ID: 992681847

View in Genome Browser
Species Human (GRCh38)
Location 5:79161327-79161349
Sequence ATGTAGGAGCTGAAAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 1, 1: 0, 2: 8, 3: 50, 4: 494}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992681845_992681847 15 Left 992681845 5:79161289-79161311 CCAAGCACAGAAAGACATGATCA 0: 1
1: 1
2: 3
3: 34
4: 264
Right 992681847 5:79161327-79161349 ATGTAGGAGCTGAAAAAAAAAGG 0: 1
1: 0
2: 8
3: 50
4: 494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992681847 Original CRISPR ATGTAGGAGCTGAAAAAAAA AGG Intronic
902995922 1:20224784-20224806 CTGTAGAAGCTGCAAACAAAAGG + Intergenic
905317318 1:37091586-37091608 ATGTAGGAGGTGAAGGAGAAAGG - Intergenic
906300318 1:44676794-44676816 ATTTAGGAGAAGAAAAAAGAAGG + Intronic
907908115 1:58803245-58803267 AGGAAGGAGTTTAAAAAAAAAGG - Intergenic
908310718 1:62880002-62880024 GGGTAGGATCTGAAAAGAAAAGG + Intergenic
908382299 1:63608335-63608357 ATTTAGGAGCTGTACAAAATGGG + Intronic
909499969 1:76323355-76323377 CTGTAAGAGCTAAAAGAAAATGG - Intronic
909668018 1:78157875-78157897 GTTTTGAAGCTGAAAAAAAATGG - Intergenic
909854798 1:80515073-80515095 ATATGAGAGCTGAAAAAAGAAGG + Intergenic
910534367 1:88279600-88279622 ATGTAGCAGCTGGAAAGAAATGG - Intergenic
910703728 1:90104459-90104481 ATGGAGGCGCTGAAAATAAATGG + Intergenic
910897755 1:92085996-92086018 ATGTAGGGGTTGAAAGAAAGTGG + Intronic
911213268 1:95164994-95165016 ATGTGGGAGCTGGGAAAAGACGG - Intronic
911509875 1:98798505-98798527 ATGTGGGGACTAAAAAAAAATGG - Intergenic
911886904 1:103313359-103313381 ATTTATGAGATGAAACAAAAGGG + Intergenic
912585908 1:110765248-110765270 ATTAAGGAAGTGAAAAAAAAAGG + Intergenic
912738814 1:112174661-112174683 TTGTGGGTGCAGAAAAAAAAAGG + Intergenic
913710325 1:121476578-121476600 ATGTAGGTACTCAAAGAAAAAGG + Intergenic
914833859 1:151190998-151191020 ATTTAGGAGGAAAAAAAAAAAGG + Intronic
915157600 1:153891240-153891262 AAGAAAGAGGTGAAAAAAAAAGG + Intronic
915383586 1:155468157-155468179 ATCAAGGACCTGAAAAAACAAGG - Intronic
917126034 1:171688425-171688447 ATCTAGGAGACCAAAAAAAAAGG - Intergenic
917557594 1:176106644-176106666 AGGTAGGAGATGAAATAATAGGG - Intronic
917803147 1:178588629-178588651 ATGTAGAAGCTAAAAAAAAAAGG - Intergenic
918867026 1:189914680-189914702 ATTTTGGGGCTGAATAAAAAAGG + Intergenic
919342533 1:196331192-196331214 ATGAAGGAGATGACAAAAAGTGG + Exonic
921353422 1:214261444-214261466 ATGTAGGGGCTGAAAAACACAGG + Intergenic
921394736 1:214656433-214656455 ATGGAGGATCTGATGAAAAAGGG - Intronic
921777148 1:219114287-219114309 ATGTATAAGCTCAAAACAAAAGG + Intergenic
922651699 1:227345789-227345811 ATGTAGGAGCAAGAAAACAAAGG - Intergenic
922771529 1:228186603-228186625 ATGCATCAACTGAAAAAAAAAGG - Intergenic
923074491 1:230597525-230597547 ATGTAGGGGCAGAAATAAAAAGG + Intergenic
924078415 1:240366022-240366044 GTGTAAGAGCTGAAACAAGAAGG + Intronic
924308677 1:242718348-242718370 GAGTAGGAGCTTAAAAAAGATGG + Intergenic
1063789982 10:9433649-9433671 CTTTAGGTGCTGAAATAAAAGGG - Intergenic
1063889397 10:10614243-10614265 ATGTAAGAGCGTAATAAAAATGG - Intergenic
1064248327 10:13687463-13687485 ATGTTGGAGGGGAGAAAAAAGGG - Intronic
1064360330 10:14658563-14658585 ATGTAGGAACTGAAAAGTAATGG - Intronic
1064625181 10:17254170-17254192 ATGGAGGAGCAGAAAACTAATGG - Intergenic
1064946846 10:20800181-20800203 ATGTGGAATCTGAAAAAGAAAGG - Intronic
1065077037 10:22090583-22090605 CTGAAGGAGCTGAAAAACCATGG + Intergenic
1065374423 10:25023647-25023669 ATGTGGCATCTGAAGAAAAATGG + Exonic
1065586403 10:27222336-27222358 TTGTAGGAGTTGAATAAAATGGG - Intronic
1066301719 10:34103189-34103211 CTGTAGCAGATGCAAAAAAAAGG - Intergenic
1068795234 10:61072100-61072122 ATATAAGAGATTAAAAAAAAGGG + Intergenic
1069381899 10:67850087-67850109 ATGCAGGGTCTGAAACAAAAAGG - Intergenic
1070002852 10:72394074-72394096 ATTCAGGAGCTCAAAAAAATAGG - Intronic
1070511698 10:77167184-77167206 ATGTGGGAGCTAAAAAAAAGGGG - Intronic
1070943415 10:80367417-80367439 ATGTGGGAGTTGAAAGAAAGTGG + Exonic
1072025592 10:91452712-91452734 ATGCAGCACCTCAAAAAAAAAGG + Intronic
1072136815 10:92554909-92554931 ATGCAGGAGCTGTGAAAAAAGGG + Intronic
1072170607 10:92857165-92857187 ATAGAGGAGCAAAAAAAAAAAGG - Intronic
1072835498 10:98707089-98707111 ATGTAGGAATGAAAAAAAAAAGG + Intronic
1074003109 10:109392155-109392177 ATGAATGAGCTGAAGAAGAATGG + Intergenic
1074623780 10:115155162-115155184 ATATAGAGGCTGAAAATAAAGGG - Intronic
1075117000 10:119635177-119635199 GTGTAGGATCTGAAATACAAAGG - Intergenic
1076400330 10:130179336-130179358 TTTTAGGAACTGAAAGAAAATGG + Exonic
1078263295 11:9732497-9732519 GTGTAGGAGGAAAAAAAAAATGG - Intronic
1078477344 11:11642347-11642369 ATGAAAGAGCAGCAAAAAAATGG + Intergenic
1079496188 11:21047237-21047259 ATATAGCAACTGAAAAGAAAGGG - Intronic
1079815120 11:25046848-25046870 ATGTAAAAGCAGAATAAAAATGG + Intronic
1080438931 11:32272566-32272588 ATCTAGGAGGTTCAAAAAAATGG + Intergenic
1081054140 11:38386982-38387004 ATGTAGAAGCTGAGACAAAAGGG - Intergenic
1081552972 11:44131177-44131199 ATGTGGAAGCTGAAAAGTAAAGG - Intronic
1081603571 11:44512569-44512591 GGGTAGGAGCTGCAGAAAAATGG - Intergenic
1082599702 11:55134007-55134029 TTGAAGGAGCTGAAAACCAAGGG + Intergenic
1082678104 11:56134141-56134163 ATGTAGGAGGTGGAAAACAGAGG - Intergenic
1082775099 11:57238447-57238469 ATGTAGGAGGTGAGTGAAAAGGG + Intergenic
1082908630 11:58343553-58343575 ATGTAATACCTGAATAAAAATGG - Intergenic
1083108436 11:60381424-60381446 ATCTAGGAGTAGAAATAAAATGG + Intronic
1083355122 11:62060537-62060559 ATGAAGGACTTGAAAAAGAAAGG - Intergenic
1083839343 11:65294946-65294968 ATTTGGGAAATGAAAAAAAAGGG - Intronic
1085658544 11:78340431-78340453 ATTTGGGAGCAGAAAAATAAGGG - Intronic
1085798435 11:79565012-79565034 ATGTGGAAGCTGAAAAGAAAAGG - Intergenic
1086282339 11:85205315-85205337 ATTTGGGAGCTAAAAAAAAGTGG + Intronic
1086490196 11:87351844-87351866 ATGCTGGAACTGAAAGAAAAGGG - Intergenic
1086589722 11:88498956-88498978 ATATAGAAGATGAAAAAATATGG - Intergenic
1087135847 11:94719149-94719171 ATGTAGTATATGAAAAAAATTGG - Intronic
1087250863 11:95898053-95898075 ATGTAGTATTTGAAAGAAAAAGG - Intronic
1087505097 11:99010680-99010702 AAGTAGCAGCTGCATAAAAAAGG - Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087796413 11:102459036-102459058 AAGTAGGAGCTGATAAATAACGG - Intronic
1088940013 11:114444128-114444150 ATGTAGGAGAGAAAAAAAAGAGG - Intronic
1088952418 11:114585070-114585092 ACTTAGGAGCTGAAAAGAACAGG - Intronic
1090186134 11:124740203-124740225 ACCTAGGAGCAGAAAGAAAAGGG + Intronic
1090396365 11:126421852-126421874 AGGGAGGTGCTGAAAAACAAAGG - Intronic
1090603953 11:128402013-128402035 ATGTAGGAACTAAAAAGACAAGG - Intergenic
1091158134 11:133392985-133393007 ATATAAGAGCTGAAACAAGAAGG - Intronic
1091911471 12:4233837-4233859 ATCTAGAAGCTGGAAAAAACTGG + Intergenic
1092631171 12:10379765-10379787 ATGAAGCAGCAGAAAAAAAATGG + Exonic
1093175237 12:15905962-15905984 ATGAAGGAACTGAGAAATAAAGG - Intergenic
1093274345 12:17105627-17105649 ATCTAGGATCAGAATAAAAATGG + Intergenic
1093687796 12:22076719-22076741 AAGGAGGAGAAGAAAAAAAAAGG + Intronic
1093891436 12:24526219-24526241 GTGTAGTAGCTGGAAAGAAATGG + Intergenic
1094223607 12:28022162-28022184 ATTTAAGAGCTGAAAGATAAAGG + Intergenic
1094578602 12:31711916-31711938 ATGTGGGAACTAAAAAAAAGTGG - Intronic
1095271210 12:40221548-40221570 ATGTATCAGTGGAAAAAAAAAGG - Intronic
1095373769 12:41501976-41501998 ATGTAGGATTAGAAAAAAAGTGG - Intronic
1095480257 12:42627250-42627272 TTGGAGAAGCTGAAAATAAAGGG - Intergenic
1095539768 12:43295813-43295835 CTGAAGGAGCTGAAGAAACATGG + Intergenic
1095662831 12:44757605-44757627 GTGTGGGTGCTGAAAAAAACAGG + Intronic
1095922595 12:47545710-47545732 ATGTGGCAGCTGACAAAATAAGG - Intergenic
1097282979 12:57856710-57856732 AATTAGAAGCTGAAAAATAAAGG - Intergenic
1098305622 12:69099704-69099726 TTTTAGTAGCTGAAAAACAACGG - Intergenic
1098381757 12:69877356-69877378 AGGGTGGAGCTGAAAACAAAAGG - Intronic
1098926536 12:76357215-76357237 AAGTAGGATCTGAACAAAAATGG - Intronic
1099101160 12:78441997-78442019 ATGTAGGGGAAGAAAAAAGAAGG + Intergenic
1099319952 12:81133562-81133584 ATGTAGAAGTTGAAAAAAAGTGG - Intronic
1099359290 12:81679560-81679582 ATGTAGAAGATGAATGAAAAGGG + Intronic
1099700033 12:86072555-86072577 ATATATGAGGTGAACAAAAAGGG - Intronic
1099738313 12:86599653-86599675 ATTTTACAGCTGAAAAAAAATGG + Intronic
1100459199 12:94781909-94781931 ATTTATCAGCTGAAAAAAATTGG + Intergenic
1100613259 12:96209915-96209937 ATGTAGGAAAAAAAAAAAAAAGG - Intronic
1100948495 12:99817224-99817246 ATGTGGGAGCTAAAAAAAAGGGG - Intronic
1101255830 12:102975652-102975674 AGGCAGGAGCTGAAATGAAAAGG - Intergenic
1102792976 12:115663183-115663205 ATGAAGGAGATGAAGAATAAAGG - Intergenic
1103284811 12:119791725-119791747 AAATAGAAGCTGGAAAAAAAAGG - Intronic
1104180057 12:126370846-126370868 ATGTCTGAGCTAGAAAAAAAGGG + Intergenic
1105488657 13:20864218-20864240 CTCTAGGAGTTAAAAAAAAAGGG + Intronic
1105909584 13:24850062-24850084 ATTGAGGAGCTGTAAAAAACAGG - Intronic
1106691720 13:32124588-32124610 AAGTGGAATCTGAAAAAAAAAGG - Exonic
1106852712 13:33812407-33812429 ATGTTGAAGCTGGGAAAAAATGG + Intergenic
1106911808 13:34471124-34471146 ATATAGGAGCAGAAAAAAAAGGG + Intergenic
1106975378 13:35205238-35205260 ATGTAGGTGCAGAAAAAGATCGG + Intronic
1107215095 13:37907566-37907588 ATTTAGGAGTTGAAAAATACGGG + Intergenic
1107985445 13:45772052-45772074 CTGTAGGAGCAGATAAAATAAGG - Intergenic
1108214113 13:48167122-48167144 ATGTGGAATCTGAACAAAAAGGG - Intergenic
1108584467 13:51857718-51857740 AGGTAGGAGTAGAAAAAACATGG + Intergenic
1108702127 13:52952688-52952710 AGGTAGTAGGGGAAAAAAAAAGG + Intergenic
1109103406 13:58216237-58216259 ATGTAGGAAATGACAAAGAAGGG + Intergenic
1109319907 13:60797839-60797861 TTGTAGCAGCTGAAGAAATATGG + Intergenic
1109495943 13:63171974-63171996 ATCTAGAAGCTGGAAAAACAAGG - Intergenic
1109593611 13:64520995-64521017 ATGTAGATCATGAAAAAAAATGG - Intergenic
1109650040 13:65313072-65313094 GTGTAAGAGCTTAAAAAAAGAGG - Intergenic
1110528451 13:76567679-76567701 ATGTAGAAGCGGGAAAATAATGG + Intergenic
1110683957 13:78349886-78349908 ATGTAGGAAGGAAAAAAAAAGGG + Intergenic
1110830012 13:80019923-80019945 ATGTTGGAGCTGAATTAGAACGG - Intergenic
1111384768 13:87510711-87510733 ATGTAAGAGAAGAAATAAAATGG + Intergenic
1111914769 13:94349367-94349389 ATGAAGAAGCTGAAACCAAAAGG - Intronic
1112175646 13:97020990-97021012 AGGTAGGAGGTGGATAAAAAAGG - Intergenic
1112853407 13:103734725-103734747 ATGTAGGAGGACAAAAAGAAGGG + Intergenic
1114472668 14:22974543-22974565 ATGTAGGGGCTGGAAAAAGGTGG - Intronic
1114723322 14:24906944-24906966 ATGTGGGAACTAAAAAAAAGTGG + Intronic
1114948152 14:27713127-27713149 ATGCAGAAGCTGAAAAATAGTGG + Intergenic
1115901155 14:38149691-38149713 AAGTAGGAGCTGAAAGCCAAAGG + Intergenic
1116217423 14:42036159-42036181 ATGTAGGAGCTGAAGACATTGGG - Intergenic
1116571221 14:46518203-46518225 ATGTGGGAGCTAAAAAATATTGG + Intergenic
1117521544 14:56556572-56556594 ATGGTGGAGATGAACAAAAATGG - Intronic
1118037557 14:61884141-61884163 AGGTAGGTGCAGAAAAACAAAGG - Intergenic
1118044921 14:61958268-61958290 AGGTAAGATCAGAAAAAAAATGG - Intergenic
1119724751 14:76915145-76915167 ATGTAGGAGATGGAAAAGCAAGG + Intergenic
1119749172 14:77065305-77065327 CCGTAGGAGATGATAAAAAATGG + Intergenic
1120055701 14:79921472-79921494 ATGTATAAGGAGAAAAAAAATGG + Intergenic
1120663120 14:87274271-87274293 GAGTAGTAGCAGAAAAAAAATGG + Intergenic
1121108953 14:91299404-91299426 CAGTAGGAGCTGAAACAAGAAGG + Intronic
1121739320 14:96240389-96240411 ATGTCGGCGCTGAAAGAAAGTGG - Exonic
1121847806 14:97188737-97188759 ATGTAGAAGCTCAAATACAAAGG - Intergenic
1123503917 15:20918754-20918776 AGGTAGGATCTTAGAAAAAAAGG + Intergenic
1123561164 15:21492416-21492438 AGGTAGGATCTTAGAAAAAAAGG + Intergenic
1123597406 15:21929720-21929742 AGGTAGGATCTTAGAAAAAAAGG + Intergenic
1124457235 15:29854889-29854911 ATTGAGGAGGGGAAAAAAAAAGG + Intronic
1130167508 15:81478190-81478212 GTGAAGAAGCTTAAAAAAAATGG - Intergenic
1130882505 15:88067228-88067250 ATTGAGGAAGTGAAAAAAAATGG - Intronic
1131563740 15:93466683-93466705 ATGTAGGATCTGACATACAAGGG - Intergenic
1131667689 15:94587750-94587772 ATGAAGGAGATGAAAGTAAATGG - Intergenic
1131997434 15:98145798-98145820 ATGAGGGAGATGAATAAAAAAGG + Intergenic
1202969510 15_KI270727v1_random:219580-219602 AGGTAGGATCTTAGAAAAAAAGG + Intergenic
1133195844 16:4169624-4169646 TCATAGGAGCTGAAAGAAAATGG - Intergenic
1133484020 16:6201014-6201036 ATGTGGGAGCTAAAAAAACTAGG - Intronic
1133501217 16:6368596-6368618 ATGTAAGAGCTAAATAATAAGGG - Intronic
1135817535 16:25648960-25648982 ATGTAATAGCTTAAAAAAAGGGG - Intergenic
1135828653 16:25753854-25753876 TTGTAGGTGCTGAATAAATACGG - Intronic
1135938057 16:26797822-26797844 ATGCAGGAGCTGCAAAGCAAAGG + Intergenic
1136601320 16:31291719-31291741 GTGTAGGAGCTAAAAAAAAATGG + Intronic
1138323743 16:56142716-56142738 ATGAAGAAGCTGAAAACCAAGGG - Intergenic
1138453049 16:57105253-57105275 ATATAGGAGGTGAAGATAAAAGG + Intronic
1141381569 16:83581876-83581898 AAGGAGGAGATGAAATAAAAAGG - Intronic
1141678313 16:85529364-85529386 GTGTAGGAGCTAAGAAAACATGG - Intergenic
1142269530 16:89081959-89081981 ATGTGGGAGCTGGAAAACAGTGG + Intergenic
1142328116 16:89431611-89431633 ATGTAGCAAGTGAAACAAAATGG - Intronic
1143156460 17:4840375-4840397 CTGTGGGAGGGGAAAAAAAATGG + Intronic
1143343849 17:6234976-6234998 ATGTAATATCTGTAAAAAAATGG + Intergenic
1143675030 17:8426351-8426373 ATGACGGGGCTGAAAAGAAATGG - Intronic
1143846632 17:9777020-9777042 CTGTAGGTGCTCAAAAAAATAGG + Intronic
1144028171 17:11296797-11296819 AGGTAGGAGCTGATCAGAAAGGG + Intronic
1144262610 17:13537405-13537427 ATGGAGGAGCTGAGAAAGGAAGG - Intronic
1147450510 17:40501142-40501164 ATGGAGAAGCTGAAGACAAAAGG + Intronic
1149855859 17:60082069-60082091 ATGTGGGAGGTAAAAAACAATGG - Intergenic
1150855051 17:68744740-68744762 ATGTATGAGATGAAAGAAAAGGG - Intergenic
1151925968 17:77197087-77197109 ATGTAGGTTCTGGAACAAAATGG - Intronic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1153630895 18:7068874-7068896 ATATTGAAGCTGAAAAAAAGGGG - Intronic
1153655819 18:7281221-7281243 ATGTAGAAGATGGAAAATAAAGG + Intergenic
1154089817 18:11346813-11346835 ATGTAGAAGGTGGAAAATAATGG + Intergenic
1155768012 18:29660176-29660198 ATGAAGAAGGTGGAAAAAAATGG + Intergenic
1156520950 18:37721941-37721963 GTGTAGGTGCGGAAAATAAATGG - Intergenic
1156810656 18:41245989-41246011 ACGTGGGAGCTAAAAAAAAGTGG - Intergenic
1158024837 18:52884388-52884410 ATGGAGGAAATAAAAAAAAAAGG - Intronic
1158598935 18:58840502-58840524 ATCTAAGAGGTGAAAACAAAAGG - Intergenic
1158817197 18:61116078-61116100 ATATAAGAGCTGAAACAAGAAGG - Intergenic
1159289829 18:66402264-66402286 ATATAGGAGCGGAATGAAAATGG - Intergenic
1159495634 18:69199941-69199963 ATGTAGTAGAGGAAAAAAAAGGG - Intergenic
1159688564 18:71456465-71456487 ATTTAGGACATGAAAGAAAATGG - Intergenic
1159746111 18:72236986-72237008 ATGTATGAAATGAAAATAAAAGG + Intergenic
1159833713 18:73310506-73310528 ATGGTGGTGGTGAAAAAAAATGG + Intergenic
1159852855 18:73547226-73547248 CTGTGAGAGCTGAAACAAAAAGG + Intergenic
1160489280 18:79323517-79323539 ATGTGGGAGCTAAGAAAAAAAGG - Intronic
1163662448 19:18586896-18586918 ATGAAGGAACTGAAAAGACATGG - Intronic
1163699348 19:18779520-18779542 ATGTAGGACTTAAAAAAAAATGG + Exonic
1163880334 19:19915101-19915123 ATGTATTATCTGAGAAAAAAAGG - Intronic
1164846508 19:31437425-31437447 ATTTGGGAGGTGAAAAAACACGG - Intergenic
1167202407 19:48075065-48075087 ATGAAGGAGCTAGAAAAAAGAGG - Intronic
1168544375 19:57238575-57238597 CTGTAGGAGCTCCAAAACAATGG + Intergenic
924994341 2:343148-343170 AGGTAGGAGCTCAAGAGAAAAGG + Intergenic
925445986 2:3927392-3927414 ACGTAATATCTGAAAAAAAATGG - Intergenic
926551400 2:14305908-14305930 ATGGATGAGCTGTGAAAAAATGG + Intergenic
926617986 2:15018069-15018091 ATGTAGAAACTTAAAAAAAGTGG + Intergenic
926829035 2:16940169-16940191 ATGGTGGAGCTGAAGAAAGAGGG - Intergenic
927318666 2:21717140-21717162 AAGTCAGAGCTGAGAAAAAAAGG - Intergenic
927725527 2:25419541-25419563 GTGTTGAAGATGAAAAAAAAAGG + Intronic
927745247 2:25613652-25613674 ATGTAGGAAAAAAAAAAAAAGGG + Intronic
928151717 2:28836684-28836706 ATGAGGCAGCTGAGAAAAAAGGG - Intronic
929744046 2:44637023-44637045 AGGTAAGAGGGGAAAAAAAATGG + Intronic
930583316 2:53239409-53239431 ATGTAGGGGCAGAAAGAATAAGG - Intergenic
930756754 2:54982314-54982336 AAGTATGACCAGAAAAAAAAAGG + Intronic
932053970 2:68425987-68426009 ATGCAGGAGCTGAAACAAAGAGG + Intergenic
932185339 2:69690567-69690589 GTGTAGGAACTGCAAAAACAGGG - Intronic
933110171 2:78388548-78388570 ACATAGGAGCTAAAAAAAAAGGG - Intergenic
933372976 2:81440750-81440772 ATGTAAGAGATGATAGAAAATGG - Intergenic
933480560 2:82851775-82851797 ATGCAGCAGCTGAGAGAAAAAGG + Intergenic
933630393 2:84649822-84649844 AAGTGGGAGCTGAAAAATGATGG + Intronic
934491151 2:94762706-94762728 ATGTGGGACCTGGGAAAAAATGG + Intergenic
934589189 2:95530950-95530972 ATGTAGGAGCTGACACAGCACGG - Intergenic
936171031 2:110174738-110174760 GTATGAGAGCTGAAAAAAAAAGG - Intronic
936583989 2:113735931-113735953 ATTTAGGAGGAGAACAAAAAAGG - Intronic
937109394 2:119351440-119351462 ATATAAGAGCTGAAACAAGAAGG + Intronic
939462703 2:142517264-142517286 ATGTTGGAGCTGAATATTAAAGG + Intergenic
939655484 2:144819007-144819029 AACTGGGAGCTGAAAGAAAAAGG - Intergenic
940063690 2:149601664-149601686 ATGAAGGAGCTGCACAAAAAAGG - Intergenic
940200591 2:151145909-151145931 CTGTAGTAGTTAAAAAAAAAAGG - Intergenic
940346272 2:152631994-152632016 ATCTAAGAGCTGAAAACAAAAGG - Exonic
940610637 2:155986985-155987007 TTTTAGGAGCTGAATAAAACTGG - Intergenic
940690771 2:156917806-156917828 ATGAAGGAAGAGAAAAAAAATGG - Intergenic
941111406 2:161422209-161422231 ATGTGTGAGCTAAATAAAAAGGG + Intronic
941363556 2:164582386-164582408 AAATAAGAGCTGAAAATAAATGG - Intronic
941380150 2:164782977-164782999 ATGTAATATATGAAAAAAAATGG - Intronic
941503717 2:166313527-166313549 GTGAAGAAGCTGGAAAAAAAAGG - Intronic
941563371 2:167077425-167077447 ATGGAGCAGTTAAAAAAAAAAGG + Intronic
941975975 2:171405916-171405938 AAGGAGGAACAGAAAAAAAATGG + Intronic
942490193 2:176482250-176482272 ATGTTGGAGCTGAAAGGACAAGG - Intergenic
943301624 2:186209877-186209899 ATGTAGGAGAAGAAAAAAGTTGG - Intergenic
943708402 2:191060752-191060774 ATTTAAGAACTGAAAACAAAAGG - Intronic
943837660 2:192533989-192534011 ATGTTGGAGCTGGAAATGAAAGG + Intergenic
944776982 2:202976647-202976669 ATGCAGTATCTGAAAAAATATGG + Intronic
945111248 2:206361894-206361916 ATATGGGAGCTGAAACAAGAAGG + Intergenic
945118848 2:206437775-206437797 ATGTGGGATCTAAAAAATAAAGG + Intergenic
946020927 2:216639453-216639475 AAGGAGGAGCAGAACAAAAAGGG + Intronic
946321118 2:218955145-218955167 ATGTAGGAGCAGATCAAGAAGGG - Intergenic
946992530 2:225351420-225351442 ATGTAGGAAATGAAGAAAAATGG + Intergenic
947457749 2:230271039-230271061 CTCTAGGAGCTGAAAAGACAAGG + Intronic
947468085 2:230372053-230372075 CTCTAGAAGCTGAAAAAACAAGG + Intronic
947700029 2:232225748-232225770 ATGAAGGAGTACAAAAAAAATGG + Intronic
1168945673 20:1754959-1754981 ATGTGGGAACTAAAAAAAAATGG + Intergenic
1169406136 20:5322804-5322826 AAGTAAGAACTGGAAAAAAATGG + Intergenic
1170861077 20:20104399-20104421 GTGTCGGAGCTAAAAAACAATGG + Intronic
1170886633 20:20345443-20345465 AGGTAGAAGGTGAAATAAAATGG - Intronic
1171333185 20:24359267-24359289 ATGTAAGATTTCAAAAAAAAAGG - Intergenic
1173321373 20:41990170-41990192 AGGTAGGAGCAGAAAAGAAGGGG + Intergenic
1173539726 20:43842458-43842480 ATGTGGGGGCTGTAAGAAAAGGG - Intergenic
1173842963 20:46170733-46170755 ATGCAGGAGCTGGAAGCAAAGGG + Intergenic
1177434575 21:21034292-21034314 CTGTAGGAGCATACAAAAAAAGG + Intronic
1177437807 21:21079576-21079598 ATGCAGTGGCTAAAAAAAAAGGG - Intronic
1177564288 21:22797883-22797905 AAGTGAGAGCCGAAAAAAAATGG + Intergenic
1177656180 21:24020233-24020255 ATGTAGGAGCTGACAAAGCTTGG - Intergenic
1178036868 21:28594398-28594420 ATGTAGGAGATTAACAATAAGGG + Intergenic
1178049038 21:28728594-28728616 AAGTATTAGCTTAAAAAAAATGG + Intergenic
1178740131 21:35192030-35192052 ATCCAGGAGCTGATAAAATATGG - Intronic
1182662977 22:31938107-31938129 CTTTCAGAGCTGAAAAAAAAAGG + Exonic
1182682880 22:32096190-32096212 CTGTAGGATCTAGAAAAAAATGG - Intronic
949297810 3:2547063-2547085 ATGTAGGTGATAAAAATAAAGGG + Intronic
949364948 3:3270927-3270949 ATGTATGAGGAGAAAAAGAATGG + Intergenic
949691734 3:6648305-6648327 ATGTAGGAGGAAAATAAAAAAGG + Intergenic
949775582 3:7629070-7629092 ATGAAGGCTCTGTAAAAAAAAGG + Intronic
950182352 3:10924119-10924141 ATGTTGGAACAGAAAAAAAGGGG + Intronic
951025973 3:17830421-17830443 AAGTAGGAGCCAAAAAAAATTGG - Intronic
951093272 3:18599634-18599656 ATGAAGGAGCAGAAAAGCAAGGG - Intergenic
951272212 3:20640043-20640065 ATGAAGGAGGTTAAAGAAAAGGG - Intergenic
951350186 3:21597582-21597604 AGGTAGGACCATAAAAAAAATGG + Intronic
951846848 3:27093739-27093761 ATGTAGAAGTGGAAAAAATATGG + Intergenic
951951265 3:28201785-28201807 CTCTAGAAGCTGAAAAAACAAGG + Intergenic
951974357 3:28487831-28487853 ATGTAGGTGAAGAAAAAAAAGGG - Intronic
952191690 3:31029564-31029586 ATGTAGTGGCTGAAAAAACGTGG - Intergenic
952203486 3:31155635-31155657 AAGCTGGAGCTGAAAAATAAAGG - Intergenic
952540314 3:34360493-34360515 GTTTAGGAACTGTAAAAAAATGG - Intergenic
952637763 3:35552443-35552465 ATGTATTGGCTGAAATAAAAAGG + Intergenic
952646557 3:35666050-35666072 AAGTAGGAGCTGATTAAAAGTGG + Intronic
953043730 3:39277506-39277528 ATGGAGGAGCTGAACAAGGAGGG - Intronic
953047024 3:39303089-39303111 ATGTATGGGCTGAAAGTAAAGGG + Intergenic
953742622 3:45550534-45550556 TTGTAAGCGTTGAAAAAAAATGG - Intergenic
955779348 3:62467330-62467352 AATTAGGAACAGAAAAAAAAAGG + Intronic
956060752 3:65345696-65345718 ATTTAGCAGTTAAAAAAAAAAGG + Intergenic
956556473 3:70528789-70528811 ATGTAGGATTGGAAAAAAGATGG - Intergenic
956901860 3:73724967-73724989 ATATTGGAGCTGTAAAAATATGG + Intergenic
957272780 3:78053122-78053144 ATGCAGGAGGAGGAAAAAAATGG + Intergenic
958430278 3:94031948-94031970 ATGTAAGACCTGAAAAATACTGG + Intronic
958707623 3:97675848-97675870 ATGCAGGAGTTTAAAAAAAGTGG + Intronic
958842250 3:99220932-99220954 ATGTATGTGCTGAGAAGAAAAGG - Intergenic
959029255 3:101278948-101278970 AGGATGGAGCTGAAAAAAATGGG + Intronic
959437520 3:106334880-106334902 ATGGAGATGCTGGAAAAAAATGG - Intergenic
960068093 3:113397186-113397208 ATGGTGGAGCTGATAACAAAAGG + Intronic
960174164 3:114497519-114497541 ATGAAAGAGCAGAAAGAAAAGGG - Intronic
960926238 3:122797150-122797172 ATGTAGCTGCTAAAAAAGAAAGG + Intronic
961074570 3:123969894-123969916 ATGGATGATCTGAAAGAAAACGG - Intronic
961537636 3:127579744-127579766 ATGTAGAAGGTGATAAAAATGGG + Exonic
961587133 3:127940728-127940750 AATTAGAGGCTGAAAAAAAAAGG + Intronic
961850817 3:129816511-129816533 ATGTGGGAGCTAAAAAATAGTGG + Intronic
962384299 3:134920638-134920660 ATGGAGGAGCTGTAAAAAGAGGG + Intronic
963414172 3:144973279-144973301 ATATAGGATCTGAAAAAGTATGG + Intergenic
964097934 3:152955076-152955098 TGGTAGGTTCTGAAAAAAAAAGG - Intergenic
965738502 3:171848065-171848087 AAGTTGGAGAAGAAAAAAAATGG - Intronic
965924465 3:173959793-173959815 ATGTAGGAGCATAGAAAATATGG - Intronic
966111892 3:176413020-176413042 AAGGAGGAGATTAAAAAAAAAGG - Intergenic
967520789 3:190429981-190430003 ATTTAGGAGCTGAAACTAGAAGG + Intronic
969120472 4:4905333-4905355 ATGTGGGAGCTAAAGAAAAGTGG - Intergenic
970881068 4:20931713-20931735 ATGTAGAATCTTAAAAAAGAAGG + Intronic
971100487 4:23461065-23461087 AAGTGGGAGTTAAAAAAAAATGG + Intergenic
971154249 4:24064891-24064913 ATGTTGGAGTTCAAAAAATAAGG + Intergenic
971259494 4:25043402-25043424 AGGTAGAAGCTGAAAGAAGATGG + Intergenic
971399230 4:26260329-26260351 GTGTAGAAACTGAAAAATAAAGG + Intronic
971418353 4:26453799-26453821 AGGAAGGTGCTGCAAAAAAATGG - Intergenic
971973288 4:33649364-33649386 ATGTAACAGCTTAAAAAAAAAGG + Intergenic
972239611 4:37175862-37175884 ATGTAGAAGGTGAAGAAACATGG - Intergenic
973141660 4:46776692-46776714 CTGTAGCTGCTGAAATAAAATGG - Intronic
973266252 4:48214196-48214218 ATGTAGCCGGTGAGAAAAAAAGG + Intronic
973692277 4:53449067-53449089 AACAAGGATCTGAAAAAAAAAGG - Intronic
973825600 4:54703117-54703139 AAGCATGAGCTGAAAAGAAAAGG - Intronic
973935381 4:55841279-55841301 ATGAAGGAGCTAAAATATAAAGG + Intergenic
974104385 4:57452878-57452900 ATGAAGGATTTGAAAAAAACTGG - Intergenic
974775147 4:66470644-66470666 ATGTAAGACCTGAAACATAAGGG - Intergenic
976240307 4:82948747-82948769 ATGTGGAATCTGGAAAAAAATGG - Intronic
976245999 4:83006593-83006615 AAATAAAAGCTGAAAAAAAAAGG + Intronic
977190039 4:93987902-93987924 TTGTAGGTGCTGAGAATAAATGG - Intergenic
977244539 4:94615505-94615527 ATATAGAATCTGGAAAAAAAAGG + Intronic
977821865 4:101481143-101481165 ATGAAGGAGTTGAATAAAACAGG + Intronic
978229430 4:106380951-106380973 ATGTGGGAGCTAAAAAAAATTGG + Intergenic
978611165 4:110541858-110541880 ATGTATGAACTGAAAAATATAGG + Intronic
978612958 4:110564837-110564859 ATCTAGGAGCAGAAGAAACACGG - Exonic
978812534 4:112867102-112867124 ATGTAAGACCTCAAAAAAAAAGG - Intronic
979020212 4:115488318-115488340 ATTTAAGGGGTGAAAAAAAATGG + Intergenic
979773955 4:124563825-124563847 AGGTAGGAGCTGAAATCATAGGG - Intergenic
980114569 4:128666792-128666814 ATGTTGGAGGTAAGAAAAAATGG + Intergenic
980964175 4:139504464-139504486 CTCTTGAAGCTGAAAAAAAAAGG - Intronic
981561834 4:146056452-146056474 AGGCTGGGGCTGAAAAAAAATGG + Intergenic
982149799 4:152440683-152440705 ATATATGAGCTAACAAAAAAGGG + Intronic
982857176 4:160398269-160398291 ATGCAGGGGATGAAAAATAAGGG + Intergenic
984367794 4:178821077-178821099 ATGTAGCTTGTGAAAAAAAATGG + Intergenic
985997500 5:3605116-3605138 AAGTTGGAGGTCAAAAAAAAAGG + Intergenic
986408372 5:7449612-7449634 CTATAGGAGCTGGAAAGAAAAGG + Intronic
986454856 5:7907219-7907241 ATGTGGGAGCTAAAAAAAAGTGG - Intergenic
987189400 5:15458876-15458898 CTGTAAGACCTGAAAAACAAAGG - Intergenic
987227248 5:15855481-15855503 ACCTAAGATCTGAAAAAAAATGG - Intronic
987255583 5:16147380-16147402 ATTTAATAGCTGAAAAAAACTGG + Intronic
987860220 5:23476609-23476631 ATTGAGCAGCAGAAAAAAAAGGG + Intergenic
988587490 5:32520377-32520399 AAATAGAAGTTGAAAAAAAATGG + Intergenic
990610104 5:57448381-57448403 ATGAAGGAAGGGAAAAAAAATGG - Intergenic
990895010 5:60689720-60689742 ATGTAGAAGCAGAAATATAACGG + Intronic
991035875 5:62126951-62126973 ATGCAGCAGCAGAAAAAGAATGG + Intergenic
991346576 5:65674671-65674693 ATGTAGGAGTTGCAAAAGATGGG - Intronic
992681847 5:79161327-79161349 ATGTAGGAGCTGAAAAAAAAAGG + Intronic
992791838 5:80220774-80220796 AAGTAGTAACTGGAAAAAAAAGG + Intronic
992893407 5:81225664-81225686 CTGTGCGACCTGAAAAAAAAGGG - Exonic
993890527 5:93466808-93466830 ATGTAGGAGGTGAAAGAGAATGG - Intergenic
993918836 5:93774540-93774562 ATGTAAGAACTGAAACAAGAAGG - Intronic
994347017 5:98698847-98698869 ATGTAGGACTTGAAAATAAATGG + Intergenic
995203114 5:109448406-109448428 GAGTAGAAGCTGAAAAAAGATGG - Intergenic
995654444 5:114409417-114409439 ATATAAGAGGGGAAAAAAAAGGG - Intronic
995953371 5:117744150-117744172 ATGTAGGAGCTAAAAAAAATTGG - Intergenic
996455056 5:123672081-123672103 ATCATGGAGCAGAAAAAAAAAGG - Intergenic
996497553 5:124178424-124178446 ATGTAAAAACTCAAAAAAAAGGG - Intergenic
996516058 5:124370667-124370689 ATGTAAGAGATGAAAAAACTTGG - Intergenic
997379771 5:133427300-133427322 CTGTGGGAGCTGATAAAACAAGG - Intronic
997704817 5:135938826-135938848 AGGGATGTGCTGAAAAAAAATGG + Intronic
998738167 5:145167228-145167250 ATTTAAAAGCTGAAAAAAATCGG + Intergenic
1000694568 5:164364322-164364344 ATGTAGGAATTTAAAAATAATGG + Intergenic
1001379933 5:171298296-171298318 ATTTAGTAGCTGAAAAAGAGGGG - Intronic
1002120975 5:177004722-177004744 ATGGATGTGCTGAAATAAAATGG - Intronic
1003157691 6:3610046-3610068 ATTTAGGACCTGAGAAAAAAGGG + Intergenic
1003202926 6:3979043-3979065 GTGAAAGAGCTGAAAGAAAATGG + Intergenic
1003982193 6:11400554-11400576 ATGTGGGAGCTAAAAAAAAATGG + Intergenic
1004256212 6:14067222-14067244 ATGTAGTAGCTGTCAAAATAAGG + Intergenic
1004589665 6:17037055-17037077 ATGGAGTGGATGAAAAAAAAAGG + Intergenic
1004668771 6:17775695-17775717 ATGTAAAAGCTTAAATAAAATGG - Intronic
1005355663 6:24981004-24981026 CTGTAGGAGATGCAAAAACAAGG + Intronic
1005957800 6:30676800-30676822 AGGCAGGAGCTGTAAACAAAGGG + Exonic
1006657856 6:35612082-35612104 ATGTAGGAGATAAGAAAAAGAGG + Intronic
1008348049 6:50453899-50453921 ATGTAAGAGCTGTAAGAAAAAGG + Intergenic
1008872102 6:56284669-56284691 ATGTGGGAGCTAAGAAAGAATGG - Intronic
1009035400 6:58111871-58111893 ATGTAGCAGCTGGTAATAAAGGG - Intergenic
1009319822 6:62273884-62273906 ATAGAGGGGCTGAAAAATAAAGG - Intronic
1009375773 6:62966471-62966493 AAATAGAAGTTGAAAAAAAAAGG - Intergenic
1009412239 6:63379184-63379206 AACTAGGAGCTTTAAAAAAAAGG - Intergenic
1009554496 6:65145504-65145526 ATGTAAGAGGAAAAAAAAAAAGG + Intronic
1009609974 6:65929254-65929276 ATGGAGGATATGAATAAAAATGG + Intergenic
1009684752 6:66942802-66942824 AAGTTGGAGAAGAAAAAAAATGG + Intergenic
1009712596 6:67345258-67345280 TTGTAGAAGCTAATAAAAAAAGG + Intergenic
1009823253 6:68832017-68832039 ATGTTGGAACTTAAAAGAAAAGG - Intronic
1009996249 6:70898614-70898636 GTTTAGGAGCTGAAAAATCATGG - Intronic
1010705670 6:79106444-79106466 ATGTGGGAGCAGAAAAGAGAAGG + Intergenic
1011614198 6:89183114-89183136 ATGGAGGAGTTGAAGAGAAAGGG + Intronic
1011634076 6:89353681-89353703 ATGTAAAAGCTGTCAAAAAAAGG + Intergenic
1012503499 6:99917078-99917100 ATGTAAGAACTGAGAAAAATGGG - Intergenic
1012611166 6:101222691-101222713 ATGTGGGAGCTAAAAAAAAATGG - Intergenic
1013167679 6:107608317-107608339 ATGAATGAGATGAAAAAAATGGG + Intronic
1013996108 6:116310231-116310253 ATGTAGAGACTGAGAAAAAAAGG - Intronic
1014785965 6:125619612-125619634 ATCTGAGAGCTGAAAAAAGAAGG + Intergenic
1014807716 6:125849170-125849192 TTGTAGTAGCTGAATGAAAACGG - Intronic
1014858365 6:126431241-126431263 ATTCAGGAGGTGAAAAAGAAAGG - Intergenic
1015100438 6:129472274-129472296 ATGTAGGATCTGAATAAGCAAGG - Intronic
1015586796 6:134784605-134784627 ATGTAGAAGTTGTAAAAGAAAGG + Intergenic
1016157461 6:140829502-140829524 CAGCAGGAGTTGAAAAAAAAAGG - Intergenic
1016368734 6:143347703-143347725 AAGGAGGAGCTGTAAAAAGAAGG + Intergenic
1016695635 6:146991740-146991762 GAGTAGGAACTTAAAAAAAAGGG - Intergenic
1017592851 6:155995527-155995549 ATGTAGGAAAGGAGAAAAAAGGG - Intergenic
1018225938 6:161628978-161629000 AAGTGGGAGCTGAAACATAATGG + Intronic
1018273981 6:162110442-162110464 ATGTAGGAGCTGATTTAAAGGGG + Intronic
1018518767 6:164619030-164619052 GTGTAGAAGCTGAACAAAAGAGG - Intergenic
1019877321 7:3825516-3825538 ATGAAAGAGGTGAAAAAAACAGG - Intronic
1020239863 7:6385377-6385399 ATTTTGCAGGTGAAAAAAAAAGG + Intronic
1020511398 7:9061443-9061465 ATGTAGGAGCTGTGAAAACTGGG + Intergenic
1020972767 7:14966759-14966781 ATATTTGAGCTGACAAAAAAAGG - Intronic
1021526320 7:21592872-21592894 ATTTTGTAGCAGAAAAAAAAAGG + Intronic
1021715451 7:23457891-23457913 ATGTTGTATCTGAACAAAAAAGG + Intronic
1021782073 7:24116092-24116114 CTGAAGGAGCTGAGAAACAAAGG + Intergenic
1022547422 7:31201925-31201947 ATGTAGCATCTGAAAGGAAAGGG + Intergenic
1022634166 7:32116220-32116242 TTGTAGGTGCAGAAATAAAAGGG - Intronic
1024244791 7:47461058-47461080 ATGCTGGAGTTGAAAAAAAACGG + Intronic
1024794068 7:53002447-53002469 CTGTAGGAGCTCAAAGAGAAAGG + Intergenic
1024801853 7:53088371-53088393 GAGTAAGAGCTGGAAAAAAATGG + Intergenic
1025967307 7:66286549-66286571 ATGTAGGAGCTCTATCAAAATGG + Exonic
1026616613 7:71910651-71910673 ATGTAAGAACAGAGAAAAAAAGG + Intronic
1027481985 7:78709394-78709416 ATGTAGAAGCTTAGAAAAGAAGG - Intronic
1028200864 7:87959372-87959394 TTATAGGAGCTTAAAAAAAAAGG - Intronic
1028472551 7:91220853-91220875 TCGTAAGAGCTGTAAAAAAATGG + Intergenic
1028661307 7:93279399-93279421 ATAGAGGAGCTGAATAAAGAAGG + Intronic
1029025802 7:97416067-97416089 CTGTAGGAGCTAGAAAAACAAGG - Intergenic
1029184472 7:98728741-98728763 AAGGAGGAGCAGAAAAAAATGGG - Intergenic
1030214897 7:107034620-107034642 ATTTAGGAGCAGAAAAGAGAAGG - Intergenic
1030353725 7:108520360-108520382 ATGTAGGAGCTAAAAAAAATTGG + Intronic
1030388503 7:108895758-108895780 ATTTTGGAAATGAAAAAAAATGG - Intergenic
1030489249 7:110211428-110211450 CTGAAGGAGCTGAAAGAAACTGG - Intergenic
1030769899 7:113461722-113461744 ATGTAGTAGCAGAAAATAATAGG - Intergenic
1031235712 7:119173711-119173733 ATGAAGGAGCTGAAGAAAATTGG + Intergenic
1031438904 7:121768505-121768527 AAGCAGGAACTGAAATAAAAAGG + Intergenic
1031754678 7:125623781-125623803 ATGTAGGAGCTGTTAAAAATAGG - Intergenic
1032337539 7:131040083-131040105 ATCTAGAAGCTCAAAATAAAAGG + Intergenic
1033009716 7:137607847-137607869 ATGCAGGACTTGAAAACAAATGG + Intronic
1034031526 7:147771750-147771772 TTTTAGGAACAGAAAAAAAAAGG - Intronic
1034060716 7:148085535-148085557 ATTTGGGAGCTGAAAAACACGGG - Intronic
1034736849 7:153437231-153437253 ATGTATGTGCTGAAAACTAAAGG - Intergenic
1034787734 7:153940808-153940830 ATGTAAGATCTGAATAAAAGCGG + Intronic
1034824639 7:154250553-154250575 GTGTAGGAACTGTAGAAAAATGG + Intronic
1035838427 8:2784399-2784421 AGGTGGGAGATGAAATAAAAGGG + Intergenic
1035850796 8:2917426-2917448 ATGAATGGGCTGAAAAAATAAGG - Intergenic
1036111777 8:5910829-5910851 ATGTAGAAACTGAAAATCAAGGG - Intergenic
1036588983 8:10150782-10150804 ATGCAGGAGCTGAAGAGAAAAGG - Intronic
1037326330 8:17694768-17694790 ATTTAGGAGGTAAAAAAATAAGG + Intronic
1038049825 8:23798146-23798168 ATGTATGAGCTGAATTGAAAGGG + Intergenic
1038232528 8:25715764-25715786 ATGTAGGAGCTTTAAAAAAGTGG - Intergenic
1038547633 8:28437951-28437973 ATGTAGGAGCTGAAAATATGTGG + Intronic
1039444191 8:37617830-37617852 ATGTGGGAGCTCAAAAAATGTGG + Intergenic
1040348781 8:46541020-46541042 ATGTAGAGGGTGCAAAAAAAGGG - Intergenic
1040588145 8:48763809-48763831 AGGTAGGAGGCAAAAAAAAAGGG - Intergenic
1040591077 8:48792622-48792644 GTGCAGGTGCAGAAAAAAAAAGG + Intergenic
1040789795 8:51213735-51213757 ATGTAGTGGTAGAAAAAAAATGG - Intergenic
1041415243 8:57600733-57600755 ATGTGGGAGCTAAAAAAAGTTGG + Intergenic
1041789027 8:61670749-61670771 ATGCAGTGTCTGAAAAAAAAAGG + Intronic
1041930421 8:63280568-63280590 GTGTAGGAGCTCAATAAAAGAGG + Intergenic
1042124523 8:65524757-65524779 ATGTAGGAGTTGGGAAAAAAAGG - Intergenic
1043587870 8:81790647-81790669 ATATGGAATCTGAAAAAAAAAGG - Intergenic
1044082463 8:87902852-87902874 ATGTAGGGGCTAAAAAAAAATGG - Intergenic
1044641526 8:94387438-94387460 AAGTAGGAGCAGACAAAGAAAGG + Intronic
1045686899 8:104721844-104721866 ATGTAGAAGCATAAAACAAATGG + Intronic
1045777292 8:105820909-105820931 ATCAAGGAAATGAAAAAAAAAGG - Intergenic
1047187903 8:122651700-122651722 AAGTAAGAGAGGAAAAAAAAAGG - Intergenic
1047397186 8:124512016-124512038 ATGTAGTGTCTGAAAAATAATGG - Intronic
1047810789 8:128406495-128406517 CTGTAGTAGATAAAAAAAAATGG - Intergenic
1048423262 8:134297941-134297963 CTGAAGGAGATGAAAAAGAATGG + Intergenic
1048949957 8:139488351-139488373 AAATGGGAGCTTAAAAAAAATGG + Intergenic
1049383567 8:142329829-142329851 ATAAAAGAGCTTAAAAAAAAAGG + Intronic
1050079046 9:1895493-1895515 ATGTGGCAGATGAAAGAAAAGGG + Intergenic
1051273564 9:15377915-15377937 ATGAAGAAAGTGAAAAAAAAAGG - Intergenic
1051411974 9:16799119-16799141 TTGTAGAATCGGAAAAAAAAAGG - Intronic
1051441925 9:17093913-17093935 CTGTAGGAAATGAAAAATAATGG - Intergenic
1051570570 9:18553519-18553541 ATCTATGATCTGAGAAAAAATGG - Intronic
1051692417 9:19729641-19729663 ATGTAGAAGCTAAGAAAAAAAGG + Intronic
1052567567 9:30176032-30176054 ATGTGGGAGTTGAAAAAATGGGG + Intergenic
1052703803 9:31969966-31969988 ATGTTGTAGCTAAATAAAAAAGG + Intergenic
1053162501 9:35823205-35823227 CTGCATGAGCAGAAAAAAAAGGG - Intronic
1054755406 9:68952449-68952471 ATGTAGGAGATGACAAACAACGG - Intronic
1055277282 9:74633114-74633136 ATATTGGAGCTGAAGACAAAAGG + Intronic
1055821754 9:80273509-80273531 ATGTAGGACCTCAAAAATAGAGG + Intergenic
1055874117 9:80922364-80922386 ATGAAGGAGCAGTAAAAGAAGGG + Intergenic
1056108134 9:83367912-83367934 ATGGAGGAGAGGAAAAAAAGAGG - Intronic
1056274731 9:84983083-84983105 ATGCATGAGCTGAGGAAAAACGG + Intronic
1056387236 9:86107200-86107222 ATGTGGGGGCTAAAAAAAAGTGG + Intergenic
1057477946 9:95420378-95420400 ATGTTGGTTCTCAAAAAAAACGG + Intergenic
1057523685 9:95781136-95781158 ATGATGGAGTTGAAAAACAAAGG - Intergenic
1057574615 9:96232271-96232293 CTATAAGAGCTGAATAAAAAAGG + Intergenic
1057720210 9:97526198-97526220 ATGAATGAGCTGAGAAATAAAGG + Intronic
1058872460 9:109214404-109214426 ATCTGGGAGCTGAAAGAAAGAGG + Intronic
1060474826 9:123978869-123978891 AAGTAGGCGCTCAAAGAAAAAGG - Intergenic
1060476536 9:123991254-123991276 AAGTAGGCGCTCAAAGAAAAAGG + Intergenic
1060686786 9:125622065-125622087 ATGTGGGAGCTTAAAAAAACTGG + Intronic
1060988629 9:127835763-127835785 ATAAAGGAAGTGAAAAAAAAGGG + Intronic
1187075325 X:15929021-15929043 ATTTATGATATGAAAAAAAATGG + Intergenic
1188301668 X:28511763-28511785 CTGTAGGAGGTGAAAAAAATGGG + Intergenic
1188440363 X:30210002-30210024 TTGGAAGAGCTGAAAATAAAGGG + Intergenic
1188657244 X:32713525-32713547 ATATAGTAGCTGAAAGGAAAGGG - Intronic
1188748842 X:33881095-33881117 AAGGAGGAGAAGAAAAAAAAAGG - Intergenic
1188865375 X:35306829-35306851 ATGTTGGAGTTGGAAAATAATGG + Intergenic
1189125750 X:38444172-38444194 GTGTAAGAGCTGAAACAAATAGG + Intronic
1189388676 X:40557876-40557898 ATGTAGGAGCTGAGGGACAAAGG + Intergenic
1189621241 X:42840903-42840925 ATGTAAGAATTGAAAAAAATAGG - Intergenic
1190414714 X:50169599-50169621 ATGGAGCAGCTGACAAGAAAAGG - Intergenic
1190497852 X:51043853-51043875 ATGAAGGAGCAGACAAAAAAAGG - Intergenic
1190566423 X:51734512-51734534 ATGTAGCAGGTTAAAAAAAAAGG + Intergenic
1191936862 X:66436339-66436361 ATGTAGGGGATGATAAGAAAAGG + Intergenic
1192013159 X:67297425-67297447 ATGTAGTAGAAGAAAAATAAAGG + Intergenic
1192197962 X:69043584-69043606 ATCAAAGAGCTAAAAAAAAACGG - Intergenic
1192617004 X:72635931-72635953 ATTTAGTAGCTGAATAAAAAAGG + Intronic
1193181265 X:78459966-78459988 AAGTGGAAGCTAAAAAAAAAGGG - Intergenic
1193825709 X:86223412-86223434 ATGTAGGAGATTTAACAAAAAGG - Intronic
1194057237 X:89150985-89151007 GTGTTGGAGCTGAAAGAAACTGG - Intergenic
1194299603 X:92169278-92169300 TTGTAAGCTCTGAAAAAAAATGG - Intronic
1195861428 X:109387580-109387602 ATGTAGGAGGAGAAAAACAGTGG + Intronic
1195882982 X:109612016-109612038 ATGGTGGAGGTGAAATAAAAGGG - Intergenic
1196194781 X:112828178-112828200 ATTTAGGATGTGAAAAACAATGG + Intronic
1196243335 X:113369282-113369304 CTGTAGCAGCTGAACACAAAAGG + Intergenic
1196591768 X:117493781-117493803 AAATAGTAGCTGAGAAAAAATGG - Intergenic
1196627475 X:117892764-117892786 ATGTAGGGCCTGATCAAAAATGG - Intergenic
1196967110 X:121068397-121068419 ATATGAGAGCTGAAACAAAAAGG - Intergenic
1197005032 X:121485925-121485947 ATGTGGAAGCTGAAAATAAGTGG - Intergenic
1197104880 X:122702246-122702268 TTGAAGGAGATGAAGAAAAATGG + Intergenic
1197198088 X:123723597-123723619 ATGAATGAACTAAAAAAAAAAGG + Intronic
1197230539 X:123999273-123999295 ATGGTGGAGCTAAATAAAAAAGG - Intronic
1197370790 X:125623059-125623081 GTGTTGGAACAGAAAAAAAAAGG + Intergenic
1198175866 X:134153834-134153856 ATGAAGGAAATGAAAGAAAAGGG + Intergenic
1198417644 X:136436456-136436478 TTGTGGGAACTGGAAAAAAATGG - Intergenic
1198628843 X:138612024-138612046 TTCTAGGAGCTGAAAAATACAGG + Intergenic
1198795847 X:140393282-140393304 CTATACGAGCTGAAAAGAAATGG - Intergenic
1199819988 X:151435194-151435216 ATTTAGTAGTTAAAAAAAAATGG + Intergenic
1200617247 Y:5394439-5394461 TTGTAAGCTCTGAAAAAAAATGG - Intronic
1201181613 Y:11353219-11353241 ATATAGAAACTGAAAAAAAAAGG + Intergenic