ID: 992678328

View in Genome Browser
Species Human (GRCh38)
Location 5:79127891-79127913
Sequence GTGGCAAAAAGCCCCTTTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 2, 1: 0, 2: 0, 3: 11, 4: 143}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992678328_992678333 3 Left 992678328 5:79127891-79127913 CCCAGAAAGGGGCTTTTTGCCAC 0: 2
1: 0
2: 0
3: 11
4: 143
Right 992678333 5:79127917-79127939 CTTCAGAAAAACATGGCAGCTGG 0: 1
1: 1
2: 1
3: 22
4: 302
992678328_992678337 16 Left 992678328 5:79127891-79127913 CCCAGAAAGGGGCTTTTTGCCAC 0: 2
1: 0
2: 0
3: 11
4: 143
Right 992678337 5:79127930-79127952 TGGCAGCTGGGGAAGTGGTTTGG 0: 1
1: 2
2: 5
3: 37
4: 398
992678328_992678335 5 Left 992678328 5:79127891-79127913 CCCAGAAAGGGGCTTTTTGCCAC 0: 2
1: 0
2: 0
3: 11
4: 143
Right 992678335 5:79127919-79127941 TCAGAAAAACATGGCAGCTGGGG 0: 1
1: 1
2: 5
3: 29
4: 300
992678328_992678334 4 Left 992678328 5:79127891-79127913 CCCAGAAAGGGGCTTTTTGCCAC 0: 2
1: 0
2: 0
3: 11
4: 143
Right 992678334 5:79127918-79127940 TTCAGAAAAACATGGCAGCTGGG 0: 1
1: 1
2: 1
3: 28
4: 329
992678328_992678336 11 Left 992678328 5:79127891-79127913 CCCAGAAAGGGGCTTTTTGCCAC 0: 2
1: 0
2: 0
3: 11
4: 143
Right 992678336 5:79127925-79127947 AAACATGGCAGCTGGGGAAGTGG 0: 1
1: 1
2: 5
3: 215
4: 1847
992678328_992678331 -4 Left 992678328 5:79127891-79127913 CCCAGAAAGGGGCTTTTTGCCAC 0: 2
1: 0
2: 0
3: 11
4: 143
Right 992678331 5:79127910-79127932 CCACCAGCTTCAGAAAAACATGG 0: 2
1: 0
2: 1
3: 17
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992678328 Original CRISPR GTGGCAAAAAGCCCCTTTCT GGG (reversed) Exonic
900379541 1:2377088-2377110 GTGGCAAAATGCCCATTCCTCGG - Intronic
901259089 1:7858053-7858075 TTGGCAAACAGCCTCTTCCTTGG - Intergenic
902286697 1:15411849-15411871 GTTGCAAAACGCCCCTTCCTGGG - Intronic
904214184 1:28906381-28906403 GTGGCACAGAGCCTGTTTCTTGG + Intronic
911329269 1:96508404-96508426 GTGGCAAAAAGCCTCACTGTCGG - Intergenic
924308759 1:242718948-242718970 GCTGTAAAAAGCCCCTCTCTTGG + Intergenic
1063157128 10:3390502-3390524 GGGGCAAAAACCCCCTTCCAGGG + Intergenic
1063958505 10:11286539-11286561 GTAGGAAACAGCCCCTTGCTGGG + Intronic
1068317209 10:55361961-55361983 GTGGAGAAAATCTCCTTTCTTGG + Intronic
1069569695 10:69486846-69486868 ATGGAATAAAGCCCCTTTCCTGG - Intronic
1074528573 10:114281266-114281288 GGGGCAGAAAGCCCCACTCTGGG - Intronic
1076544057 10:131232054-131232076 GTGGCAGAATGGCCCCTTCTGGG - Intronic
1077233424 11:1468765-1468787 GTGGCCAACAGGCCCCTTCTTGG - Intergenic
1079986874 11:27208962-27208984 GTGGCAAAAGATCCTTTTCTTGG - Intergenic
1081636994 11:44727652-44727674 GTGGCGAGCAGCCCCTTTCCGGG - Intronic
1084600087 11:70140129-70140151 GTGGCTCAAGACCCCTTTCTGGG - Intronic
1089374588 11:117985759-117985781 CTGGTTAAAAGCCTCTTTCTTGG + Intergenic
1089745061 11:120610814-120610836 GTAGCAAGAATCCCCTTGCTGGG - Intronic
1090765223 11:129870569-129870591 GTCTCAAAAAGTCCTTTTCTAGG - Intronic
1091425607 12:386038-386060 GTGGCAAAACCCCCCTTTAAGGG - Intronic
1096081628 12:48837126-48837148 GTGGAAGAAAGACCCTGTCTGGG - Intronic
1096230987 12:49896840-49896862 ATGGCCAGAAGCACCTTTCTGGG - Intronic
1100504555 12:95206734-95206756 TAGGCAAAAAGCTCCTTCCTTGG - Intronic
1102021673 12:109687561-109687583 TTAGGAAAAAGCCCCATTCTGGG - Intergenic
1102598861 12:114013259-114013281 GTGGAAGAAAGCCCCTCTTTGGG - Intergenic
1108525905 13:51285890-51285912 AAGGCAAAAAGACCCCTTCTGGG + Intergenic
1108693248 13:52879119-52879141 GTGGGAACAGGCCCCTCTCTTGG - Intergenic
1111745672 13:92265895-92265917 GTAGCAAGAAGCCCCTTGCCAGG - Intronic
1113062003 13:106331912-106331934 GGGCCAAAAAGCAACTTTCTGGG + Intergenic
1114225141 14:20731400-20731422 GTGCCAGATAACCCCTTTCTGGG + Intergenic
1115426689 14:33268893-33268915 GAGGCAAAAAAGCCCTTTCCAGG - Intronic
1117308842 14:54502097-54502119 TTGTCAAGAATCCCCTTTCTGGG + Intergenic
1118206269 14:63727110-63727132 CTCGCAAACAGGCCCTTTCTGGG - Intronic
1119032013 14:71200201-71200223 GTGGATAAAAACCCCTTCCTGGG + Intergenic
1123836518 15:24200412-24200434 GGGGCATGAAGCACCTTTCTGGG + Intergenic
1124703389 15:31937218-31937240 GTGGCACCATGCCCCTTTCTGGG + Intergenic
1124722628 15:32123594-32123616 CTGGCATAAATCTCCTTTCTAGG + Intronic
1127799692 15:62467145-62467167 GTGGCAAAGAGCCCCATACCAGG + Intronic
1128117197 15:65116785-65116807 GTGGCTAAATGCCACCTTCTTGG + Intergenic
1129302596 15:74634213-74634235 GTGTCAGCAAGCCCCGTTCTAGG - Intronic
1130549985 15:84884276-84884298 GTGGCAAAAAGCCACAGGCTGGG - Intergenic
1130936901 15:88478483-88478505 GTGGCAAAAAGCTCCAATTTGGG - Exonic
1132726610 16:1341631-1341653 GTGGCACAACGCCCATCTCTGGG - Intronic
1133316830 16:4890109-4890131 AGGTCAACAAGCCCCTTTCTGGG - Intronic
1133442495 16:5832376-5832398 GTGGCAAAATAGCCCTTTCTGGG - Intergenic
1133443398 16:5839363-5839385 TTTGCCAAAAGCCCTTTTCTTGG + Intergenic
1134380794 16:13723627-13723649 ATGGCAAAAAGGAACTTTCTGGG + Intergenic
1141168696 16:81677633-81677655 ATGCCATAGAGCCCCTTTCTGGG + Intronic
1141867018 16:86757351-86757373 GTGGCAAAAAGGCCTTGCCTTGG + Intergenic
1142047083 16:87932453-87932475 GTGGCAATGAGCCCTTTTGTTGG - Intronic
1143305032 17:5939754-5939776 GTGGCCAAAAGTGCATTTCTTGG - Intronic
1144396506 17:14849149-14849171 CTGATAAAAAGCCCCCTTCTTGG - Intergenic
1145990344 17:29075550-29075572 AAGGGGAAAAGCCCCTTTCTTGG + Exonic
1148587455 17:48791062-48791084 GATGAAAAACGCCCCTTTCTGGG + Intronic
1150654488 17:67031038-67031060 GTGACAAAAAGAGCCGTTCTGGG - Exonic
1151439539 17:74119283-74119305 TTGGTAAAAAGCCCCTTCCAAGG - Intergenic
1155319399 18:24604215-24604237 GAGTCAAAAATACCCTTTCTTGG + Intergenic
1157211166 18:45743176-45743198 GGGGCAAAAAAGCCCTCTCTAGG - Intronic
1157285389 18:46373943-46373965 GTGCCACACAGCCCCTTTGTCGG - Intronic
1159914025 18:74173120-74173142 ATGGCTTAGAGCCCCTTTCTGGG - Intergenic
1160288344 18:77567726-77567748 GTAGCAAAATGACCTTTTCTGGG + Intergenic
1161296401 19:3522699-3522721 AGGGCAGAAAGCCCCTTTCCCGG + Intronic
1167336041 19:48886545-48886567 AGGGCAAAAAACCTCTTTCTAGG + Intronic
925224677 2:2172799-2172821 GTGGCCAGAAGCCCCGTGCTGGG + Intronic
927770018 2:25851978-25852000 GAGGGAAAAAAACCCTTTCTTGG + Intronic
930252032 2:49044969-49044991 GTTTCTAAAAGCCCCTCTCTTGG - Intronic
930835114 2:55784687-55784709 TTGCCATAAATCCCCTTTCTTGG + Intergenic
932817901 2:74876368-74876390 TTGACAAAAGGCCCATTTCTGGG - Intronic
935588494 2:104823638-104823660 GTAACACACAGCCCCTTTCTAGG + Intergenic
940020580 2:149152371-149152393 ATAGGAAAGAGCCCCTTTCTGGG - Intronic
940091377 2:149923085-149923107 GTGACCAAAAGCCCCTTCCCAGG + Intergenic
943182155 2:184559038-184559060 GCAGCATATAGCCCCTTTCTAGG + Intergenic
943238677 2:185356457-185356479 GTGGCAAAAAGCCTGTTTAGTGG - Intergenic
946035072 2:216735256-216735278 GTGGCCATAAGACCCTTTCAGGG + Intergenic
946621278 2:221566079-221566101 GTAGCCAAAAGCTACTTTCTTGG - Intronic
947360438 2:229340497-229340519 GGAGCAAAAAGCCCATTTCATGG + Intergenic
947569635 2:231222310-231222332 GTGGAAATGAGTCCCTTTCTTGG + Intronic
1170569461 20:17624796-17624818 GGGACAAAATGCCCCTTCCTTGG + Intronic
1171152106 20:22836201-22836223 GTGGGAAGAAGCCCTTTTCAAGG + Intergenic
1173312540 20:41911578-41911600 GAGGCATAAAGGCCATTTCTTGG - Intergenic
1174918689 20:54679599-54679621 ATGGCAGAAAGCCTATTTCTTGG - Intergenic
1178889322 21:36508304-36508326 GTGTCAAAAAGCTACTTTCCAGG + Intronic
1179923394 21:44519812-44519834 GTGGCAGCAAGCCCCTCTCAAGG + Intronic
1181003367 22:19998339-19998361 GTGACACAAAGCCCCTTTGAGGG + Intronic
1182079546 22:27519156-27519178 GTGACACATAGCCCCTATCTGGG + Intergenic
1183296794 22:37034426-37034448 GTGGCAATAATCCACTTTATAGG + Intergenic
1183832335 22:40424963-40424985 CAGGCAAACATCCCCTTTCTGGG - Intronic
1184681221 22:46073234-46073256 GTGGTAAAATGCCCCTTTATAGG + Intronic
1184760114 22:46538832-46538854 TTGCCAAAAAGACCCGTTCTAGG - Intergenic
950914891 3:16634400-16634422 GTGGCAAAATACCACTTGCTTGG + Intronic
954458658 3:50613427-50613449 TTGGCCAGAAGCCACTTTCTTGG + Intronic
955688130 3:61564505-61564527 GAGGTAAATAGCCCCTTTCCTGG + Intronic
959164424 3:102758934-102758956 GGGCCAAAAAGCAACTTTCTGGG + Intergenic
960808918 3:121610151-121610173 CAGGCAGAAAGCCCCATTCTGGG - Intronic
963164311 3:142185182-142185204 GTGGCAGAAGGCCCCAGTCTAGG + Intronic
970532122 4:16995569-16995591 ATGGAAAAGAGCCACTTTCTAGG + Intergenic
972093278 4:35316289-35316311 GTGGCAATACACCCCTTTCTGGG + Intergenic
973138208 4:46732965-46732987 GTTACAAAAAGCTCCTGTCTGGG + Intergenic
977045503 4:92064370-92064392 ATGGAAAAAAGTACCTTTCTGGG + Intergenic
978418167 4:108501269-108501291 GAGGCAAATAAACCCTTTCTGGG - Intergenic
979609568 4:122674804-122674826 ATGGAACAAGGCCCCTTTCTGGG - Intergenic
981280455 4:142952462-142952484 GTGGCAAAAGGAAGCTTTCTAGG + Intergenic
984414751 4:179444010-179444032 ACAGCAAAAAACCCCTTTCTGGG - Intergenic
985295964 4:188437863-188437885 TTGGCAAGAAGTCCCTTGCTTGG + Intergenic
989854355 5:46262311-46262333 TTCTCAAAAAGCCTCTTTCTGGG + Intergenic
992187370 5:74257297-74257319 GTGGCCAAGAGCTGCTTTCTGGG - Intergenic
992592292 5:78307690-78307712 GTGGCAAAAATCCACATTATGGG + Intergenic
992673629 5:79083764-79083786 GTGGCAAAAAGCCCCTTTCTGGG - Exonic
992678328 5:79127891-79127913 GTGGCAAAAAGCCCCTTTCTGGG - Exonic
998709798 5:144810443-144810465 GTGGCAAAAAGACTATTTCTGGG - Intergenic
1001431405 5:171665514-171665536 GTGACAATAAGCCTGTTTCTAGG - Intergenic
1002373528 5:178772820-178772842 GTGGAAGAAAGCCCATTACTGGG + Intergenic
1002925542 6:1604210-1604232 GTGGCTGAAAGCCCCAGTCTCGG + Intergenic
1003715182 6:8638572-8638594 GTGGCAAGTGGCCCCTTTATTGG + Intergenic
1009349283 6:62653684-62653706 GGGACAAAAAGGCCCTTACTAGG + Intergenic
1012418404 6:99035359-99035381 GTGGAAATAAGCCCCTTACCAGG - Intergenic
1014398266 6:120953470-120953492 GTGCCAAAACGCACCTTTTTGGG + Intergenic
1015031566 6:128601881-128601903 GAGGCCAAAATCCCCTGTCTGGG - Intergenic
1017233165 6:152094130-152094152 AAGGCTAACAGCCCCTTTCTGGG + Intronic
1017418304 6:154245313-154245335 GTGGCACAAAGCTCCTCTTTGGG - Intronic
1019967418 7:4511115-4511137 TTGTCAAACATCCCCTTTCTAGG + Intergenic
1020710404 7:11598033-11598055 GCAGCACTAAGCCCCTTTCTAGG + Intronic
1028753717 7:94410965-94410987 GAAGCAGCAAGCCCCTTTCTAGG - Intronic
1029611266 7:101627765-101627787 TTGGCCAAATGCCCCTTCCTGGG - Intronic
1029685572 7:102145389-102145411 TTGGCCAAAAGCCCCTTTGTGGG + Intronic
1032350442 7:131158063-131158085 ATGGCAAAACGCCCGTTTCCAGG - Intronic
1032624122 7:133571206-133571228 GTTGCAATAAGCCCCTTTGATGG + Intronic
1032872766 7:136003738-136003760 GTGGGAAACAGGCCTTTTCTTGG + Intergenic
1034684734 7:152959933-152959955 CTAGCAAAAGGCCCATTTCTGGG + Intergenic
1034889259 7:154825435-154825457 GTGACAAATATCCCTTTTCTTGG - Intronic
1036865166 8:12390141-12390163 GTGGCAAGAAAGCCCATTCTGGG + Intergenic
1039570301 8:38581185-38581207 GTGGCAAGATGCCCCTGGCTGGG + Intergenic
1044273416 8:90273086-90273108 GGGGCCAAAATACCCTTTCTGGG - Intergenic
1048379773 8:133855233-133855255 GTAGCAAAAAGCCTACTTCTGGG + Intergenic
1049607871 8:143538071-143538093 GTGGCTTGAAGCCCCTCTCTGGG - Exonic
1051492006 9:17676677-17676699 GTAGCAAAATGCCACTTTCAGGG - Intronic
1051794040 9:20844066-20844088 GACCCAAAAAGCCCATTTCTAGG + Intronic
1054993031 9:71352618-71352640 GTGGCAAAAAGCTGCATTATAGG - Intronic
1055704340 9:78981218-78981240 GTGGCAAACAGCCCTTCTTTGGG + Intergenic
1059018128 9:110544026-110544048 CTGGCAGAAACCCCCTTCCTGGG - Intronic
1059529654 9:115024030-115024052 GTACCAGAAAGCCCCTTTGTAGG + Exonic
1059731597 9:117062338-117062360 GGGGGAAAAAGCTCCTTTTTAGG - Intronic
1060405905 9:123373034-123373056 GTGGCAGACAGCCACTTACTTGG - Intronic
1061788232 9:133043815-133043837 GTGGAAAAAGGCCTCCTTCTCGG - Exonic
1062438370 9:136557131-136557153 GTGGCAGAAAGGCCATTTCTTGG - Intergenic
1187394353 X:18906814-18906836 GTGACACAATGCTCCTTTCTAGG - Exonic
1187420258 X:19127823-19127845 GAGGCAAAAAGGCCCTCTCTTGG + Intergenic
1189436111 X:40994249-40994271 GTCCCAAAAGGGCCCTTTCTGGG - Intergenic
1192200785 X:69065479-69065501 GTGGCAAAAAGCACCTCCTTTGG - Intergenic
1192580118 X:72274106-72274128 GTTGCATAAAGCCCTTCTCTAGG + Intronic
1195267572 X:103198024-103198046 GTGGAGAAAAGTCACTTTCTTGG + Intergenic
1196235051 X:113269935-113269957 GTCACCAAAAGCCCTTTTCTGGG - Intergenic
1197685926 X:129439705-129439727 CAGGTAGAAAGCCCCTTTCTGGG + Intergenic
1198624485 X:138554627-138554649 ATGGCAAAAAGCTCCTGGCTTGG - Intergenic
1199987859 X:152965207-152965229 GTTGCAGGAAGCCCCTTTCTGGG + Intronic
1202038798 Y:20661697-20661719 GTGACCAAAAACCCCATTCTAGG - Intergenic