ID: 992674520 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:79092337-79092359 |
Sequence | ATAGTTGTGGGGATTGAGGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
992674520_992674527 | 26 | Left | 992674520 | 5:79092337-79092359 | CCTCCCTCAATCCCCACAACTAT | No data | ||
Right | 992674527 | 5:79092386-79092408 | TCTTCATATGTTATTATAATAGG | 0: 1 1: 0 2: 3 3: 28 4: 379 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
992674520 | Original CRISPR | ATAGTTGTGGGGATTGAGGG AGG (reversed) | Intronic | ||