTGAGGCAGGTGGG - Intronic
1141490675 16:84370485-84370507 GTGTGAGGAGGGAGGGAGGTGGG + Intronic
1141709610 16:85690166-85690188 CTATGGGGCTTCAGGGAGGTTGG - Intronic
1141831531 16:86512098-86512120 TTGTGGTGACTGAGGCAGGAGGG + Intronic
1142184616 16:88688594-88688616 GGGTGGGGATTGGGGGAGGGCGG + Intergenic
1142626130 17:1193269-1193291 TTGTGGGTATTGAGGGGGAGGGG - Intronic
1143281428 17:5757597-5757619 TTGTGGGGAGGGTGGGAGGAGGG + Intergenic
1143514395 17:7412095-7412117 TTGTGGGGAAAGATGGGGGTCGG - Intronic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144421008 17:15098454-15098476 ATGCGGAGAATGAGGGAGGTGGG - Intergenic
1145261076 17:21355204-21355226 TGATGGGGGTTGAGGGTGGTGGG - Intergenic
1146236271 17:31166692-31166714 TTGTGGGGAGTGGGGGCGGCAGG + Intronic
1146906901 17:36623757-36623779 TTGTTGGGATTGGGGGAGAGTGG + Intergenic
1147218556 17:38914921-38914943 CTGTGGGGCTTGAGCCAGGTTGG + Intronic
1147512876 17:41086900-41086922 TTGTGGGGGTGGGGGGAGGGGGG + Intronic
1148316757 17:46707787-46707809 TTTTGGAGATTGAGGTGGGTGGG + Intronic
1148471977 17:47900104-47900126 TTGTGGTGATTTAGGCAGTTAGG + Intronic
1148583813 17:48762429-48762451 TGGTGGGGATGGGCGGAGGTCGG + Exonic
1148856854 17:50583656-50583678 TGGTGGGGGTGGGGGGAGGTGGG + Intronic
1149893684 17:60412395-60412417 TAGTGGGGAATGGGGGCGGTGGG + Intronic
1149998969 17:61420341-61420363 TTGTTTGTATGGAGGGAGGTGGG - Intergenic
1151147526 17:72054780-72054802 TCTTGGAGATTGAGGGAGGGGGG + Intergenic
1151334638 17:73432647-73432669 AGGTGGGGAGTGAAGGAGGTAGG + Intronic
1152554858 17:81047966-81047988 TTGAGGGGCTGGAGGGAGGTGGG + Intronic
1153009568 18:525760-525782 TTGTGGGGTTTGTGGGAAGTAGG + Intergenic
1153841343 18:9010877-9010899 TGGTGGGGAGGGAGGGAGGGGGG + Intergenic
1154505333 18:15033567-15033589 TTGTGGGGAGTAAAGGAGGATGG - Intergenic
1154966903 18:21367459-21367481 GGGTGGGGAGTGAGGGAGGGTGG + Intronic
1155968538 18:32058758-32058780 TAGTGGGGATTGGGGGAAGTGGG - Intronic
1156261063 18:35445344-35445366 TTGTGGGGAGGGAGGGAGGTGGG + Intronic
1156361312 18:36386841-36386863 TTGGGGGGATTGGAGAAGGTGGG + Intronic
1156426008 18:37013490-37013512 CTGTGGGGAGTGAGGGGGATGGG - Intronic
1156540918 18:37909449-37909471 TTGTGGGGAGAGAAGGAGGAAGG + Intergenic
1156604844 18:38654245-38654267 TTGTGAGGATTGGGGGATGATGG + Intergenic
1156850984 18:41725958-41725980 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1157422260 18:47557013-47557035 TTGCAGGGATTGGGGGAGGAAGG - Intergenic
1157663998 18:49470019-49470041 TGGTGGGTATGGAGGAAGGTAGG - Intergenic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1158243691 18:55406733-55406755 TTGTGGGGATGGGGGGAGGCGGG - Intronic
1159893499 18:73974612-73974634 CTATGTGGATTGAGGTAGGTAGG + Intergenic
1160009795 18:75097928-75097950 CTGTGGGGTTTGGGAGAGGTTGG + Intergenic
1160640912 19:135031-135053 TAGTGGGGGTTGGGAGAGGTGGG + Intergenic
1161113065 19:2480327-2480349 TTGGGAGGCTTGGGGGAGGTGGG + Intergenic
1161308799 19:3582381-3582403 GGGTGGGGAGTGAGGGGGGTTGG - Intergenic
1161483914 19:4524695-4524717 TTTTTGAGATGGAGGGAGGTGGG - Intronic
1162030960 19:7917043-7917065 ATCTGGGGGTTGGGGGAGGTGGG + Intronic
1162396218 19:10419286-10419308 TTGGGGGGGTTGAGGGGGATGGG + Intronic
1162789982 19:13057815-13057837 TTGCGGGGAGGGAGGGAGGAAGG - Intronic
1163382973 19:16980758-16980780 TTCTGGGGCCAGAGGGAGGTTGG + Intronic
1163397090 19:17070012-17070034 CTGTGGGGATTCAGGCAGGGAGG - Intronic
1163452274 19:17385487-17385509 TTCTGGGGATGGAGGGTGATAGG - Intergenic
1163741250 19:19014390-19014412 TTGTGGGGTGTGAGGGTGGAAGG + Intronic
1163741706 19:19018102-19018124 TTGTGGGGTGTGAGGGTGGAAGG - Intronic
1165149782 19:33753763-33753785 GTGTGGGGATGGTGGGTGGTTGG - Intronic
1165149848 19:33753932-33753954 GTGTGGGGATGGTGGGAGGTTGG - Intronic
1165771077 19:38380657-38380679 TTGGGGGGAGGGAGGGAGGGAGG + Intronic
1165774194 19:38395337-38395359 AAGTGGGGATTGAGGGACCTTGG + Intronic
1165843288 19:38802261-38802283 TTGTTGGGTCTGAGGGAGGAGGG + Intronic
1165897701 19:39153196-39153218 TTTTGGGGGTTGGGGGAGGCTGG - Intronic
1166141236 19:40806531-40806553 TGGCAGGGATGGAGGGAGGTAGG - Intronic
1166881151 19:45930845-45930867 TTGGGGGCTTTGAGGGAGCTAGG + Intergenic
1166887261 19:45969624-45969646 TTGGGGGGGTTGACAGAGGTGGG + Intronic
1167034971 19:46989697-46989719 TTGGGCGGATTGAGGGAGAAAGG + Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167348549 19:48961696-48961718 GGGTGGGGATTGGGGGACGTGGG + Exonic
1167456519 19:49599197-49599219 TTTTGGGGGCTGAGGGAGGATGG + Intronic
1167574564 19:50311965-50311987 TGGTGGGGAGTGAGGGTGGGTGG + Intronic
1167668985 19:50838959-50838981 CTGGGGGGTTTGAGGGAGGTAGG + Intergenic
1167669029 19:50839081-50839103 CTGGGGGGTTTAAGGGAGGTGGG + Intergenic
1168456251 19:56511018-56511040 TGGTGGGGATTGAGTGAAGAAGG + Intronic
1168697199 19:58410206-58410228 TTGTAGGTATTGTGGGTGGTGGG + Intronic
925173721 2:1767940-1767962 GGGTGGGGGTAGAGGGAGGTGGG + Intergenic
925178519 2:1801163-1801185 TTGTGGGCATGGAGGGGGTTAGG + Intronic
925521768 2:4754430-4754452 TTGTGGGGGTTGAGGGGGGAAGG + Intergenic
925601186 2:5610234-5610256 TTGTGGGGCTGGAGGCAGGGAGG + Intergenic
927092955 2:19726560-19726582 TTGTGGGCATTCAGGGATATTGG - Intergenic
928365358 2:30696214-30696236 TTGTGAGGATTGAATGAGCTGGG + Intergenic
928768500 2:34676645-34676667 TAGTAGGGATTGAGGTGGGTGGG + Intergenic
929212859 2:39377469-39377491 ATGTGGGTTTTGAGGGAAGTAGG + Intronic
929380883 2:41351986-41352008 TTGTGGGCATTGAGTGATGTAGG - Intergenic
929592206 2:43154700-43154722 GAGTGGGGATGGATGGAGGTTGG + Intergenic
930857032 2:56029937-56029959 ATGTGAGGATTGAGGGAGATGGG + Intergenic
931389961 2:61833054-61833076 TGGTGGGGAATGAGGGAAGGTGG + Intronic
931854620 2:66288965-66288987 TTGGGGGGATTGAGGGGAGATGG - Intergenic
932284492 2:70520804-70520826 TTGTGGAGAGTGGTGGAGGTTGG - Intronic
932478719 2:72025197-72025219 TTGTGAGGCTTTAGGGAGATAGG - Intergenic
932827775 2:74957641-74957663 GTGTGGGGATTCATGGGGGTGGG + Intergenic
935104283 2:100025191-100025213 TTTTGGGGAGTGAGGAAGGAAGG - Intronic
936041358 2:109152307-109152329 TTGTGGGGAATGTGGGTGGGTGG + Intronic
936480072 2:112877763-112877785 TTGTGGGAATTAAAGGAGATGGG - Intergenic
936972695 2:118190075-118190097 TTGTAGGGATTGAGGAATGGGGG + Intergenic
937564143 2:123263005-123263027 CTGTGGGGATTGAAGAAAGTAGG + Intergenic
937658007 2:124398901-124398923 TGGTGATGATGGAGGGAGGTGGG + Intronic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
938265313 2:129923835-129923857 CTGGGGAGATTGAGGCAGGTAGG - Intergenic
939705092 2:145442599-145442621 TTGTGGGGGTGGGGGGAGGGGGG + Intergenic
940409736 2:153347323-153347345 GTGTGGAGATTGTGGGAGGTAGG + Intergenic
940809727 2:158228805-158228827 TTGTGGGGTTGGGGGGAGGGGGG + Intronic
941066289 2:160906737-160906759 ATGTTGGCATTGGGGGAGGTGGG + Intergenic
941469403 2:165865581-165865603 TTGGTGGCATTGTGGGAGGTGGG + Intronic
942315985 2:174696967-174696989 TTGTGGTGTTCGAGGGAGGAAGG - Intergenic
942425977 2:175861284-175861306 TTGTGGGGGTTGAGGGGAGTTGG + Intergenic
942512919 2:176722082-176722104 TTGTGGGGTTGGGGCGAGGTAGG + Intergenic
942745226 2:179224621-179224643 TAGTGGGGGTAGGGGGAGGTTGG - Intronic
944154370 2:196594362-196594384 TTCTGGGGGTTGAGGGTGGGAGG - Intergenic
944426722 2:199591171-199591193 GTGTGTGGGTGGAGGGAGGTTGG - Intergenic
944912246 2:204322300-204322322 TTGGGGGGATAGAGGGAGAAGGG - Intergenic
944955856 2:204807844-204807866 TTGTGGGGGTTGGGGGTAGTGGG + Intronic
945224464 2:207519397-207519419 TTATGGGGAAAGAGGGAGGAAGG - Intergenic
946119855 2:217500500-217500522 TGGTGGGGAGTAATGGAGGTTGG + Intronic
946165926 2:217863829-217863851 GTCTGGGGATAGAGGGAGGAAGG + Intronic
946326183 2:218985671-218985693 GGGTGGGGATAGAGGGAGGGAGG - Intergenic
946497747 2:220213034-220213056 ATGTGGGGATGGAGGGAGAGAGG + Intergenic
947625640 2:231616511-231616533 TTGAGGGGACTGATGGAGGAGGG - Intergenic
948464439 2:238145492-238145514 TTATGGGGATGGAGGGACCTGGG + Intronic
948479629 2:238241267-238241289 TAGTGGGGACTGAGGAAGGCAGG - Intergenic
948688351 2:239685840-239685862 TCGTGGGGTGTCAGGGAGGTGGG + Intergenic
1168897625 20:1334711-1334733 TTGGGGGAGTTGACGGAGGTGGG + Intronic
1168909706 20:1438088-1438110 TAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1168972503 20:1940237-1940259 CTGTGTGGATTCAAGGAGGTTGG + Intronic
1169140872 20:3226949-3226971 TGGTGGCGATGGAGGGAGGTGGG - Intergenic
1169307726 20:4507542-4507564 TTGAGGGGGTGGAGGGAGGGCGG + Intergenic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1169731326 20:8788370-8788392 TTCTGTTGTTTGAGGGAGGTGGG + Intronic
1170100037 20:12688837-12688859 TAGTGGGGATTGAGGAAAGGTGG - Intergenic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1173017526 20:39239013-39239035 TTCTGGGGATGGTGGGGGGTTGG + Intergenic
1174303627 20:49600100-49600122 TTGTGGGGAATGGGGGACGAGGG - Intergenic
1174308986 20:49635762-49635784 GGGTGGGGATTGAGGGTGGAGGG - Exonic
1174357112 20:50005845-50005867 CTGTGGGGACTGAAGGAAGTGGG + Intergenic
1174531854 20:51220520-51220542 GGGTGGGGGTTGGGGGAGGTGGG - Intergenic
1174669645 20:52294417-52294439 TTCTGGGGAGGGAGGGAGTTGGG + Intergenic
1175124611 20:56741957-56741979 TTATGGGGATTGAGGGTGGGTGG + Intergenic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175280334 20:57799953-57799975 TTTTGGGGACTGAGGGAGTGAGG + Intergenic
1176792518 21:13335533-13335555 TTGTGGGGAGTAAAGGAGGATGG + Intergenic
1177991920 21:28046407-28046429 TTGTGGGGAGTAAAGGAGGATGG + Intergenic
1178228760 21:30755902-30755924 TCTTGGGATTTGAGGGAGGTTGG - Intergenic
1178474232 21:32922408-32922430 TTGATGGGATTGAGGGTGGCTGG + Intergenic
1179645866 21:42775749-42775771 ATCTGGGGACTGAGGCAGGTTGG + Intergenic
1179817693 21:43918043-43918065 TTGTGGGGGTTGTGGGTGTTGGG + Intronic
1180186638 21:46143323-46143345 GAGTGGGGAGAGAGGGAGGTGGG - Intronic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1180798744 22:18621400-18621422 TTGTGGGAAGCGAGGGATGTGGG + Intergenic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181222970 22:21373862-21373884 TTGTGGGAAGCGAGGGATGTGGG - Intergenic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181255769 22:21561757-21561779 TTGTGGGAAGCGAGGGATGTGGG + Intronic
1181477286 22:23176606-23176628 GTGTGGGGAATGAGGGATGTTGG - Intergenic
1181900945 22:26155309-26155331 TTCTGAGGAGTGAGGGAGCTGGG - Intergenic
1181967456 22:26666953-26666975 ATGTGGGGAGGGAGGGAGGGAGG + Intergenic
1182264462 22:29102870-29102892 TTCTGGGGATAGAGGGTGGGTGG + Intronic
1182359001 22:29735701-29735723 TTGGGGGCATTCAGGGAGATTGG - Intronic
1182521006 22:30884557-30884579 GTGTGGTGCTTGAGGGAGATGGG + Intronic
1182560087 22:31152862-31152884 GTGTGGAGAGGGAGGGAGGTGGG - Intergenic
1183013813 22:34969666-34969688 TGGCTGGGGTTGAGGGAGGTGGG + Intergenic
1183164046 22:36134111-36134133 TGGTGGGGTCTGACGGAGGTCGG + Intergenic
1183170321 22:36183056-36183078 GGGTGGGGTCTGAGGGAGGTTGG + Intergenic
1183659238 22:39208682-39208704 TTGTGAGGATTAAAGGAGCTAGG - Intergenic
1183791779 22:40077164-40077186 TTGTAGGGGTTGAGGAAGCTGGG - Intronic
1184060841 22:42080000-42080022 TTGTGGGGAGTGCGTGAGGGCGG + Intronic
1184532423 22:45064695-45064717 TTGTGGAAAGTGGGGGAGGTGGG + Intergenic
1184839345 22:47043456-47043478 TTGTGGGGACTGAGCGAGTGAGG + Intronic
949161120 3:883393-883415 ATGTGGGGAATGAGGCAGATGGG - Intergenic
950955072 3:17044226-17044248 TTCTGGAGAGTGAGGGAGGAAGG + Intronic
951019380 3:17765989-17766011 TGGTGGTGATGGAGGGTGGTGGG + Intronic
951291200 3:20874060-20874082 TTGTGGGGTTGGGGGGAGGGGGG - Intergenic
951655337 3:25001105-25001127 GTGTGAGGATGGAGGGAGGGAGG + Intergenic
952926854 3:38326607-38326629 TTGTGGGGAGTGAGGGAGGCAGG - Intergenic
953063354 3:39446642-39446664 TTTTGGGGAATGTGGGAGGTGGG + Intergenic
953668763 3:44945105-44945127 TGGCGGGGATGGAGGGAGGCAGG + Intronic
954436510 3:50499083-50499105 TTGCAGGGAGTGAGGGAGGGAGG + Intronic
954763800 3:52896900-52896922 CACTGGGGATTGAGGGATGTGGG + Intronic
955095737 3:55796067-55796089 TTGTGGTGGTTGAGGGGGGAGGG + Intronic
955163498 3:56488066-56488088 TAGTGGGAATTGAGGCAGGAGGG - Intergenic
955371372 3:58354873-58354895 TTTTGGAGACTGAGGCAGGTGGG + Intronic
955399205 3:58579258-58579280 ATCTTGGGAGTGAGGGAGGTGGG + Intronic
956538689 3:70309070-70309092 TAAGGGGGAGTGAGGGAGGTTGG + Intergenic
957345801 3:78959935-78959957 TTTTGGGGAGTGGGGGAGGGTGG + Intronic
957646765 3:82939971-82939993 TTGGGGGGGTGGGGGGAGGTTGG - Intergenic
958491025 3:94773571-94773593 TTGTGTGTATTTAGGTAGGTTGG + Intergenic
959513429 3:107240161-107240183 TTGGGGGGGTTGAGGGGGGGAGG - Intergenic
959991761 3:112638858-112638880 CTCTGGGGGTTGAGGGAGGTTGG + Exonic
960384619 3:117007163-117007185 TTGTGGGGGTGGAGGGAGGGAGG - Intronic
961221516 3:125204584-125204606 TTGGGGGGATGAAGAGAGGTTGG + Intronic
961454753 3:127018370-127018392 TTGTGGGCATTGGCGGAGGCGGG + Exonic
961636189 3:128334727-128334749 TTCTGGGGAAGGAGGGAGGGAGG - Intronic
962932886 3:140053817-140053839 TTGTGGAGATGGAGTGAGATGGG + Intronic
963759595 3:149273850-149273872 TAAAGGGGATTTAGGGAGGTAGG - Intergenic
964284819 3:155106656-155106678 TTGGGGGGATGGTGGGAGGAGGG + Intronic
965355620 3:167669493-167669515 TTGGGAGGATGGAGGGAGGAGGG + Intergenic
965373768 3:167896301-167896323 TTGTTGTGATGGAGAGAGGTGGG + Intergenic
965404535 3:168252845-168252867 TGGTGGGTATGGAGAGAGGTTGG + Intergenic
965574757 3:170206659-170206681 TAGTGGGGATTGAGTTAGGGTGG + Intergenic
965668313 3:171119794-171119816 TTGTGGGGTTGGGGGGAGGGAGG + Intronic
966018279 3:175171923-175171945 TTGGGGGGATAAAGAGAGGTTGG + Intronic
968519438 4:1029002-1029024 GGGTGGGGCTTGTGGGAGGTGGG + Intergenic
968808319 4:2788822-2788844 GAGTGGGGATTGGGGGAGGTAGG + Intergenic
968876398 4:3269935-3269957 TTTTGGAAAATGAGGGAGGTGGG - Intronic
968905791 4:3449956-3449978 CTGTGGGGGCTGAGGGAGGGAGG + Intergenic
969436982 4:7194008-7194030 TTGTGGGGGTGGGGGGAAGTGGG - Intronic
969699703 4:8761437-8761459 TTGTGGGGCTCCAGGGAGGGTGG - Intergenic
970539972 4:17067862-17067884 GGGTAGGGAATGAGGGAGGTAGG - Intergenic
970558451 4:17259269-17259291 TTGTGGGGGTGGGGGGAGGGGGG - Intergenic
971537553 4:27772526-27772548 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
973532435 4:51846145-51846167 TTTGGGGAATGGAGGGAGGTGGG - Intronic
973704991 4:53572286-53572308 TTCTGGGGAATGAGGGAGGTAGG + Intronic
974646832 4:64705172-64705194 TTGTGGGGTGTGAGGGGGGAGGG + Intergenic
974859551 4:67502993-67503015 TTGAAGGGATGGAGGAAGGTTGG - Intronic
975808014 4:78133380-78133402 TAGTGGGGTGGGAGGGAGGTAGG + Intronic
975842250 4:78487404-78487426 GTTTGGGGATTGGGGGACGTGGG - Intronic
975985402 4:80197560-80197582 TTGGGGGGGTGGAGGGAGGGAGG - Intronic
976178666 4:82379032-82379054 ATGTGGGGGGTGAGGGAGGGGGG - Intergenic
976484861 4:85590244-85590266 ATGGAGGGATGGAGGGAGGTGGG - Intronic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
977148693 4:93480890-93480912 CTGTAGAGATTCAGGGAGGTGGG - Intronic
977969887 4:103200950-103200972 TTGTGGCAATGGAGAGAGGTAGG + Intergenic
978829387 4:113066179-113066201 TTGTGGGGCTGGGGGGAGGAGGG - Intronic
979719920 4:123886942-123886964 TTGAGAGGATTGGGGGAGGTAGG + Intergenic
981626635 4:146763988-146764010 ATGTGAGAATTGAGTGAGGTAGG - Intronic
982448009 4:155517233-155517255 TTTGGGAGATTGAGGCAGGTGGG - Intergenic
982545685 4:156730117-156730139 TTGATGGGAATGAGGAAGGTGGG - Intergenic
983604270 4:169568225-169568247 TTGTGGGGGTAGAGAGAGATGGG - Intronic
983851984 4:172592408-172592430 GTGTGGGGATGGTGGGAGGTAGG - Intronic
984707913 4:182861311-182861333 TTGTGGGGGTTGGGGGGGTTGGG + Intergenic
985521367 5:375390-375412 CAGTGGGGAGTGAGGGTGGTGGG + Intronic
985968001 5:3352258-3352280 GTGTGTGGGTTGAGGGAGGGGGG + Intergenic
986723696 5:10578536-10578558 TTGGGGGGATTTTGGGAGATAGG + Intronic
987017360 5:13834595-13834617 ATTTGGAGATTGCGGGAGGTCGG + Intronic
988698067 5:33644001-33644023 TTATGGGGATAAAGGAAGGTTGG + Intronic
988820010 5:34873712-34873734 TTGTGGGTATCCAGGGATGTGGG - Intronic
990461055 5:56031478-56031500 TGGTGAGGATTAAGAGAGGTTGG + Intergenic
991021812 5:61987248-61987270 CTGTGGGGATTGAGGGAGATTGG + Intergenic
991661201 5:68952390-68952412 CTGTGGGGATTGAGAGAGCCTGG - Intergenic
992142040 5:73808246-73808268 TGCTGGGGGTTGGGGGAGGTAGG + Intronic
992240568 5:74765557-74765579 TTCGGGGGATTGAGGGACGGCGG + Intronic
992512374 5:77450200-77450222 TGGAGGTGATTGAGGGATGTGGG - Intronic
992674518 5:79092333-79092355 TTGTGGGGATTGAGGGAGGTGGG - Intronic
992874072 5:81034796-81034818 TTGTGGGGTGGGAGGGGGGTAGG + Intronic
992970290 5:82049395-82049417 TTGTGGGGGTGGGGGGAGGGGGG + Intronic
993845383 5:92935984-92936006 TCCTGGGTATGGAGGGAGGTAGG + Intergenic
994180961 5:96765531-96765553 CTGAGGGGATTCTGGGAGGTAGG + Intronic
994188512 5:96841536-96841558 TTGTGGGCATTGTGGGGGGGTGG - Intronic
995717939 5:115098715-115098737 TGGTAGGGAATGAGGGAGGATGG + Intergenic
996032456 5:118721226-118721248 TTGGGGGGAAGGAGGGAGGGGGG + Intergenic
996081816 5:119265912-119265934 TTGTGGGGATCAAGGGTGGGAGG + Intergenic
997417060 5:133737236-133737258 GTGGGGGGATTAGGGGAGGTGGG - Intergenic
997598914 5:135126232-135126254 TTGGGGGAATTCAGGGAGTTGGG + Intronic
997621924 5:135304676-135304698 TTGGGGAGATTGAGGGAGGGAGG + Intronic
997778891 5:136637299-136637321 TTTTTGGGATTGTTGGAGGTGGG + Intergenic
998458029 5:142288847-142288869 TTGTGGAGAAGGAGGGAGGCTGG - Intergenic
999187725 5:149725159-149725181 TTGTGTTGAATGAGGGAGGGAGG - Intergenic
999652167 5:153778117-153778139 AGGTTGGGAGTGAGGGAGGTTGG + Intronic
1000646179 5:163762963-163762985 TTGTGGAGAGAGAGGGAGGAGGG + Intergenic
1001791116 5:174458648-174458670 GTGTGGGGAGGTAGGGAGGTGGG - Intergenic
1002647827 5:180669909-180669931 TTGTGGGGATGGAATGAGGTTGG - Intergenic
1002736438 5:181391390-181391412 TAGTGGGGGTTGGGAGAGGTGGG - Intergenic
1002748259 6:83434-83456 TAGTGGGGGTTGGGAGAGGTGGG + Intergenic
1002937796 6:1688174-1688196 TTGTGGGGTGTGAGAGAGGGAGG + Intronic
1003122437 6:3329158-3329180 TTGTGGGGGATGAGGGAGGTGGG - Intronic
1003693986 6:8383864-8383886 TGGTGGGGGGTGAGCGAGGTGGG - Intergenic
1003860669 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG + Intergenic
1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG + Intergenic
1003860777 6:10319750-10319772 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003860787 6:10319780-10319802 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003867138 6:10373455-10373477 TTGGGGGGTTTCAGGGAAGTGGG + Intergenic
1004031596 6:11875488-11875510 TTGTGGGCTTGGAGGGAGGGCGG - Intergenic
1004852634 6:19715822-19715844 TTGTGGGAATTGAAGGATGGGGG + Intergenic
1005111359 6:22285352-22285374 TTGGGGGGGTGGGGGGAGGTTGG + Intergenic
1005602687 6:27443778-27443800 AAGTGGGGGTGGAGGGAGGTGGG - Intergenic
1006982840 6:38159475-38159497 TCGTGAGGAGTGAGTGAGGTTGG + Intergenic
1007004090 6:38343585-38343607 TTGTGGTGATGGAGGGTTGTGGG - Intronic
1007175167 6:39891463-39891485 TGGTGGGGATTCAAGCAGGTGGG + Intronic
1007515813 6:42410633-42410655 ATGTGGTGATGGAGGGAGGGGGG - Intronic
1007786025 6:44279832-44279854 TGGTGGGGAGTCAGGGAGGCAGG + Exonic
1009522797 6:64705824-64705846 TTGTGGGGTGGGAGGGAGGGGGG + Intronic
1010434189 6:75811111-75811133 TGGTGGGGATTGGGGTAGGGGGG + Intronic
1011426325 6:87235408-87235430 TGGGGGGGATTGGGGGAGGTGGG + Intronic
1011749964 6:90445616-90445638 GTGTAAGGATTCAGGGAGGTGGG - Intergenic
1012082178 6:94773866-94773888 TTGTGGGCATGGTAGGAGGTGGG - Intergenic
1012529275 6:100214596-100214618 GTGGGGGGATTGAGTGAGGTTGG + Intergenic
1013458711 6:110356199-110356221 TTTGGGGGATTGAGGCGGGTGGG + Intronic
1014054477 6:116997825-116997847 TGGAGGGGAAAGAGGGAGGTAGG - Intergenic
1015743243 6:136481629-136481651 TGGTGGGGATGGAGGGAGTAGGG + Intronic
1016542052 6:145177587-145177609 TAGTGGGGGTAGAGGGAGGTGGG + Intergenic
1016710861 6:147170436-147170458 ATGTGGGGGTTGGAGGAGGTGGG - Intergenic
1016741320 6:147532299-147532321 CTTTGGGGACTCAGGGAGGTGGG - Intronic
1017689257 6:156946685-156946707 TTGTTGGAATAGAGGGAGGGAGG + Intronic
1018118104 6:160607610-160607632 ATGTGAGGATAGAGAGAGGTTGG - Intronic
1018412111 6:163560487-163560509 TTGTGGGGATGGGGATAGGTAGG + Intronic
1019044943 6:169138506-169138528 GTGTGCGGGGTGAGGGAGGTAGG + Intergenic
1019103571 6:169650737-169650759 TGGTGGGGATGGAGGGATGGAGG - Intronic
1019241536 6:170666919-170666941 TAGTGGGGGTTGGGAGAGGTGGG - Intergenic
1020023972 7:4885497-4885519 ATGTGGGGACTGTGGGAGATGGG - Intergenic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1021104272 7:16618573-16618595 TTGGGGGGATTCGGGGAGGTGGG + Intronic
1021486632 7:21175331-21175353 GTGTGGGTCTTGAGAGAGGTGGG - Intergenic
1021545815 7:21812050-21812072 TTGGGGGAATTGGGGGAGGAAGG - Intronic
1022118900 7:27287714-27287736 GGGTGGGGGTTGGGGGAGGTAGG + Intergenic
1023965422 7:44961309-44961331 TTGAGGGGGTTGAGGGGGCTGGG + Intergenic
1023965509 7:44961547-44961569 TTGAGGGGGTTGAGGGGGCTGGG + Intergenic
1024163853 7:46709963-46709985 TTTTGGGGACTGAGGTAGGGTGG - Intronic
1024608282 7:51040695-51040717 TGGTGGGGAGGGAGGGAGTTCGG - Intronic
1024618818 7:51139532-51139554 TTGGGAGCATTGTGGGAGGTGGG - Intronic
1026011888 7:66642829-66642851 TGGCAGGGGTTGAGGGAGGTGGG + Exonic
1026740853 7:72977407-72977429 TTGTGGAGCATGAGGGAGCTAGG + Intergenic
1026798154 7:73378901-73378923 TTGTGGAGCATGAGGGAGCTAGG + Intergenic
1027102880 7:75387667-75387689 TTGTGGAGCATGAGGGAGCTAGG - Intergenic
1027113220 7:75457379-75457401 TTGTGGGGGTTGGGGGATGAAGG - Intronic
1027285470 7:76641974-76641996 TTGTGGGGGTTGGGGGATGAAGG - Intergenic
1028243782 7:88451926-88451948 ATGAGGGGAGGGAGGGAGGTGGG - Intergenic
1028399625 7:90410703-90410725 TTGTGGGGGTGGAAGGAGGAGGG + Intronic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028531264 7:91841275-91841297 TGCTGGGGATGGAGGGAGGTGGG - Intronic
1030149663 7:106390954-106390976 TTGGGGGGATAAAGGGAGATTGG + Intergenic
1030183628 7:106737175-106737197 TTGTGGGGAGTGGGGGAGAGTGG - Intergenic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032236909 7:130132552-130132574 TTCTGGGGAGTGAGGAATGTGGG + Exonic
1032266667 7:130374486-130374508 TTTGGGGAATTGAGAGAGGTGGG - Intergenic
1034366680 7:150555753-150555775 TTGAGGGGCTTGATGGAGGATGG - Intergenic
1034429385 7:151033673-151033695 TAGGGGGGCTCGAGGGAGGTGGG - Exonic
1034778388 7:153853392-153853414 TTCTGGGGCTTGAGGCAGGATGG + Intergenic
1035017243 7:155777389-155777411 TTGTGGGTATTGAGTGAGGTCGG - Exonic
1035415927 7:158685988-158686010 ATGTGTGGTTTGTGGGAGGTAGG - Intronic
1035506580 8:141177-141199 TAGTGGGGGTTGGGAGAGGTGGG + Intergenic
1035937045 8:3852537-3852559 TGTTAGGGATTGAGGAAGGTGGG + Intronic
1036206061 8:6806383-6806405 GGGTGGGGATGGAGGGTGGTTGG + Intergenic
1036213764 8:6863150-6863172 TGGTGGGGAGTGGGGGAGGCTGG + Intergenic
1036259984 8:7231813-7231835 TTGTGGGGAGTGTGTGAGGCTGG - Intergenic
1036312027 8:7690382-7690404 TTGTGGGGAGTGTGTGAGGCTGG - Intergenic
1036899512 8:12660233-12660255 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1036900576 8:12666380-12666402 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1037152424 8:15654184-15654206 ATGTGGGGAGTGAGGAAGATGGG + Intronic
1037255931 8:16953556-16953578 GTGTGGGGATGAAAGGAGGTGGG + Intergenic
1037301114 8:17452969-17452991 TGGTGGGAAGTCAGGGAGGTGGG + Intergenic
1037731032 8:21524207-21524229 ATGTGGGGATTGATGGGGCTTGG - Intergenic
1037765656 8:21770797-21770819 TTGTGGGGCTAGAGAGAAGTGGG - Intronic
1037856376 8:22374183-22374205 TGGTGGGGTTGGGGGGAGGTTGG + Intronic
1038052931 8:23830387-23830409 TTTTGGGGACTGAGGGAGAAAGG - Intergenic
1038692264 8:29774177-29774199 CTGTGGGCATTGGGGGAGGGAGG - Intergenic
1039116873 8:34101000-34101022 TGGTGGGGGTAGGGGGAGGTAGG - Intergenic
1040880400 8:52198923-52198945 TGGTGGGGCTGGAAGGAGGTGGG - Intronic
1040921419 8:52624016-52624038 TTGAGGGGTTGGAGGGATGTGGG + Intronic
1041244547 8:55878277-55878299 TTGTGAGGAGTTAGGGAGTTGGG + Intergenic
1041359127 8:57031907-57031929 TTGTGGGGATTGTGGGAGTGGGG + Intergenic
1042491272 8:69401253-69401275 ATCTGGGGAATGAGGGAGGTGGG + Intergenic
1042542236 8:69918922-69918944 TTGTGGGGGTTTGGGGCGGTGGG + Intergenic
1043510156 8:80943162-80943184 TTGTGGGATGTGAGGGAGGGAGG - Intergenic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1044645847 8:94442243-94442265 AGGTGGGGATTAAGAGAGGTTGG + Intronic
1044780062 8:95734675-95734697 TTGCAGGGACTGGGGGAGGTGGG + Intergenic
1045154995 8:99458061-99458083 TTGTGGGGTTGGGGGGAGGGGGG - Intronic
1045519822 8:102894108-102894130 GTGTGGGGGTTGGGGAAGGTAGG - Intronic
1046046959 8:108976075-108976097 TTGGAGGTATTGAGGGTGGTGGG - Intergenic
1046791449 8:118326601-118326623 TTGGGGGGCTAGAGGGAGGATGG - Intronic
1047125730 8:121958341-121958363 TTGTTGTGATTGAGGGATCTCGG + Intergenic
1047291576 8:123535754-123535776 TTGTGGGGGTTGAGGGAGTTAGG - Intronic
1047333493 8:123914526-123914548 TTGTGGGGATTGGGGGTTGGGGG - Intronic
1047345424 8:124023421-124023443 CTGTGGGAATAGAGGGAGTTGGG - Intronic
1047347293 8:124040522-124040544 TTGTGAGTATTAAGGGAGATGGG + Intronic
1047613753 8:126545769-126545791 TTGTGGGGAGAGGGGGAGGAGGG + Intergenic
1047958487 8:129993904-129993926 GTGGGAGAATTGAGGGAGGTAGG - Intronic
1048170568 8:132102374-132102396 TTCTGGGGTTAGAGGTAGGTGGG + Intronic
1048695800 8:137026389-137026411 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1048890207 8:138940464-138940486 GTGGGGGGATTGGGGGAGGTGGG - Intergenic
1049055521 8:140233603-140233625 TGGTGGGGAGAGAGGGAGGGAGG - Intronic
1049097844 8:140559285-140559307 TTGTGCGCATTTGGGGAGGTGGG - Intronic
1049159486 8:141088071-141088093 GTGTGGGCCTTGCGGGAGGTTGG - Intergenic
1049321153 8:141997086-141997108 TTGTCGGGCCTGAGGGAGGGAGG + Intergenic
1049471009 8:142775000-142775022 GTGTGGTGGTTGGGGGAGGTCGG + Intronic
1049577384 8:143396009-143396031 GTGTGGGGAGTTAGGGAGGAGGG + Intergenic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1051330856 9:16023834-16023856 TTGTGGGGGTGGGGGGAGGGTGG - Intronic
1052234614 9:26195021-26195043 TTGTAGGGGTTGTGGGAGGGAGG - Intergenic
1052711874 9:32066930-32066952 TGTTGGGGGTTGGGGGAGGTTGG + Intergenic
1053010234 9:34628798-34628820 TCGCGGGGATGGAGGGCGGTGGG + Intergenic
1054703969 9:68444203-68444225 TGGTGGGCATTGAGGGAGACTGG + Intronic
1055575169 9:77653947-77653969 TGGTGGGGATATAGGGAGATGGG - Intergenic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1056201981 9:84285759-84285781 TTGTGGGGAAGGAGGGGGATAGG + Intronic
1056628540 9:88274032-88274054 GGGTGGGGATGGAGGGAGGCTGG + Intergenic
1056742260 9:89267622-89267644 TTGTGGGGGGTGGGGGGGGTTGG + Intergenic
1057250864 9:93500515-93500537 TTGTGGGGAGTGACGGGGGAAGG - Intronic
1057813750 9:98278908-98278930 GTGTGGGCACTGAGGAAGGTTGG - Intergenic
1057931293 9:99195872-99195894 TAGAGGGGATTAAGGGAAGTAGG - Intergenic
1060193307 9:121606721-121606743 CAGTGGGGGGTGAGGGAGGTGGG + Intronic
1061164724 9:128915776-128915798 TAGTGGGGATCGAGGCAGGCAGG + Intronic
1061543822 9:131292218-131292240 CTGTTGGGATTTAGAGAGGTAGG + Intronic
1061680771 9:132241509-132241531 TTGCGGGGACAGAGGGAGGGAGG + Intronic
1061973618 9:134057525-134057547 TTGTGGGGATTGTGGGGTCTCGG - Intronic
1062036606 9:134385321-134385343 TTGTGTGGCTGGAGGGAGGCTGG + Intronic
1062588704 9:137263429-137263451 TTGGGGGGAAGGAGGGAGGGAGG - Intronic
1203601728 Un_KI270748v1:16153-16175 TAGTGGGGGTTGGGAGAGGTGGG - Intergenic
1185430808 X:10674-10696 CTGTGGGGATTTAGGGACTTGGG + Intergenic
1185440074 X:223071-223093 CTGTGGGGATTTAGGGACTTGGG + Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186137024 X:6532789-6532811 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137045 X:6532848-6532870 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137056 X:6532878-6532900 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137068 X:6532911-6532933 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137087 X:6532970-6532992 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137106 X:6533029-6533051 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137118 X:6533062-6533084 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137129 X:6533092-6533114 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137141 X:6533125-6533147 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137152 X:6533155-6533177 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137164 X:6533188-6533210 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137176 X:6533221-6533243 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137187 X:6533251-6533273 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137198 X:6533281-6533303 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137218 X:6533343-6533365 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137240 X:6533405-6533427 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137252 X:6533438-6533460 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137263 X:6533468-6533490 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137275 X:6533501-6533523 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137287 X:6533534-6533556 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137303 X:6533571-6533593 TGGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186267141 X:7844168-7844190 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267155 X:7844205-7844227 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267177 X:7844267-7844289 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267199 X:7844329-7844351 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267211 X:7844362-7844384 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267222 X:7844392-7844414 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267234 X:7844425-7844447 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267245 X:7844455-7844477 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297738 X:8169171-8169193 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297750 X:8169204-8169226 GTGTGGGGAGGGAGGGAGGGGGG - Intergenic
1186297764 X:8169237-8169259 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297776 X:8169270-8169292 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297788 X:8169303-8169325 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297800 X:8169336-8169358 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297812 X:8169369-8169391 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297824 X:8169402-8169424 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297836 X:8169435-8169457 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297858 X:8169497-8169519 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297870 X:8169530-8169552 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297882 X:8169563-8169585 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297904 X:8169625-8169647 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297926 X:8169687-8169709 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297940 X:8169724-8169746 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297952 X:8169757-8169779 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297964 X:8169790-8169812 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297978 X:8169827-8169849 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186298004 X:8169897-8169919 TGGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186324846 X:8466535-8466557 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324882 X:8466630-8466652 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324955 X:8466838-8466860 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324967 X:8466871-8466893 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324978 X:8466901-8466923 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324989 X:8466931-8466953 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325001 X:8466964-8466986 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325014 X:8466997-8467019 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325036 X:8467059-8467081 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325117 X:8467296-8467318 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186426239 X:9465692-9465714 TTGCGGGGAGAGACGGAGGTCGG + Intronic
1187049256 X:15679817-15679839 TGGTGGGGGTTGGGGTAGGTGGG - Intergenic
1188171862 X:26937651-26937673 TTGTTTGGATTGAGGGATGGAGG - Intergenic
1188287239 X:28342790-28342812 GTGTGGGGTTGGAGGTAGGTGGG - Intergenic
1188440988 X:30215315-30215337 CAGTGGGGGCTGAGGGAGGTGGG + Intergenic
1188862212 X:35271336-35271358 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1189323144 X:40098052-40098074 CTGTTGGGAGGGAGGGAGGTAGG - Intronic
1189984892 X:46545240-46545262 TTGTGGGGATTGAGTGACACAGG - Intronic
1190060310 X:47206571-47206593 TGGTGGGAAGTGAGGGAGGGAGG - Intronic
1190328057 X:49218774-49218796 TGGTGGGGGTTGGGGGAGGTGGG + Intronic
1190473426 X:50805474-50805496 CTGTGAGGAATGCGGGAGGTGGG - Intronic
1191090456 X:56615645-56615667 TTCTGGGGATTCAGGGTTGTGGG - Intergenic
1192460583 X:71313618-71313640 TTGGGAAGATTGAGGAAGGTAGG + Intergenic
1193137071 X:77984096-77984118 ATGTGGGGAATGAGGAAGGTGGG + Intronic
1193356518 X:80525412-80525434 TTGAGGGGTTTGAGGGATGAGGG - Intergenic
1193454001 X:81706987-81707009 TTGTGGGGAATGAAGAAGGAAGG - Intergenic
1193816507 X:86110594-86110616 TAGTGGGGGCTGAGGGAGATGGG + Intergenic
1193859787 X:86651213-86651235 TTGTGGGGCAGGAGAGAGGTGGG + Intronic
1194846111 X:98811473-98811495 CTTTGGGGACTCAGGGAGGTTGG - Intergenic
1195000592 X:100639614-100639636 TGGTAGGGATGGAGGGAGGCTGG - Intronic
1195808080 X:108798051-108798073 TAGTGGGGATTGAGGGAGCTTGG - Intergenic
1196588131 X:117454142-117454164 ATGGGGGGATAGAGGGAGGGAGG - Intergenic
1196828782 X:119760228-119760250 TTGTGGTTAGTAAGGGAGGTGGG - Intergenic
1197091081 X:122538511-122538533 TTGTGGGCATTGTGGGATATGGG + Intergenic
1197249563 X:124200740-124200762 TGTTGGGGATTGAGGGAGTTTGG - Intronic
1197371749 X:125635441-125635463 ATGCAGGGGTTGAGGGAGGTTGG + Intergenic
1197962814 X:132023884-132023906 AGGTGGAGATTGAGGGCGGTTGG + Intergenic
1198171550 X:134110800-134110822 TTGTGGAGATGAAGAGAGGTTGG - Intergenic
1198427698 X:136536241-136536263 ATGTGGGGAGGGAGGGAGCTGGG + Intronic
1198889176 X:141373879-141373901 ATGTGGGGATTGGAGGAGTTAGG + Intergenic
1199325910 X:146497989-146498011 TTGGGGGGTTGGGGGGAGGTGGG + Intergenic
1199963745 X:152801038-152801060 GTGTGGGAAGGGAGGGAGGTGGG - Intergenic
1199963756 X:152801072-152801094 TGGTGGGGAGGGAGGGAGGAAGG - Intergenic
1200165022 X:154029907-154029929 TGGTTGGGAGTGGGGGAGGTGGG + Intronic
1200988112 Y:9325267-9325289 TTGGGGGGATTGGGGCAGGGCGG + Intergenic
1201287788 Y:12393797-12393819 TTTTGGAGACTGAGGCAGGTTGG - Intergenic
1201387881 Y:13463010-13463032 TTGTGGGGTTGGGGGGAGGGGGG - Intronic
1201570830 Y:15412107-15412129 TTGTGGGGGTTGGGGGAAGGGGG + Intergenic
1201572736 Y:15431905-15431927 TTGTGGGAGTTGGGGGAGGGGGG + Intergenic
1202098871 Y:21284533-21284555 GTGTGGGGTTGGAGGGAGGTGGG - Intergenic
1202119906 Y:21510924-21510946 TTGGGGGGATTGGGGCAGGGCGG - Intergenic
1202122357 Y:21534465-21534487 TTGGGGGGATTGGGGCAGGGCGG - Intronic
1202156648 Y:21894918-21894940 TTGGGGGGATTGGGGCAGGGCGG + Intronic
1202159096 Y:21918459-21918481 TTGGGGGGATTGGGGCAGGGCGG + Intergenic
1202185545 Y:22183374-22183396 TTGGGGGGATTGGGGCAGGGCGG + Intergenic
1202205815 Y:22403022-22403044 TTGGGGGGATTGGGGCAGGGCGG - Intronic