ID: 992674520

View in Genome Browser
Species Human (GRCh38)
Location 5:79092337-79092359
Sequence ATAGTTGTGGGGATTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992674520_992674527 26 Left 992674520 5:79092337-79092359 CCTCCCTCAATCCCCACAACTAT No data
Right 992674527 5:79092386-79092408 TCTTCATATGTTATTATAATAGG 0: 1
1: 0
2: 3
3: 28
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992674520 Original CRISPR ATAGTTGTGGGGATTGAGGG AGG (reversed) Intronic