ID: 992694181

View in Genome Browser
Species Human (GRCh38)
Location 5:79268395-79268417
Sequence CTATTTTAATAGGTATGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 990
Summary {0: 1, 1: 0, 2: 22, 3: 179, 4: 788}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992694176_992694181 15 Left 992694176 5:79268357-79268379 CCTCTAGCATTTTCTGATGTCAG 0: 1
1: 0
2: 2
3: 17
4: 205
Right 992694181 5:79268395-79268417 CTATTTTAATAGGTATGTATTGG 0: 1
1: 0
2: 22
3: 179
4: 788
992694175_992694181 21 Left 992694175 5:79268351-79268373 CCGCATCCTCTAGCATTTTCTGA 0: 1
1: 0
2: 1
3: 25
4: 282
Right 992694181 5:79268395-79268417 CTATTTTAATAGGTATGTATTGG 0: 1
1: 0
2: 22
3: 179
4: 788

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992694181 Original CRISPR CTATTTTAATAGGTATGTAT TGG Intronic
900750445 1:4393301-4393323 CTATTCTAATAAGTGTGTAGTGG - Intergenic
901176662 1:7305847-7305869 CTATTTTAATAGGCGTGTACTGG + Intronic
901342803 1:8510530-8510552 CTGTTTTAGGAGGTATGTAAAGG + Intronic
904984224 1:34531611-34531633 AGATTTTAATAGGTATGCAATGG + Intergenic
905329521 1:37183181-37183203 CCATTCTAATAGGTGTGTAGTGG - Intergenic
905926716 1:41755776-41755798 CTGTTTTAATAGCCATGTAGGGG - Intronic
906731684 1:48087232-48087254 CCATCTTAATAGGTGTGTAGTGG + Intergenic
906927675 1:50136578-50136600 ATATTTTAATGAGTATGTAAAGG - Intronic
907027936 1:51140253-51140275 TTATTTTAATGGGTATCTTTTGG + Intronic
907882088 1:58559935-58559957 CCATTCTAATAGGTGTGTAGTGG - Intergenic
908716393 1:67074692-67074714 ATATTGTAATAGGTGTGTAGTGG - Intergenic
909170750 1:72291138-72291160 CTCTTCTAATAGGTTTGTAGTGG + Intergenic
909205368 1:72749980-72750002 CTGTTTTAATAGGGCTGAATGGG + Intergenic
909242311 1:73229995-73230017 CTGTTTTAATAGGTGTGTAGTGG - Intergenic
909611770 1:77558387-77558409 CTATTCTAATAGATGTGTAGTGG + Intronic
910232633 1:85002108-85002130 CCATTCTAATAGGTGTGTAGTGG + Intronic
910554993 1:88521780-88521802 CTATTATTAGAGGTATGTATAGG - Intergenic
910768025 1:90802071-90802093 CCATTCTAATAGGCATGTAGTGG + Intergenic
910909996 1:92223346-92223368 CCATTATAATAGGTATGTAGTGG + Intronic
911276455 1:95865512-95865534 CTATTCTAATAGGTGTGTAGTGG + Intergenic
911403093 1:97401002-97401024 CTATTCTAATAGATGTGTAGTGG + Intronic
911703738 1:100986429-100986451 CTATTCTGATAGGTGTGTAGTGG - Intergenic
911723280 1:101214529-101214551 CCATTTTAATAGGTGTGGAGTGG - Intergenic
912010857 1:104960444-104960466 CCATTCTAATAGGCATGTAGTGG - Intergenic
912791209 1:112652713-112652735 CTATTTTAATAGGTTAAAATTGG + Intronic
912923181 1:113889019-113889041 CCATTTTAATAGGTGTGCAGTGG - Intergenic
912970774 1:114280857-114280879 CCATTGTAATAGGTATGTAGTGG - Intergenic
913235366 1:116776407-116776429 CCATTCTAATAGGTATGTAGCGG - Intergenic
913266838 1:117053591-117053613 CTTTTTTAGTAGGTATGAAGTGG - Intergenic
913280294 1:117179007-117179029 CTAATTTAATAGCAATGTAGTGG + Intronic
913309851 1:117478117-117478139 CCATTTTAATAGATGTGTAGTGG + Intronic
914976793 1:152372672-152372694 TTATCCTAATAGGTATGTAGTGG - Intergenic
916201365 1:162274520-162274542 CTATTCTAATATGTATATAGTGG + Intronic
916429492 1:164713318-164713340 CTATGATAAAAGGTATGTGTAGG + Intronic
916554182 1:165879005-165879027 CCATTTTAATAGGTATGTAGTGG + Intronic
916680584 1:167101278-167101300 ATATTTTAATAGTAATGTAACGG - Intronic
916865723 1:168855908-168855930 CCATTCTAATAGGTGTGTAATGG - Intergenic
917157078 1:172014485-172014507 CCATTCTAATAGGTGTGTAGTGG + Intronic
917590705 1:176473720-176473742 TCATTTGAATAGGTATGTAGTGG + Intronic
917877178 1:179296279-179296301 ACTTTATAATAGGTATGTATAGG + Intronic
917885052 1:179375901-179375923 CTATTTTTAAACGTATATATTGG - Intronic
917910066 1:179634377-179634399 CTATTTTAACAAATATGCATAGG + Intronic
918274080 1:182934378-182934400 CATTTCTAATAGGTATGTAATGG + Intronic
918326348 1:183414254-183414276 CTATTTTAATTTGTAGATATAGG - Intronic
918329047 1:183438778-183438800 CCATTCTAATAGGTATGTTGAGG - Intergenic
918416572 1:184314973-184314995 CTAATTTAAAAGGCATATATTGG + Intergenic
918665478 1:187145784-187145806 CCATTTTAATAGATGTGTAGTGG + Intergenic
918722402 1:187870023-187870045 CTATGCTAATAGATATGTAGCGG + Intergenic
919074981 1:192802520-192802542 CCATTTTAACAGGTGTGTATTGG - Intergenic
919406167 1:197187014-197187036 CCATTGTAATAGGTTTGTAGTGG - Intronic
919441950 1:197646099-197646121 ATATGTTTATATGTATGTATAGG - Intronic
919721341 1:200839831-200839853 TTATTTTAATAGGTGTTTAGGGG - Intronic
920162099 1:204006673-204006695 CCATTTTAATAGGTATGTAATGG - Intergenic
920265549 1:204719598-204719620 CTATTCTAATAGGTTTGTAGTGG + Intergenic
920890721 1:209982885-209982907 CCATTCTAATAGGTATGTGGTGG + Intronic
921014922 1:211180613-211180635 TAATATTAATAGGTATGTAGTGG + Intergenic
921344623 1:214169708-214169730 ATATATTAAAAGGGATGTATTGG + Intergenic
922055154 1:222035477-222035499 CCATTCTAATAGGTATGTAATGG - Intergenic
922657591 1:227399875-227399897 CCATTCTAATAGGTGTGTAGTGG + Intergenic
922997756 1:229979887-229979909 CCATTCTAATAGGTGTGTAGTGG - Intergenic
923466793 1:234255303-234255325 CTATTTTAATAGGTGTGTAGTGG - Intronic
923482105 1:234395320-234395342 CTCTTTTAATAGCTATGTGGAGG + Intronic
923618871 1:235560874-235560896 CCATTCTAATAGGTGTGTAGTGG + Intronic
923717753 1:236439539-236439561 CTATTGTAATAGGTATGTAGTGG + Intronic
924020866 1:239780318-239780340 CTATTCTAATAGGTGTGTAGTGG + Intronic
924049789 1:240069267-240069289 CCATTCTAATAGGTATGTAATGG + Intronic
924124423 1:240835392-240835414 CAATTCTAATAGGTGTGTAGTGG - Intronic
924184470 1:241473330-241473352 CCATTCTAATAGGTATGCAGTGG + Intergenic
924286051 1:242488022-242488044 CCTTTCTAATAGGTATGTAGTGG - Intronic
924888853 1:248252269-248252291 CCATTTTAATAGGTATAAAGTGG + Intergenic
1063259395 10:4368414-4368436 CCATTTTAATAGGTGTGTAGTGG + Intergenic
1063429133 10:5974430-5974452 CCATTCTACTAGGTATGTAGGGG - Intronic
1063571941 10:7223321-7223343 CCATTGTAATAGGTATCTAGTGG + Intronic
1063970703 10:11379506-11379528 CTAATTTAATGGGAAAGTATCGG - Intergenic
1064482975 10:15758035-15758057 CCATTCTACTAGGTATATATTGG + Intergenic
1065526394 10:26625670-26625692 CCATTCTAATAGGTATGTAGTGG + Intergenic
1066214458 10:33273064-33273086 CTATTTTTAAAAGTATGTGTGGG + Intronic
1066417553 10:35235483-35235505 CTATTTTAATTGTTATGTATCGG + Intergenic
1067203059 10:44191433-44191455 CCATTCTAACAGGTATGTAGTGG - Intergenic
1067347907 10:45450989-45451011 CCATTCTAATATGTATGTAGTGG - Intergenic
1067852878 10:49766262-49766284 AAATTATCATAGGTATGTATAGG + Intergenic
1067857783 10:49811464-49811486 CCATTCTAATAGGTATGTAGTGG + Intergenic
1067920315 10:50449010-50449032 AAATTTCAATAGGTATGTAGTGG - Intronic
1067926173 10:50510578-50510600 TTATTTTAATAGATGTGTAGTGG + Intronic
1067934456 10:50597278-50597300 CTATTCTAATAGGTGTGTAATGG - Intronic
1068185717 10:53583289-53583311 CTACTCTAATAGGTGTGTAGTGG - Intergenic
1068807869 10:61220016-61220038 CTATTCTAATAGGTGTGTGGTGG + Intergenic
1068931914 10:62599363-62599385 CTGTTTTATTAGGTATGTGGTGG - Intronic
1069107361 10:64399334-64399356 CCATTCTAATAGGTGTGTAGTGG + Intergenic
1069299487 10:66888672-66888694 CCATTCTAATAGGTGTGTAGTGG - Intronic
1069783533 10:70973146-70973168 CTGTTTTAATAAGTGTGTAGTGG - Intergenic
1070311545 10:75276922-75276944 TTATTTTAATAGGTATGTAGTGG + Intergenic
1070755641 10:78991401-78991423 CCATTTTACTAGATATGTATGGG - Intergenic
1071171555 10:82870622-82870644 TCATTTCAATAGGTATGTAATGG + Intronic
1071194751 10:83145033-83145055 CTTTTTAAAGAGGTGTGTATTGG + Intergenic
1071406661 10:85341056-85341078 CCATTTTTATAGGTGTGTATTGG - Intergenic
1071441278 10:85698837-85698859 CCATGTTAATAGGTGTGTAGTGG + Intronic
1071591673 10:86880396-86880418 CTATTTTAATATTTATTCATAGG - Intronic
1071850183 10:89560803-89560825 CCATTCTAATAGGTATGTAGTGG - Intergenic
1072107344 10:92286917-92286939 CTATTTTAATAATTCTGTAATGG - Intronic
1072512391 10:96140618-96140640 CCTTTTTAATAGGTAGGAATTGG - Intronic
1072831173 10:98660445-98660467 CTATTTTCAGAGGTATGGAAAGG - Intronic
1073956840 10:108882523-108882545 CTATTTTCATTGCTATGTAAAGG - Intergenic
1074131273 10:110579268-110579290 CTTTTTTTCTAGATATGTATTGG + Intronic
1074629620 10:115237420-115237442 CTATTCTAATATGTGTGTAGTGG + Intronic
1074644265 10:115427160-115427182 CCATTCTAATAGGTGTGTAATGG + Intronic
1074718634 10:116245381-116245403 CCATTCTAATAGGTGTGTAGGGG - Intronic
1075592212 10:123700414-123700436 CCATTTGAATGGGTATGTAGTGG - Intergenic
1075653964 10:124148990-124149012 CTATTTTTATAGTTATGTCTTGG - Intergenic
1076185555 10:128445465-128445487 CTATTTTCATAGGGATGTGTGGG + Intergenic
1077293220 11:1810156-1810178 CTATTCTAATAAATATGTAGTGG - Intergenic
1077683578 11:4269861-4269883 CCATTCTAATAGGTATGTAGTGG - Intergenic
1077686462 11:4296902-4296924 CCATTCTAATAGGTATGTAGTGG + Intergenic
1077691616 11:4348090-4348112 CCATTCTAATAGGTATGTAGTGG + Intergenic
1078173141 11:8945248-8945270 TCATTCTAATAGGTGTGTATTGG + Intergenic
1078388805 11:10917311-10917333 CTATTTTAAAAGGGAGGAATCGG + Intergenic
1078393203 11:10954594-10954616 CTATATTAATTGATATGGATTGG + Intergenic
1078667354 11:13337449-13337471 CTCTTTTAATAGATATGCACTGG - Intronic
1079072512 11:17359822-17359844 CCATTTTAATAAGTATATAGTGG + Intronic
1079421525 11:20294697-20294719 CTGTTTTAATAGGTGTGAAATGG + Intergenic
1079694621 11:23465105-23465127 CCATTCTAATAGGTGTGTAATGG - Intergenic
1080164319 11:29218738-29218760 CTATATAATTTGGTATGTATGGG - Intergenic
1080305956 11:30836516-30836538 CCATTCTAATAGGTGTGTAGTGG - Intronic
1080349233 11:31363516-31363538 GAATTCTAATAGGTATGAATGGG - Intronic
1080548374 11:33345100-33345122 ATATTATAATATGTAGGTATAGG + Intronic
1080868946 11:36220142-36220164 CCATCTTAATAGGTATTTAGTGG - Intronic
1081088421 11:38830172-38830194 CTATTCTAATAAGTGTGTAGTGG + Intergenic
1081113609 11:39170123-39170145 TTATTTTAATAGGTGTGAAATGG - Intergenic
1081339548 11:41910400-41910422 CAATTTTAATAGTTCTGTAGTGG + Intergenic
1081374344 11:42340867-42340889 CTATTTACAAAGGTATGAATTGG - Intergenic
1081628766 11:44672903-44672925 CTATTCTAATAGGTGTGTAGTGG - Intergenic
1082892048 11:58150150-58150172 CTATTCTAATGGGTATGAAATGG + Intronic
1083073693 11:60014793-60014815 CCATTCTAATAGGTGTGTAGTGG + Intergenic
1083111071 11:60407614-60407636 CTATTTTAGTGGGTATGTAGTGG + Intronic
1084278535 11:68070283-68070305 ATTTTTTAATAGGTATCTAAAGG - Exonic
1085500131 11:77013528-77013550 CTGTTTTAGTAGGTATGTAGTGG - Intronic
1086069384 11:82783135-82783157 CCATTCTAATAGGTGTGTATTGG + Intergenic
1086265273 11:84990657-84990679 GAATTTTAATAGGTATGTGGTGG - Intronic
1086361187 11:86061555-86061577 CCATTCTAATAGGTGTGTAGTGG - Intronic
1086760061 11:90618264-90618286 CTATTCTAATAGATATTTAGTGG + Intergenic
1087494654 11:98875106-98875128 TTTTTGTAATTGGTATGTATTGG + Intergenic
1087577573 11:100009269-100009291 CTATTTTAAGAGCTATTTCTAGG - Intronic
1087942354 11:104113806-104113828 CCATTCTAATAGGTATGTAGCGG + Intronic
1087984891 11:104665717-104665739 TCATTTTAATAGGTGTGTAGAGG - Intergenic
1087999795 11:104864009-104864031 CAATTATTATAGGTATGTAGTGG - Intergenic
1088140545 11:106610792-106610814 CCATTTTAATAGGTATGTAGGGG + Intergenic
1088324152 11:108585203-108585225 CCATTCTAATAGGTTTGTAGAGG - Intronic
1088705116 11:112455167-112455189 CCATTCTAATAGGTATGTAGTGG + Intergenic
1089803262 11:121056671-121056693 CTATTCTAATAGGTATATTGGGG + Intronic
1090053174 11:123398615-123398637 CCATTTTAATAGGTGTGTAGTGG + Intergenic
1090847322 11:130541376-130541398 CCATTTTAATAGGTGTTTAGTGG + Intergenic
1091033166 11:132209753-132209775 CAATTTTAATAGATGTGGATAGG + Intronic
1092292771 12:7173404-7173426 CTGTTCTAATATGTATGTAGTGG + Intergenic
1093427952 12:19050559-19050581 CAGTTCTAATAGGTATGTAGTGG - Intergenic
1093515139 12:19976722-19976744 TTATTTCAATAAATATGTATTGG - Intergenic
1093532126 12:20178223-20178245 CTTTTCTAACAGGTATGTAGTGG + Intergenic
1093591676 12:20909073-20909095 CCATTCTAATAGGTATGTAGTGG + Intronic
1093900762 12:24628812-24628834 CTATTCTAATAGGTGTGTAGTGG + Intergenic
1094047794 12:26186277-26186299 GTATGTTAATAGATACGTATAGG - Intronic
1094084088 12:26569990-26570012 CTATTTTAATAGTCATGAAATGG + Intronic
1094762744 12:33552668-33552690 CTATTCTAATAGGTGTGCAGTGG + Intergenic
1095175639 12:39089005-39089027 CAATTTAAATAGGTATGCCTAGG + Intergenic
1095428217 12:42102184-42102206 TTAATTTTATATGTATGTATAGG - Intronic
1095795013 12:46209641-46209663 CTATTTTAAAATCTATATATTGG + Intronic
1095835489 12:46633630-46633652 CCATTTTAATAGGCATGTATTGG + Intergenic
1096001834 12:48136719-48136741 CTATTCTGATAGGTATATAGTGG + Intronic
1096039766 12:48503719-48503741 CCATTCTAATAGGTGTGTAGTGG - Intergenic
1096039909 12:48505985-48506007 CTATTCTAACAGGTGTGTAGTGG - Intergenic
1096170509 12:49465387-49465409 CTATCTTAATAGATGTGTAATGG + Intronic
1096437237 12:51603752-51603774 CCATTCTAATAGGTGTGTAGTGG + Intronic
1097569391 12:61313967-61313989 ATATTTTAATTGTTATGAATTGG - Intergenic
1097576866 12:61405233-61405255 CTATTCTAATAGGTACGCAGTGG - Intergenic
1097932202 12:65200536-65200558 CCATTCTGATAGGTATGTAATGG + Intronic
1097989112 12:65816210-65816232 CCATTCTAATAGGTGTGTAGCGG - Intergenic
1098101514 12:67022624-67022646 CAATTTGAATAGATTTGTATAGG + Intergenic
1098604266 12:72371266-72371288 TGAGTTTCATAGGTATGTATAGG - Intronic
1098898761 12:76091383-76091405 CAATTCTAATAGGTGTGTAAGGG - Intergenic
1099242542 12:80154969-80154991 CCATTTTAATAGATATGTAGTGG + Intergenic
1099572012 12:84334441-84334463 CAATTCTAATAGGTATGTAATGG - Intergenic
1099629264 12:85119699-85119721 TTATTCTAATAGGTACGTAGTGG + Intronic
1099821197 12:87712656-87712678 CCACTCTAATAGGTGTGTATTGG - Intergenic
1100003404 12:89864973-89864995 CCACTTTAATAGGTGTGTAGAGG - Intergenic
1100181762 12:92093736-92093758 CTATTCTAATAGGTGTGTAGTGG + Intronic
1100840050 12:98603867-98603889 AAATTTTAATATGTATGTATTGG + Intronic
1100904658 12:99284112-99284134 CTACTTTACTAGGTAAGTTTCGG - Intronic
1101279054 12:103231999-103232021 CCATTCTAATAGGTGTGTAGTGG + Intergenic
1101318361 12:103650361-103650383 CTATTCTAATGGGCATGTGTAGG - Intronic
1101572700 12:105969507-105969529 CCACTTTAATAGGTATGTATTGG - Intergenic
1101649514 12:106662251-106662273 CCATTCTAATAGGTATGTAGTGG + Intronic
1102125769 12:110479330-110479352 ATATTGAAATAGATATGTATGGG - Intronic
1102325550 12:111979883-111979905 CCATTCTAGTAGGTATGTATTGG - Intronic
1102811757 12:115830432-115830454 CCATTCTAATAGGTGTGTAGCGG + Intergenic
1104003578 12:124875980-124876002 CTATATGAATAGGTGTGTCTGGG - Intronic
1104278147 12:127349796-127349818 CTATTCTAATAGGTGTGAAGTGG - Intergenic
1104280986 12:127376965-127376987 TAATTCTAATAGGTATGTAGGGG - Intergenic
1104299189 12:127548597-127548619 CCATTCTAATTGGTATGTAATGG - Intergenic
1105065123 12:133190485-133190507 CCATTCTAATAGGTGTGTAGTGG + Intronic
1105302257 13:19146564-19146586 CCATTATAATAGGTATGAAGTGG - Intergenic
1105340447 13:19518559-19518581 ATATTCTAATAGGTATCTAATGG - Intronic
1107179127 13:37437408-37437430 CCATTCTAATAGGTGTGTATTGG - Intergenic
1107495768 13:40924302-40924324 CTATATTAATAGCTATGTCATGG + Intergenic
1107839837 13:44445825-44445847 CTATTCTGATAGGTGTGTAGTGG - Intronic
1107847401 13:44530800-44530822 CTACTCTAATAGGTGTGTAGTGG - Intronic
1108211790 13:48146864-48146886 CCATTCTAATAGGTATGTAGTGG + Intergenic
1108315921 13:49237480-49237502 CCATTGTAATAGGTATATAGTGG - Intergenic
1108531760 13:51333491-51333513 CCATTTTAATATGTGTGTAGTGG - Intergenic
1108635015 13:52324685-52324707 ATATTCTAATAGGTATCTAGTGG - Intergenic
1108652789 13:52498507-52498529 ATATTCTAATAGGTATCTAGTGG + Intergenic
1108843936 13:54655179-54655201 CTATTTTAATTAAAATGTATAGG + Intergenic
1108868557 13:54952741-54952763 CCATTCTAATAGTTGTGTATTGG - Intergenic
1108876138 13:55053583-55053605 CTGTCTTAATAGGTATGTGGTGG - Intergenic
1109087436 13:57992854-57992876 CTATTCTAACAGGTATGTAGTGG + Intergenic
1109321176 13:60811722-60811744 CTCTATCAGTAGGTATGTATGGG + Intergenic
1109588864 13:64448164-64448186 CTAATTTAATGGGTAATTATTGG + Intergenic
1109608717 13:64734627-64734649 CTATTCTAATATGTATGTAAAGG + Intergenic
1109632690 13:65072779-65072801 CCATTCTAATAGGTATGCAGTGG - Intergenic
1110009901 13:70318945-70318967 TTATTCTAATGGGTATGTAGTGG + Intergenic
1110703327 13:78575504-78575526 CTATTGTAATAGGCATGATTTGG - Intergenic
1110713524 13:78675737-78675759 CCATTGTAATAGGTGTGTAGTGG + Intergenic
1110935761 13:81286274-81286296 CTATATTAATAGGTGTATAGTGG + Intergenic
1111039363 13:82725133-82725155 CTATTTTATTAAGTGTGTACTGG + Intergenic
1111058721 13:82983752-82983774 TTATTTAAATAGGTATATTTGGG - Intergenic
1111203977 13:84979617-84979639 ATATTTTAATTGATATGTAATGG + Intergenic
1111734626 13:92122088-92122110 CTATTTTAATTGCTATATTTCGG - Intronic
1111751572 13:92338244-92338266 CCATTCTAATACGTATATATTGG - Intronic
1112292157 13:98154338-98154360 CCATTTTAACAGGTGTGTAGTGG + Intronic
1112545125 13:100360617-100360639 ACATTCTAATAGGTATGTAGTGG - Intronic
1112762345 13:102705692-102705714 CCATTCTAATAGGTATATAGTGG - Intergenic
1112960105 13:105113676-105113698 CCATTTTAATAGGTGTGTAGAGG - Intergenic
1112982919 13:105409010-105409032 ATATTTTTATATGTATGTTTTGG - Intergenic
1113434027 13:110275356-110275378 CCACTTTAATAGGTGTGTACTGG - Intronic
1113545043 13:111142015-111142037 CCATTCTAATAGGTATGCAGTGG + Intronic
1114160450 14:20160194-20160216 CTGTTCTAATAGGTATGTAGTGG + Intergenic
1114160460 14:20160369-20160391 CTATTCTAATAGATATGTAGTGG + Intergenic
1114168991 14:20252675-20252697 CCATTTTAATGGGTGTGTAGTGG - Intergenic
1114175448 14:20315234-20315256 CCATTTTAATAGGTGTATAGTGG - Intronic
1114812993 14:25922610-25922632 CTATTTGAATAGGTGTGTTGGGG + Intergenic
1115093795 14:29610471-29610493 CAATTCTAATAGGTGTGTAATGG - Intronic
1115138457 14:30140339-30140361 CTATTTATATAGGTCTTTATTGG - Intronic
1115139405 14:30152395-30152417 GTATTATAATAGGTATGTGATGG - Intronic
1115169499 14:30488287-30488309 CCATTCTAATAGGTGTGTAGTGG - Intergenic
1115411932 14:33084910-33084932 TTATTTTAATGGGGATGTTTTGG + Intronic
1115621020 14:35140379-35140401 CTGTTCTAATAGGTATGAAGTGG + Intronic
1115639967 14:35329013-35329035 CCATTCTAATAGATATGTAGTGG - Intergenic
1115829768 14:37324252-37324274 CTATTTTAGTAGGCATGTATTGG + Intronic
1116902371 14:50373725-50373747 CCATTCTAATAGGTGTGTAATGG - Intronic
1117051438 14:51864202-51864224 CCATTTTAAGAGGTATGAAGTGG + Intronic
1117259230 14:54013430-54013452 CCATTCTAATGGGTATGTAGTGG + Intergenic
1117533557 14:56682561-56682583 CCATTCTAATAGATATGTAATGG + Intronic
1117808533 14:59520253-59520275 TCATTTTAATAGGTATGTAATGG - Intronic
1117838702 14:59834807-59834829 CCATTCTAATAGGCATGTAGTGG - Intronic
1117902157 14:60545679-60545701 CCATTCTAATAGGTTTGTAGTGG + Intergenic
1118082646 14:62379289-62379311 CCATTCTAACAGGTATGTAGTGG - Intergenic
1118083093 14:62384715-62384737 CTATTCTAATAGGTGTGTAGTGG + Intergenic
1118131676 14:62972302-62972324 CTATTCTAACAGGTGTGTAGTGG - Intronic
1118268588 14:64319729-64319751 CCATTTGAATAGGTGTGTAGTGG - Intronic
1118407831 14:65444248-65444270 CTTTTCTAATAGGTAAGTAATGG - Intronic
1118829332 14:69415315-69415337 CCATTTTAATGGGTATGAAAAGG + Intronic
1118901014 14:69985918-69985940 CCTTTATCATAGGTATGTATGGG + Intronic
1119063245 14:71498025-71498047 CCATTTTAATAGGTGTGAGTGGG + Intronic
1119146709 14:72322909-72322931 CCATGTTACTAAGTATGTATTGG - Intronic
1119629947 14:76221297-76221319 CCATTGTAATAGGTATGTCATGG - Intronic
1119868936 14:77996811-77996833 TCATTCTAATAGGTATGTAGTGG + Intergenic
1119932259 14:78559159-78559181 CTATTGTAATGGGTATCTCTAGG - Intronic
1120662255 14:87264330-87264352 CTATTTTTATAGTTATTTCTTGG + Intergenic
1120738860 14:88085542-88085564 TTATTTTAATATTTATGTGTAGG - Intergenic
1120895458 14:89527678-89527700 CCATTGTAATAGGAATGTAATGG - Intronic
1120928125 14:89818830-89818852 CCATTTTTATAGGCATGTAGTGG - Intronic
1122360378 14:101156749-101156771 CCATTTTAATAGGCGTGTAGAGG + Intergenic
1122769078 14:104089541-104089563 CCATTCTAACAGGTATGTAGTGG - Intronic
1202894510 14_KI270722v1_random:191598-191620 CCATTCTACTAGGTATGTAGCGG + Intergenic
1123466640 15:20521296-20521318 GTATTTTAATAGGTGATTATTGG + Intergenic
1123651474 15:22479745-22479767 GTATTTTAATAGGTGATTATTGG - Intergenic
1123741892 15:23288606-23288628 GTATTTTAATAGGTGATTATTGG - Intergenic
1123745104 15:23313952-23313974 GTATTTTAATAGGTGATTATTGG + Intergenic
1123761427 15:23435881-23435903 GTATTTTAATAGGTGATTATTGG + Intergenic
1124246519 15:28075375-28075397 CCATTTTAATAAGTATTTAGAGG - Intronic
1124277374 15:28337272-28337294 GTATTTTAATAGGTGATTATTGG + Intergenic
1124305328 15:28574334-28574356 GTATTTTAATAGGTGATTATTGG - Intergenic
1124398481 15:29327731-29327753 CCATTGTGATAGGTATGTAATGG - Intronic
1124436770 15:29656656-29656678 CCATTTTAATACGTGTGTACTGG - Intergenic
1125043980 15:35224758-35224780 CTGTTCTAATAGGTGTGTAGTGG + Intronic
1125096668 15:35861483-35861505 CCATTCTAATAGGTGTGTAGTGG + Intergenic
1125290794 15:38144170-38144192 CTATTCCAATAGGTATGTAGAGG - Intergenic
1125312293 15:38393186-38393208 CCATTCTAATATGTATGTAGTGG - Intergenic
1125431566 15:39599905-39599927 CTATTTTCAGAGGTATTGATAGG - Intergenic
1125843474 15:42828345-42828367 CTATTTTAAAAAGTAGGGATTGG - Intronic
1126183461 15:45808636-45808658 CAAGTTTAATAGATGTGTATTGG - Intergenic
1126279779 15:46931431-46931453 CTACTCTAATAGGTATGTAGTGG + Intergenic
1126296890 15:47149309-47149331 CCATTCTAATAGGTGTGTAGTGG - Intergenic
1126537767 15:49784865-49784887 CCATTCTAATAGGTATATAGTGG + Intergenic
1126642071 15:50838167-50838189 CCATTATAATAGGTGTGTAATGG + Intergenic
1126821634 15:52510284-52510306 TTATTTTAAAATGTATATATTGG - Intronic
1128470929 15:67952272-67952294 ACATTCTAATAGGTATGTAATGG - Intergenic
1129021426 15:72522945-72522967 CCATTCTAATAGGTATGTACTGG - Intronic
1129047134 15:72745585-72745607 GCATTCTAATAGGTATGTAGTGG - Intergenic
1129224662 15:74161916-74161938 CTATTCTAATAGATGTGTAGTGG + Intergenic
1129647614 15:77451450-77451472 CCATTCTAATAGGTTTGTAGTGG + Intronic
1129985580 15:79917507-79917529 CTATATTAATTGGTAGGAATTGG - Intronic
1129996739 15:80013354-80013376 CCATTCTAATAGGTGTGTAGTGG - Intergenic
1130249419 15:82287774-82287796 CCTTTTTAGTAGGTATGTAGTGG - Intergenic
1130703115 15:86205642-86205664 TCATTGTAATAGGTATGTATTGG + Intronic
1131320095 15:91380415-91380437 CCATTCTAATATGTATGTATTGG + Intergenic
1131363115 15:91812778-91812800 CCATTCTAATAGGTATGTAGTGG - Intergenic
1131409641 15:92196351-92196373 CTATTTTATTATGCATGTAAGGG - Intergenic
1131904116 15:97122938-97122960 CCATTTTAATAGGCGTGTAGTGG - Intergenic
1131933412 15:97472791-97472813 CTATTTTAGTATGTATGTAATGG + Intergenic
1132032991 15:98453907-98453929 CTATTCTAATAGGTGTGTAGTGG - Intronic
1132306428 15:100817662-100817684 CCATTTTAATAGGCATGTAATGG - Intergenic
1135273813 16:21093085-21093107 CCATTTTAATAGGTGTGTAGTGG - Intronic
1135333515 16:21581753-21581775 CTATTCTAATTGTTATGTACGGG - Intergenic
1135948411 16:26887294-26887316 ACATTCTAATAGGTATGTAGTGG - Intergenic
1137316962 16:47335681-47335703 CTATTTTATTTGGTGTGTAGTGG - Intronic
1137345871 16:47658872-47658894 CTGTTCTTATAGGTATGTGTAGG - Intronic
1137473334 16:48782788-48782810 CTACATTAATAGGTATGCAGTGG + Intergenic
1138176877 16:54908387-54908409 CTATTTTAATAGGTGTGTAGTGG - Intergenic
1138306903 16:55985785-55985807 CCATTCTAATAGATATGTAGTGG + Intergenic
1138327514 16:56188250-56188272 TTATTTAAATATGTATGCATTGG - Intergenic
1138355733 16:56378890-56378912 CTATTCTAATATATATGTAGTGG - Intronic
1138879744 16:60997181-60997203 CCATTGTAATAGGTGTGTACAGG + Intergenic
1138907721 16:61357858-61357880 CCATTTTAATAGGTATGGACTGG - Intergenic
1138941067 16:61790801-61790823 CTATCTTCATAGGTAGGTATAGG - Intronic
1139051918 16:63134389-63134411 GTTTTTTAATGAGTATGTATAGG - Intergenic
1139129187 16:64119519-64119541 CTATTATAAAAGGTATGGACAGG - Intergenic
1139362765 16:66412474-66412496 CCATTATAGTAGGTATGTAGTGG - Intergenic
1139702524 16:68717264-68717286 CCATTCTAATAGGTAGGTAGTGG - Intronic
1139721292 16:68857707-68857729 CCATTCTAATAGGTATATAATGG + Intronic
1139809932 16:69606020-69606042 TTCTTTTAATAGGAATGTTTTGG + Intronic
1140061580 16:71574844-71574866 CTAATTTAATAGGTATAGATGGG + Intronic
1140461671 16:75145226-75145248 CCATTCTAATAGGTATGTAGTGG - Intergenic
1141241555 16:82269773-82269795 GTATTTTGATAGGCATATATGGG + Intergenic
1141340244 16:83196741-83196763 CTGTTCTAATAGGTGTGTACCGG - Intronic
1141355804 16:83345656-83345678 ATACTTTAATTTGTATGTATTGG - Intronic
1143386355 17:6533284-6533306 CCATTCTAATAAGTAGGTATTGG + Intronic
1144803421 17:17947690-17947712 CTATTTTTAAAAGTATGTGTCGG - Intronic
1144868291 17:18351444-18351466 CTCTTTTAAAAGGTAATTATTGG - Intronic
1148010864 17:44480260-44480282 CCATTTTAATAGGCATGTGGTGG - Intronic
1148691665 17:49531045-49531067 CCATTCTAATAGGTATGTAGTGG + Intergenic
1149443531 17:56695514-56695536 CCATTCTAATAGGTATGTAGTGG + Intergenic
1149735709 17:58991673-58991695 CCATTCTAATAGGTGTGTAATGG - Intronic
1149899971 17:60466238-60466260 CTGTTTTTATAGGTACTTATTGG + Intronic
1149937435 17:60822285-60822307 CTATTTTAATAAATATGCAGTGG + Intronic
1150172983 17:63019527-63019549 CTATTTTGATAGGTATATAGAGG + Intronic
1150542700 17:66119914-66119936 CCATTATAATAGGTGTGTAGTGG + Intronic
1150580038 17:66464560-66464582 CCATTCTAATAGGTGTGTAGTGG + Intronic
1150673806 17:67226455-67226477 CCATTCTAATAGGTATGTAGTGG - Intronic
1150689097 17:67348311-67348333 GCATTTTAATAGGTATGTAGTGG + Intronic
1150906488 17:69344042-69344064 CCATTTTTATAGTTATGTAAAGG - Intergenic
1152054379 17:78011841-78011863 CCATTCTAATAGGTATGTAGTGG + Intronic
1152254877 17:79232818-79232840 CCATTTGACTAGGTATGTAGCGG - Intronic
1152910077 17:82998933-82998955 CTAATCTAGTAGGTATGTAGTGG - Intronic
1153111300 18:1591921-1591943 CCATTCTAATAGGTATGTAGTGG - Intergenic
1153592541 18:6688786-6688808 CCATTCTAATAGGTACGTAGGGG - Intergenic
1153663526 18:7347628-7347650 TCATTTTAATAGGTGTGTAGTGG - Intergenic
1154380076 18:13841488-13841510 CTATTTCAAAAGGTATATTTAGG - Intergenic
1154993231 18:21615935-21615957 CCATTTTAGTGGGTATGTAGTGG + Intronic
1155691137 18:28624401-28624423 ATATTTTAATAGGTATTAGTGGG - Intergenic
1156146561 18:34188007-34188029 CCATTCTAATAGGTAGGTAGTGG + Intronic
1156618782 18:38823060-38823082 CCATTCTAATAGGTGTGTAGTGG - Intergenic
1156884303 18:42116514-42116536 CCATTCTAATAGGTATGCAGAGG + Intergenic
1157072731 18:44428237-44428259 CCATTCTAATAGGTATGCAATGG + Intergenic
1157390450 18:47298120-47298142 CTATCCTAGTAGGTATGAATTGG + Intergenic
1158030329 18:52955736-52955758 CTATTCCAATAGGTTTGTAATGG + Intronic
1158129366 18:54135885-54135907 CTATTTTAAAATGTATAGATGGG - Intergenic
1158636558 18:59163709-59163731 CCATTCTAATAGGTATGTCATGG + Intergenic
1158826791 18:61230091-61230113 CCATTTTAATAGGTATGAAGTGG - Intergenic
1158937460 18:62377580-62377602 CCATTCTAATAGGTGTGTAGTGG + Intronic
1159165064 18:64688239-64688261 CCATTTTAATAGGTGTGAAGTGG - Intergenic
1159866089 18:73706989-73707011 CCATTTTAATAGGTATGTTATGG - Intergenic
1159998204 18:74988774-74988796 CTATTTTGATGGGTATGTAGTGG - Intronic
1160129942 18:76216304-76216326 CAATTTTAATAGGTGTGCACTGG + Intergenic
1164456484 19:28411729-28411751 CTATGTTAAAAGGGATTTATGGG - Intergenic
1164665544 19:30031482-30031504 CTATTCTAATAGGTGTGTAGTGG + Intergenic
1164817070 19:31212547-31212569 CTATTTTAACAGGGGTGTAGTGG - Intergenic
1164838720 19:31376237-31376259 TCATTTTAATAGGTATATAGTGG + Intergenic
1166179513 19:41097455-41097477 CCATTCTAATAGGTAGGTAACGG - Intergenic
1166629857 19:44396778-44396800 AGATTTGAATGGGTATGTATTGG - Intronic
1166637596 19:44464641-44464663 AGATTTGAATGGGTATGTATTGG + Intergenic
1168150584 19:54445567-54445589 GCATTCTAATAGGTATGTAGTGG - Intergenic
1168161136 19:54510648-54510670 TTATTTGTATATGTATGTATAGG - Exonic
1168638095 19:58011925-58011947 CAATTCTAATAGGTGTGTATTGG + Intergenic
924975320 2:168526-168548 CCATTCTAATAGGTGTGTAGTGG - Intergenic
925469641 2:4145159-4145181 CCATTTTAATGGGCATGTAGTGG + Intergenic
925791575 2:7493650-7493672 CCATTTTAACAGGTATGTCATGG - Intergenic
926400317 2:12489941-12489963 ATATTTTCATAAGTATGTATGGG - Intergenic
926436418 2:12843039-12843061 CTATTCTAATAGGTGTGTAGTGG - Intergenic
927023759 2:19044352-19044374 CTATTTTTAAAAGTTTGTATAGG + Intergenic
927414246 2:22860760-22860782 CTATTCTAATAGGTATGTGCTGG + Intergenic
927536501 2:23865169-23865191 AAACTTTAATAGGTATCTATAGG + Intronic
928008742 2:27587219-27587241 CTAATTTAATGGGTGTGTAGTGG + Intronic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
928131217 2:28651902-28651924 TTATTTTAATAGTTATATTTTGG + Intergenic
928608423 2:32966022-32966044 CCATTCTAATAGTTATGTAGTGG + Intronic
928936238 2:36681372-36681394 CCATTTTAATATGTGTGTAGTGG + Intergenic
929767878 2:44864932-44864954 CCATTCTAATAGGTGTGTAGCGG - Intergenic
929861968 2:45685972-45685994 CTATTTTAAAATTTAAGTATAGG + Intronic
929900302 2:45994979-45995001 CCATTTTAATAGGTGTGTAGTGG + Intronic
930117058 2:47727171-47727193 CTATTCTAATAGATGTGTAGTGG + Intronic
930941068 2:57014732-57014754 CCATTCTAGTAGGTATGTAGTGG - Intergenic
930967331 2:57345778-57345800 CTATTTATAAAGGTAAGTATTGG + Intergenic
931424134 2:62155606-62155628 CCATTTTAATGAGTATGTAGTGG + Intergenic
931598133 2:63973219-63973241 CTATTCTAATAGATATGTAGTGG + Intronic
931667528 2:64620889-64620911 CCATTATAATAGGTGTGTAGTGG - Intergenic
931737501 2:65210455-65210477 ATATTTTAATAGGTATGTAATGG + Intergenic
931851379 2:66254626-66254648 ATATTTTACTAGGTATGTTTTGG + Intergenic
932643738 2:73479907-73479929 TCATTCTAATAGGTATGTAGTGG + Intronic
932719433 2:74127738-74127760 ATAGCTTAATAGGTTTGTATAGG + Intergenic
932786467 2:74608773-74608795 CCATTTTAATAGGTATGTGGTGG + Intronic
932829584 2:74976308-74976330 CCATTATAATAGGTGTGTAGGGG + Intergenic
933013894 2:77099595-77099617 TTATTTTATTAGGTGTATATTGG + Intronic
933106769 2:78337996-78338018 CTATTCTAATAGGCACGTAGTGG + Intergenic
933134080 2:78710006-78710028 ACATTTTAATAGGTATGTAATGG - Intergenic
933212214 2:79583720-79583742 CCATTTTAATAGGTATGAAGTGG + Intronic
933352618 2:81174250-81174272 CCATTCTAATAGGCATGTAGTGG + Intergenic
934062535 2:88308639-88308661 CCATTTTAATAGGTATGTAGTGG - Intergenic
934120697 2:88836281-88836303 CTATTTTAAAACGTATCTTTTGG + Intergenic
934479941 2:94627904-94627926 CCACTTTATTGGGTATGTATTGG + Intergenic
934722369 2:96589824-96589846 CCATTCTAATAGGTGTGTAGTGG - Intergenic
935081404 2:99800372-99800394 ACATTCTAATAGGTATGTAGTGG - Intronic
935551071 2:104454822-104454844 CCATTCTAATATGTATGTAGTGG + Intergenic
935886754 2:107628992-107629014 CAATTCTAATAGGTATGTGGTGG + Intergenic
935889726 2:107663294-107663316 CCATTCAAATAGGTATGTAATGG - Intergenic
936245569 2:110823653-110823675 CCATTCAAATAGGTATGTAGTGG + Intronic
936277716 2:111114876-111114898 CTATATTAATATGTATATTTGGG - Intronic
936487518 2:112939012-112939034 CTATGTTCATAGGTAAGTCTGGG + Intergenic
937448433 2:121978273-121978295 CTATTCTAACAGGTGTGTAGTGG + Intergenic
937481937 2:122270646-122270668 CCATTCTAATAAGTATGTATTGG + Intergenic
937901605 2:127023923-127023945 CTGTTTTAATGGTTATCTATTGG + Intergenic
937922306 2:127139014-127139036 CTATTTTAAGAGGTACCAATGGG + Intergenic
939025290 2:137006090-137006112 CTGTTTTAATAAATACGTATAGG + Intronic
939090007 2:137769124-137769146 CCATTTGAATAGGTAGGTAGTGG + Intergenic
939173887 2:138727416-138727438 CCATTCTAATAGGTGTGTAGTGG + Intronic
939237051 2:139508205-139508227 CCATTCTAATAAGTATGTAGTGG - Intergenic
939313377 2:140513919-140513941 CTATTTTTATAGATGTCTATTGG - Intronic
939415753 2:141894736-141894758 CTTTCTTAATGGGTATATATAGG - Intronic
939751795 2:146057074-146057096 CCATTTTAATAGATGTGTAGTGG - Intergenic
939754289 2:146090632-146090654 CTATGATAATAGATATGTAATGG + Intergenic
939798024 2:146672121-146672143 TTATTTTAATAGGTGTGTAGTGG - Intergenic
939910118 2:147971558-147971580 CCATTCTAATAGGTATATATTGG - Intronic
939936546 2:148300022-148300044 CTTATTCAATAGGTATGTACTGG - Intronic
940110922 2:150152954-150152976 CTATTTCAATGAGTATGTAGAGG - Intergenic
940200515 2:151144909-151144931 TTATTCTAATAGGTGTGTAGTGG - Intergenic
940852152 2:158698550-158698572 CCATTCTAATAGGCATGTAGTGG - Intergenic
940878809 2:158925045-158925067 CTATTCTAATAGGTGTATAGTGG + Intergenic
941474731 2:165936748-165936770 CCATTCTAATAGGTTTGTAGTGG - Intronic
941645697 2:168038848-168038870 CCATTTAAATAGGTGTGTAGTGG - Intronic
941837061 2:170034861-170034883 CCATTCTAATAGGAATGTAGTGG + Intronic
942137304 2:172939343-172939365 CCATTCTAATAGATATGTAGTGG + Intronic
942287087 2:174430293-174430315 CCATTCTAATAGGTGTGTAATGG + Intergenic
942526546 2:176859312-176859334 CCATTCTAATAGGTATATGTTGG - Intergenic
942594353 2:177578679-177578701 CCATTCTAATAGGTGTGTAGTGG + Intergenic
942796779 2:179830160-179830182 CTATTCTAATAGATATGTAGTGG - Intronic
942895936 2:181054425-181054447 CCATTCTAATAGGTGTGTAGTGG + Intronic
943857330 2:192814175-192814197 CCATTCTAATAGATATGTAGTGG + Intergenic
943861701 2:192873427-192873449 CCATTCTAATAGGTATGCAATGG - Intergenic
943921993 2:193719821-193719843 TTATTTAAATAGTTATTTATTGG + Intergenic
943928964 2:193825104-193825126 CTATTGTAATAGGTGTGTGGTGG - Intergenic
943943323 2:194026448-194026470 CCATTTCAATAGGTATCTATGGG + Intergenic
944075060 2:195720275-195720297 TTATTTTAGTTGGTATTTATTGG + Intronic
944161996 2:196672088-196672110 CCATTGTAATAGGTGTGTAGTGG + Intronic
944467022 2:200012199-200012221 CTATTTCTATAATTATGTATTGG - Intergenic
944562208 2:200951551-200951573 CTATTCTAATAGGTGTATAGTGG + Intronic
944992874 2:205257552-205257574 CTATTTTAAATGGTTTATATGGG + Intronic
944996087 2:205295622-205295644 ATTTTTTAATATGGATGTATTGG + Intronic
945077535 2:206054944-206054966 CTAATTTAAAATATATGTATAGG - Intronic
945639228 2:212401830-212401852 CCATTCTGATAGGTATGTAATGG - Intronic
946671810 2:222113051-222113073 CCATTCTAGTAGGTATGTAGTGG + Intergenic
947067494 2:226245112-226245134 GTATTTTAAAAGGGATGTTTAGG + Intergenic
947272629 2:228353820-228353842 CCATTCTATTAGGTGTGTATTGG + Intergenic
947784701 2:232806534-232806556 CTATTTTACTATGTCTTTATTGG + Exonic
1168746397 20:246224-246246 ATATTTTAATAGGTATCTCTCGG - Intergenic
1169253487 20:4079453-4079475 GTATTTTAATTGGTATGCTTGGG + Intergenic
1170008152 20:11691448-11691470 CTGTTCTAATAGGTATGTAGTGG - Intergenic
1170018045 20:11804381-11804403 CCATTCTAATAGGTATGGAGTGG + Intergenic
1170101952 20:12711444-12711466 TCATTCTAATAGGTATGTAGAGG + Intergenic
1170162361 20:13326548-13326570 CCATTCTAATAGGTATATAGTGG + Intergenic
1170355004 20:15482387-15482409 CCATTCTAATAGGTGTGTAAGGG - Intronic
1170675547 20:18477254-18477276 CTATTCTAATAGGTGTGTAGTGG - Intronic
1170689433 20:18599709-18599731 CCATTCTAATAGGTATGTAGAGG + Intronic
1171872764 20:30542452-30542474 AGATTTGAATGGGTATGTATTGG + Intergenic
1172089350 20:32417698-32417720 ATACTTTAATAGGTATGTGTAGG + Intronic
1173721977 20:45267483-45267505 CAATTTTACCATGTATGTATGGG - Intergenic
1174084415 20:47995713-47995735 CTATTTTAATAGGTGGTTACTGG + Intergenic
1174936157 20:54871404-54871426 CCACTCTAATAGGTATGTAGTGG + Intergenic
1176277642 20:64281786-64281808 CCATTCTAATAGGTATGAAGTGG + Intronic
1176885856 21:14255083-14255105 TCATTTTAATAGGTATGTACTGG + Intergenic
1177020268 21:15846741-15846763 CTTTTTTAATAGGTAAATAGTGG + Intronic
1177225923 21:18255996-18256018 CAATTTTAATAGATTTGTTTCGG + Intronic
1177362741 21:20094521-20094543 CTACTTTAATGGGTCTGGATTGG - Intergenic
1178609227 21:34066494-34066516 CCATTCTAATAGGTATGCAGTGG + Intergenic
1180010322 21:45045538-45045560 CCATTCTAATAGGTGTGTAGTGG - Intergenic
1181135174 22:20760441-20760463 CTATTTTAATATCTTTTTATTGG + Intronic
1181794544 22:25295662-25295684 CCACTCTAATAGGTATGTAGTGG + Intergenic
1181834526 22:25592172-25592194 CCACTCTAATAGGTATGTAGTGG + Intronic
1181933350 22:26420944-26420966 ATATATTAATATGTATTTATAGG - Intergenic
1182166273 22:28177307-28177329 CTGTTCTAATACGTATGTAGTGG - Intronic
1182179090 22:28325793-28325815 CTATTCTAATAGGTATATAGTGG - Intronic
1182972724 22:34592994-34593016 CTAATTCAATAGATATTTATTGG + Intergenic
1183603741 22:38855968-38855990 CCATCTTAATAGGTATGAGTTGG + Intergenic
949298288 3:2552696-2552718 TTATTTTAAAAGGCAGGTATGGG + Intronic
950797959 3:15525949-15525971 CTATTCTAGTAGGTGTGTAGTGG - Intergenic
950959179 3:17086953-17086975 CTACTGTAATAGATGTGTATTGG - Intronic
951100936 3:18687648-18687670 CTATTCTAATAGGTATGTAGTGG - Intergenic
951277575 3:20707548-20707570 CCATTTTAATAGGTATATGGTGG + Intergenic
951435665 3:22660735-22660757 CTATTCTAATAGGGATTTAATGG - Intergenic
951692788 3:25414594-25414616 CAATTCCAATAGGTATGTAGTGG + Intronic
951769304 3:26237723-26237745 ATATTTTTATAGGTATGAAGTGG + Intergenic
952029327 3:29121667-29121689 CTAAATAAATAGGTAAGTATTGG + Intergenic
952128177 3:30328014-30328036 CCATTCTAATAGGTGTGTAGTGG - Intergenic
952135017 3:30408978-30409000 TTAATTTTATATGTATGTATAGG - Intergenic
952434006 3:33254311-33254333 CCATTCTAATAGGTATATAGTGG - Intergenic
952473313 3:33679684-33679706 CCATTTTAACAGGTATTTAGTGG - Intronic
952491155 3:33874283-33874305 CCATTCTAATAGGTGTGTAGTGG + Intergenic
952546572 3:34426500-34426522 CTATTTTAAAATGCATGTATAGG + Intergenic
952548024 3:34443835-34443857 CTATTTTAAAATATATGTAGAGG - Intergenic
953173509 3:40528689-40528711 CCTTTCTAATAGGTATGTAGTGG + Intronic
953422938 3:42769283-42769305 CCATTCTAATAGGTATGTAATGG - Intronic
953643991 3:44736676-44736698 CTATTCTAATAGGTATGTAGTGG + Exonic
953794921 3:45977419-45977441 TTATTTTAAAAGGTATTTTTAGG + Intronic
953950481 3:47185688-47185710 CTACTCTAATAGGTGTGTAGTGG - Intergenic
955562885 3:60211909-60211931 GTACTTTAATATGTATATATTGG - Intronic
955568918 3:60281958-60281980 CTATCCTAATAGGTATATACTGG - Intronic
955703178 3:61702324-61702346 ATATTTTAAAAGGTAAGGATGGG - Intronic
955994977 3:64670821-64670843 CTATTCTAATAGGTGTTTAGTGG - Intronic
956028896 3:65014734-65014756 CTATTTTAGTAGGTGTGTAGTGG - Intergenic
956081370 3:65560155-65560177 CTATTTTAAGAGAAATATATAGG + Intronic
956085292 3:65602034-65602056 CCATTTTAGTGGGTATGAATGGG - Intronic
956235580 3:67067414-67067436 CTATTCTAATAGATATGTAGTGG - Intergenic
956326963 3:68063802-68063824 TTATTTTAAAAGGGATGCATAGG + Intronic
957460060 3:80504980-80505002 CTATTCTAATAGATAGGTATTGG + Intergenic
957587081 3:82146450-82146472 CATTTTTAATAGTTATGCATGGG + Intergenic
957720870 3:83997518-83997540 CTATTTTATGAAGTATGTCTAGG - Intergenic
958121322 3:89293033-89293055 CCATTCTGATAGGTATGTAATGG + Intronic
958490938 3:94772320-94772342 CTATTCTAATAAGTGTGTAATGG - Intergenic
958589170 3:96132421-96132443 GTAATTTAATAGATATGTAGAGG - Intergenic
958627758 3:96647806-96647828 CTATTCAAATAGGTTTGTAGTGG - Intergenic
958717803 3:97808169-97808191 CTATTTTAGTAGGTGTATAATGG - Intergenic
958824535 3:99014581-99014603 CTATTTGAATGGGTATGTAGTGG + Intergenic
958854953 3:99373798-99373820 CTTTTTTAAAAAATATGTATGGG + Intergenic
958875751 3:99614983-99615005 CCATTCTAATGGGTATGTAGTGG - Intergenic
958985269 3:100773409-100773431 CCATTTTAATAGGTGTGTAATGG - Intronic
959168767 3:102817611-102817633 CTATTCTAATAAGTGTGTAGTGG + Intergenic
959253978 3:103986919-103986941 ATATTTTAATTGGTTTCTATGGG + Intergenic
959654269 3:108783355-108783377 CCTTTTCAATAGGTATCTATTGG + Intergenic
959665944 3:108921626-108921648 CCATTCTAATAGGTGTGTAGTGG + Intronic
959837120 3:110932316-110932338 ATAATTTACTAGGTTTGTATAGG - Intergenic
960227193 3:115182555-115182577 CTATTCTAATTGGTATGTTGTGG - Intergenic
960380380 3:116953327-116953349 GGATTTTTATAGGTATTTATAGG - Intronic
960509619 3:118532675-118532697 CCTTTCTAATAGGTATGTAGTGG + Intergenic
960652812 3:119970395-119970417 CTATTCTAATAGGTGTATAGTGG - Intronic
960819427 3:121712759-121712781 CCATTCTAATGGGTATGTAGTGG - Intronic
960851695 3:122061641-122061663 CCATTTTTATAGGTAGGTAGTGG - Intronic
961015206 3:123462744-123462766 CCATTCTAATAGGTGTGTAGTGG - Intergenic
962194277 3:133346352-133346374 CCATTCTAATAGGTGTGTAGTGG + Intronic
962561849 3:136614433-136614455 ATATTTTAATGAGTATGTATAGG + Intronic
962583322 3:136818147-136818169 CTATTTAAAAAGGTGTGGATGGG + Intergenic
962912432 3:139865498-139865520 TCATTTTAATAGGCATGTAGTGG + Intergenic
963144935 3:141983759-141983781 CCATTCTAATGGGTATGTAGTGG - Intronic
963179174 3:142336053-142336075 CTATTTTAATAGTTCTGTTAAGG + Intronic
963731476 3:148977804-148977826 CCATTCTAATAGGTATATAGTGG + Intergenic
963859170 3:150290003-150290025 CCATTCTAATAGGTATGTGGTGG - Intergenic
964727665 3:159831474-159831496 ACTTTATAATAGGTATGTATAGG - Intronic
964773495 3:160250023-160250045 ACATTTTAATGAGTATGTATGGG - Intronic
964807315 3:160625205-160625227 CCATTCTAATAGGTATGTAGTGG + Intergenic
964833742 3:160914122-160914144 TCATTCTAATAGGTGTGTATTGG + Intronic
965001911 3:162965163-162965185 CTATATTAATAGAAATATATAGG - Intergenic
965006073 3:163026203-163026225 ATTTTATAATATGTATGTATAGG - Intergenic
965105770 3:164350501-164350523 CTATTTTAAAAGGTCAGTAGTGG - Intergenic
965289288 3:166857558-166857580 CTATTCTAATAGGTTTATAATGG - Intergenic
965526420 3:169724000-169724022 CCATTCTAATAGGTATATAGTGG - Intergenic
965555066 3:170010429-170010451 CCATTCTAATAGGTATGTAGTGG - Intergenic
965729060 3:171750995-171751017 ATATTTGAATAGGTTTGTTTTGG - Intronic
965848878 3:172997299-172997321 CCATTTTAATAGGTGTGTAGTGG + Intronic
966164694 3:177004467-177004489 CCATTCTAATAGGTGTGTAGTGG - Intergenic
966267653 3:178065513-178065535 CTATTCTGATAGGTATATAGTGG + Intergenic
966295601 3:178418022-178418044 CCATTCTAATAGGTTTGTAGTGG + Intergenic
966601072 3:181775614-181775636 GTATTTTAAGAGGTAAATATGGG - Intergenic
966969879 3:185033817-185033839 CCATTCTAATAGGTATGTAATGG + Intronic
967287278 3:187884837-187884859 CCATTCTAATAGGCATGTAGTGG + Intergenic
967445265 3:189558361-189558383 CTGTTGTAATAGGTATGTAGTGG - Intergenic
967476823 3:189931247-189931269 CCATTTTAACAGGTATGTAGTGG + Intergenic
967560661 3:190915172-190915194 TTATTTTAGTAGGTGTGTAATGG + Intergenic
967780363 3:193432212-193432234 CCATTCTAATAGGTTTGTAGTGG - Intronic
969470316 4:7383893-7383915 ATATTTTAATAGGTGGGTCTTGG - Intronic
969544274 4:7814318-7814340 CCATTTTAATAGGGGTGTAGTGG - Intronic
970147293 4:13049901-13049923 CCATTTTAGTAGGTGTGTAGTGG - Intergenic
970573122 4:17402207-17402229 TTATTTTGATAGGAATGTATTGG - Intergenic
970962806 4:21892683-21892705 CTATTTTAATCGGTTTTGATTGG - Intronic
971242899 4:24904725-24904747 CCATTCTAATAGGTATGTTGTGG + Intronic
972322422 4:37984441-37984463 TTATTCTAATAGGTGTGTAGTGG + Intronic
972679766 4:41294146-41294168 CAAGTTTAATAGGTCTGGATGGG - Intergenic
972807192 4:42541324-42541346 CTATTCTAATAGATGTGTACTGG - Intronic
972922400 4:43960095-43960117 ATATTTTAAAAGGTATTTTTAGG + Intergenic
973196153 4:47444493-47444515 CTATTCTAATAGAGATGTAGTGG - Intergenic
974005689 4:56554372-56554394 CCATTCTAATAGGTGTGTAGTGG + Intronic
974879787 4:67741058-67741080 TTATTTTAATAGGTTTTTTTGGG + Intronic
975252327 4:72194407-72194429 CTATTTTAATTGATGTGTAGCGG + Intergenic
975317539 4:72972129-72972151 ATCTTATCATAGGTATGTATAGG + Intergenic
975793895 4:77984968-77984990 TTATTTTAATAGATCTGTCTTGG + Intergenic
975798865 4:78037570-78037592 CTCTTTTAGTAGGTGTGTAGTGG + Intergenic
975958437 4:79871194-79871216 CCATTCTAATAGGTACGTAGTGG - Intergenic
976577280 4:86688342-86688364 CTATTTTATTGGGTGTGTAGTGG + Intronic
976723291 4:88191407-88191429 CTATTTTAGTGGGTATGAAGTGG - Intronic
976894083 4:90086536-90086558 AAATTTTAAAAGGTATATATGGG - Intergenic
976985461 4:91290567-91290589 ATATTTTAATAGTTCAGTATTGG - Intronic
977035961 4:91953910-91953932 CCATTCTAATAGGTCTGTAGTGG + Intergenic
977663574 4:99618590-99618612 CTAATTTAGTAGGTATGAAGGGG + Intronic
977749948 4:100597410-100597432 CTATTCTAATAGGTGTGGAGTGG + Intronic
977799576 4:101210597-101210619 CTATTTGAATAGGGATGATTAGG - Intronic
977933450 4:102774364-102774386 CCATTCTAATAGGTATGTAGTGG - Intergenic
977938892 4:102836703-102836725 CCATTGTAATAGGTGTGTAGTGG + Intronic
977971307 4:103217502-103217524 CTTTTCTTATGGGTATGTATAGG - Intergenic
978129447 4:105177581-105177603 CCATTCTAACAGGTATGTAGCGG - Intronic
978234317 4:106439472-106439494 CTATTCTCATAGGTGTGTAGTGG + Intergenic
978659057 4:111101331-111101353 CCATTCTAATAGATATGTAGTGG - Intergenic
979039191 4:115765220-115765242 CCATTCTAATAGGTATGCAGTGG - Intergenic
979222565 4:118246200-118246222 CCATTTTAGTGGGTATGTAGTGG - Intronic
979320508 4:119318166-119318188 CTATTCAAAGTGGTATGTATTGG + Exonic
979349139 4:119626507-119626529 CGATTTTTAAAAGTATGTATTGG - Intronic
979642089 4:123021062-123021084 CTATTTTAATTTGGATGTTTTGG + Intronic
979648332 4:123099049-123099071 CTATTCTAACAGGTATGAAATGG + Intronic
979877909 4:125916737-125916759 CCATTTTAATAGTTTTGTTTGGG - Intergenic
980232383 4:130061402-130061424 CTCTTATAATAGTTATGAATTGG - Intergenic
980262812 4:130475717-130475739 ACATTTTAATAGGTATGCAGTGG + Intergenic
980609097 4:135133399-135133421 CCATTCTTATAGGTATGTATTGG + Intergenic
981234248 4:142396417-142396439 CTATTTTAGTGGGTATGAAGTGG - Intronic
981250011 4:142589577-142589599 TTATTCTAATAGGCATGTAGAGG - Intronic
981555892 4:145993118-145993140 CTATTCTAACAGGTTTGTAGAGG + Intergenic
981594926 4:146409119-146409141 ATTTTTTAATGGGTATGTATAGG + Intronic
981596670 4:146432087-146432109 CCATTCTAATAGGTGTGTAGCGG - Intronic
983119415 4:163862506-163862528 CCACTCTAATAGGTATGTAGTGG - Intronic
983458858 4:168002015-168002037 CCATTCTAATAGGTGTGTAATGG - Intergenic
983580246 4:169302685-169302707 CCATTCTAATAGGTGTGTAGTGG - Intergenic
984032633 4:174623577-174623599 CTATTTTAAAATATATGTATTGG - Intergenic
984258989 4:177421312-177421334 CTATTCTAATAGGTAGATAGTGG + Intergenic
984307256 4:178009344-178009366 CCATTTTAATAGGTGTGTAGTGG + Intergenic
984986782 4:185338641-185338663 CTACTTTAATTGTTATATATAGG + Intronic
985086359 4:186317072-186317094 CCATTCTAATAGGTATGTAGTGG - Intergenic
985096460 4:186417145-186417167 CTATTTGCATAGGTATGGACAGG - Intergenic
985470399 5:39272-39294 CCATTCTAATAGGTGTGTAGTGG - Intergenic
986158882 5:5205628-5205650 CTATTCTAAGAGGTGTGTAGTGG + Intronic
986398562 5:7355641-7355663 CCATGCTAATAGGTATGTAGTGG + Intergenic
986828014 5:11542547-11542569 TTATTTAAATAGGAATGTATGGG - Intronic
986973499 5:13366759-13366781 CAATTCTAATAGGTGTGTAGTGG - Intergenic
987765182 5:22218037-22218059 CTATTCTAATAGGTATTTAGTGG - Intronic
987903205 5:24040322-24040344 CCATTCTAATAAGTATGTAGTGG + Intronic
988328532 5:29803589-29803611 CCATTCTAATAGGTCTGTAGTGG - Intergenic
988952362 5:36276470-36276492 ATTTTATCATAGGTATGTATAGG + Intronic
989348806 5:40460174-40460196 CTATTTTAACAGGGAGGAATAGG - Intergenic
989437018 5:41426140-41426162 TCATTCTAATAGGTATGTAGTGG + Intronic
989471261 5:41821637-41821659 CCATTCTAATAGGTGTGTAATGG + Intronic
990149059 5:52796441-52796463 CTAATTTTATACTTATGTATTGG - Intronic
990336676 5:54779681-54779703 AAATTTTAATACGTATTTATAGG - Intergenic
990471343 5:56118837-56118859 CCATCTTCATAGGTGTGTATTGG - Intronic
990919571 5:60947326-60947348 CCATTTTGATAGGTATATAGTGG + Intronic
990932010 5:61102913-61102935 CCATTTTAATGGGTGTGTAGTGG - Intronic
990971581 5:61512664-61512686 CTATTATAATACGTATATAATGG + Intronic
991338529 5:65578524-65578546 CCATTTTAATAGATGTGTAATGG + Intronic
991539472 5:67710776-67710798 CCATTCTAATAGGTATGTACTGG - Intergenic
991651592 5:68860989-68861011 CCATTCAAATAGGTATGTAGTGG - Intergenic
992694181 5:79268395-79268417 CTATTTTAATAGGTATGTATTGG + Intronic
993223847 5:85139726-85139748 TTATTATAGTATGTATGTATAGG - Intergenic
993429066 5:87809142-87809164 CTATTATAATAAGTGTGTAGTGG - Intergenic
993498630 5:88638392-88638414 ACATTCTAATAGGTATGTAGTGG - Intergenic
993800185 5:92323646-92323668 CTATTGTTATTGGTATCTATTGG - Intergenic
993935791 5:94000350-94000372 CCATTCTAATAGATATGTAGTGG + Intronic
994159649 5:96542470-96542492 CTATTCTAATGGGTGTGTAGTGG + Intronic
994260154 5:97648672-97648694 CTATTCTAATAGGTGTGTAGTGG + Intergenic
994275130 5:97827353-97827375 CTATTCTAATAGATTTGTAGTGG + Intergenic
994569455 5:101496727-101496749 CCATTCTAATAGGTATGTAGCGG - Intergenic
994793525 5:104263627-104263649 CCATTTTAATAGGGAGGTAGAGG - Intergenic
994884071 5:105536054-105536076 CTATTCTAATAGATATGTAGTGG + Intergenic
994922451 5:106065466-106065488 CCATTCTAATAGGTGTGTAGTGG + Intergenic
994976230 5:106810758-106810780 CTATTTTGACAGGTATATAGTGG + Intergenic
995285284 5:110381465-110381487 CCATTCTAATAGGTGTGTAGTGG + Intronic
995933409 5:117480208-117480230 CTATATTAATAGGTTTGAACTGG - Intergenic
996000021 5:118349518-118349540 TTATTCTAATAGGTGTGTATTGG + Intergenic
996182274 5:120433403-120433425 CCATTCTAATAGGTGTGTAGCGG - Intergenic
996388256 5:122932545-122932567 ATATTTTGACAAGTATGTATGGG - Intronic
996445055 5:123538362-123538384 CTATTTTAATGGGTGTGAAATGG + Intronic
996546930 5:124689696-124689718 CCATTCTAATAGGTGTGTAGTGG - Intronic
996631241 5:125635386-125635408 CTATTCTAATAGGTTTGTAGCGG - Intergenic
996687402 5:126297985-126298007 TAATTTTAATAGGTCTTTATTGG + Intergenic
996729970 5:126707499-126707521 CTATTTAAAAAGTTATGTTTGGG + Intergenic
997857624 5:137387112-137387134 CCATTCTAATAGGTGTGTATGGG - Intronic
997873814 5:137530275-137530297 CTATTCTAACAGGTGTGTAGAGG - Intronic
998361676 5:141593738-141593760 CTATTCTAGTAGGTATGTAGTGG - Intronic
999045496 5:148464537-148464559 TTATTTTTATAGGTTTGTAGTGG - Intronic
999509362 5:152232202-152232224 CCATTCTAATAGGTATGTAGTGG + Intergenic
1000053957 5:157587194-157587216 CCATTGTAATAGCTATGTAGCGG + Intergenic
1000134124 5:158328409-158328431 CCATTCTAATAGGTGTGTAGTGG + Intergenic
1000236223 5:159363371-159363393 CCATTCTAATAGGTATGTAGTGG + Intergenic
1000683679 5:164219913-164219935 CTATCTTAATAGGTATGTGGTGG + Intergenic
1000911922 5:167032632-167032654 CTATTCTGATAGATACGTATGGG + Intergenic
1001538569 5:172519894-172519916 CCATTCTATTAGGTATGTAGTGG - Intergenic
1001765672 5:174244689-174244711 CCATTCTAATAGGTATGTAGAGG + Intergenic
1001791681 5:174463026-174463048 CCATTCTAATAGGTGTGTAGTGG + Intergenic
1003622698 6:7715247-7715269 CCATTTTAACAGGGATGTAGTGG - Intergenic
1003706831 6:8541800-8541822 CTATTCTACCAGGTATGTTTTGG - Intergenic
1003969592 6:11286294-11286316 CTATTCTAATAGGTATGTAGTGG - Intronic
1004023958 6:11800710-11800732 CTATTCTAATAGATGTGTAGTGG + Intronic
1004284009 6:14303532-14303554 CTATTTGAATAGGTGTGTAGTGG + Intergenic
1004381712 6:15138258-15138280 CTAATTTAATAGGTCTGGGTTGG + Intergenic
1004588169 6:17023016-17023038 CTATTCTAACAGGTGTGTAGTGG + Intergenic
1004657123 6:17673661-17673683 CTATTCTAGTAGGCATGTAGTGG - Intronic
1004772744 6:18802873-18802895 TCATTCTAATAGGTATGTAGTGG + Intergenic
1004821687 6:19374499-19374521 TTTTTTTTATAGGTATGTAATGG - Intergenic
1005427780 6:25721471-25721493 ATATTTTAATATGTCTGTCTTGG - Intergenic
1006483204 6:34315484-34315506 ACATTCTAATAGGTATGTAGTGG + Intronic
1006802446 6:36767751-36767773 CTAATTTAATTGGTCTGGATAGG + Intronic
1007117433 6:39353260-39353282 CCATTCTAATATGTATGTAGTGG + Intronic
1007734841 6:43974600-43974622 CTATTCTAACAGGTATGTAGAGG + Intergenic
1007939608 6:45767632-45767654 GTATTTTAATTGGTATGTATAGG - Intergenic
1008181869 6:48341016-48341038 TTATTTTAAAAGGTGTCTATTGG - Intergenic
1008460686 6:51766244-51766266 CTATCTTGATAGGTATGCTTTGG - Intronic
1008599387 6:53075563-53075585 CCATTCTGATAGGTATGTAGTGG + Intronic
1008695832 6:54035653-54035675 CTATTTTAATAGGTGTGTGGTGG + Intronic
1008945505 6:57091892-57091914 GTATTTTAATAGATTTGTTTAGG + Intronic
1008956292 6:57220208-57220230 CCATTCTAATAGGTGTGTAGTGG - Intronic
1009578731 6:65503160-65503182 CCATTTAAATAGGTATTTACTGG + Intronic
1010073753 6:71775152-71775174 ACATTTTAATAGGTATGTAATGG + Intergenic
1010770767 6:79827228-79827250 CCATTATAATAGGTAGGTAGTGG - Intergenic
1011264678 6:85502930-85502952 GAAATTTTATAGGTATGTATAGG - Intergenic
1011519539 6:88189877-88189899 CCACTTTAATAGGTATGTAGTGG + Intergenic
1011905367 6:92360239-92360261 TCTTTTTAATAGGTATGTAGTGG - Intergenic
1012034507 6:94115349-94115371 CCATTCTAATAGGTGTGTAGTGG + Intergenic
1012059004 6:94453362-94453384 CTATTCTAATAGGTATATGGTGG - Intergenic
1012088773 6:94864377-94864399 CTATTTTAATATGGAAGTAGTGG - Intergenic
1012293368 6:97487672-97487694 CCATTTTAATAGGTATGCAGTGG + Intergenic
1012316470 6:97787089-97787111 CTATTCTATTAGGCATGTAATGG + Intergenic
1012332149 6:98005611-98005633 CCATTCTAATAGGTGTGTAATGG + Intergenic
1012668567 6:102011233-102011255 CCATTTTAATAGGTATGTGGTGG + Intronic
1012704919 6:102511904-102511926 CCATTCTAATAGGTGTGTAGTGG + Intergenic
1012964014 6:105653408-105653430 CTATTTTCATGGGTGTGAATTGG + Intergenic
1013328904 6:109078134-109078156 TTGTTTTAAAATGTATGTATAGG - Intronic
1013331213 6:109102034-109102056 CTGTTCTAATAGGTATGTAATGG + Intronic
1013700262 6:112759350-112759372 CTATTTTAATTGGAATGCTTAGG + Intergenic
1014178886 6:118361818-118361840 CTATTCTAATAGGTGTGTGGTGG - Intergenic
1014322967 6:119954248-119954270 TTATTCTAATAGGTGTGTAGTGG + Intergenic
1014328744 6:120032846-120032868 CTATTTTAATTAGTATGGCTTGG - Intergenic
1014390406 6:120856408-120856430 CCATTCTAATAGGTGTGTAGTGG - Intergenic
1014596323 6:123344949-123344971 CTATTTTAATAGGTGTGTAGTGG + Intronic
1015040073 6:128705951-128705973 GTTCTTTAAAAGGTATGTATAGG + Intergenic
1015080103 6:129213565-129213587 CTATTCTAATAGATATGTAGTGG + Intronic
1015478152 6:133676687-133676709 CCATTTTAATAGGTCTGCAGTGG + Intergenic
1015766685 6:136725391-136725413 CCAGTCTAATAGGTATGTAGTGG + Intronic
1015873136 6:137797125-137797147 CCATTCTAATAGGCATGTAGCGG + Intergenic
1016264117 6:142211969-142211991 CCATTCTAATAGGTGTGTAGTGG - Intronic
1016405638 6:143726740-143726762 CCATTCTAGTAGGTATGTAGTGG + Intronic
1016515687 6:144891155-144891177 CTATTTGAATAGATTTGTAATGG - Intergenic
1016971862 6:149771407-149771429 TTATTAAAATAGGTATGTTTGGG - Intronic
1017555740 6:155564913-155564935 CTATTATAATAGATGTGTAGTGG + Intergenic
1017661314 6:156676859-156676881 CCATTTTAATAGGTATATAGTGG - Intergenic
1018042662 6:159938914-159938936 CCATCTTAATGGGTATGTAGTGG - Intergenic
1018097625 6:160405358-160405380 CCATTCTAATAGATATGTAGTGG - Intronic
1018213120 6:161501311-161501333 CCATTTTAGTAGGTGTGTAGAGG + Intronic
1018293687 6:162320554-162320576 CAATTCTAATAGGTGTGTAGTGG - Intronic
1018603026 6:165566373-165566395 CCATTTAAATAGGTATGTAATGG - Intronic
1019222227 6:170482177-170482199 CCATTCTAATAGGTATGAACTGG - Intergenic
1019389127 7:775604-775626 ATATATAAATATGTATGTATTGG + Intronic
1019874494 7:3797281-3797303 CCTTTTTAAAAGGTATATATGGG - Intronic
1019875097 7:3803136-3803158 CCATTTTAATAGGTGTGGAAGGG + Intronic
1020239281 7:6379918-6379940 CTATTTTAATAGTGTTGTTTTGG + Intronic
1020391824 7:7666531-7666553 ATATTTTAATAGGTATATAATGG + Intronic
1020446218 7:8270994-8271016 CCATTTTAATAGGTGTGTAGTGG - Intergenic
1020512797 7:9080243-9080265 CCATTTTAATTGGTATGTAATGG + Intergenic
1020520259 7:9176366-9176388 CTATTTTAATTGGTAGATCTAGG - Intergenic
1021008745 7:15435417-15435439 CCATTATAATAGGTATGCAGTGG + Intronic
1021086489 7:16425959-16425981 CCATTCTAATAGGTGTGTAGTGG + Intergenic
1021271970 7:18599995-18600017 CCATTCTAATACGTATGTAGTGG + Intronic
1021406774 7:20277066-20277088 CTAATTTGATAGGTTTGGATGGG - Intergenic
1021596493 7:22322595-22322617 CTATATTAAGAGACATGTATGGG - Intronic
1022689000 7:32627504-32627526 CCATTTTAATAGATGTGTAATGG - Intergenic
1022830607 7:34062140-34062162 TTATTTTTGTAGGTATATATAGG + Intronic
1023033954 7:36114476-36114498 CCATTCTAATAGGTGTGTAGAGG + Intergenic
1023425446 7:40031167-40031189 CAATTCTAATAGATATGTAGTGG + Intronic
1023558971 7:41452638-41452660 CTATTTTAAAATATATTTATTGG + Intergenic
1024092352 7:45954444-45954466 CTCTATTACTAGGTATCTATTGG - Intergenic
1024092407 7:45955399-45955421 CTCTATTACTAGGTATCTATTGG - Intergenic
1024356482 7:48418374-48418396 CCATTCTAATAGGTGTGTAGAGG + Intronic
1024772453 7:52739266-52739288 CCATTCTAATAGGAATGTAGTGG + Intergenic
1024795914 7:53019693-53019715 CCATTCTAATAGGTGTGTAGTGG - Intergenic
1024861295 7:53844710-53844732 CCATTCTAATAGGTGTGTAGTGG + Intergenic
1025226624 7:57170622-57170644 GTATTGTGATAAGTATGTATAGG - Intergenic
1026080332 7:67212699-67212721 CTATTCTAATAGATTTGTAGTGG + Intronic
1026696758 7:72601310-72601332 CTATTCTAATAGATTTGTAGTGG - Intronic
1027384097 7:77643083-77643105 CCATTCTAATGGGTATGTAGTGG + Intergenic
1027572154 7:79883193-79883215 CTGTCCTAATAGGTATGTAATGG + Intergenic
1027810994 7:82898245-82898267 CTATTTTAATAGTAATGCAAGGG - Intronic
1027891618 7:83984394-83984416 CTATTTTGATATGTCTGTGTAGG + Intronic
1028816385 7:95150964-95150986 CTATTGTAACAGGTATATAGTGG - Intronic
1029060593 7:97793778-97793800 CCATTCTAATAGGTATATAGTGG + Intergenic
1029352608 7:100025138-100025160 CATTTTTAATAGGAAAGTATTGG + Intronic
1029839505 7:103347238-103347260 CTATCTTAATAGGTATGTGGTGG + Intronic
1029908273 7:104115988-104116010 CCATTCTAATAGGTATGCAATGG + Intergenic
1030095902 7:105899552-105899574 CTTTTCTAATAGGTGTGTAGGGG + Intronic
1030243433 7:107355216-107355238 CTATTCTAATAGGTGTGTCATGG - Intronic
1030472754 7:109987527-109987549 CTATTTTAATGGGTAGATAGTGG - Intergenic
1030538107 7:110793959-110793981 CTATTCCAATAGTTATGTAGTGG - Intronic
1030693867 7:112562721-112562743 CTATTTTGATATCTATGGATTGG - Intergenic
1030834887 7:114270509-114270531 GTATTCTAATAGATATGTAGTGG + Intronic
1031307127 7:120142804-120142826 CTATTCTTATAGGTGTGTAGTGG + Intergenic
1031511862 7:122660563-122660585 GTCTTTTAATGGGTATGTTTAGG - Intronic
1031784205 7:126008179-126008201 CTATTTACAAAGATATGTATAGG + Intergenic
1031900468 7:127403804-127403826 CTATTTGAATAGGTAATTATTGG + Intronic
1032172457 7:129596567-129596589 TCATTCTAATAGGTATGTAGTGG + Intergenic
1032386021 7:131524569-131524591 CTATTCCAATAGGTATGTAATGG - Intronic
1033055576 7:138050526-138050548 TGATTTTAGTAGGTATGTAGTGG - Intronic
1033604872 7:142919564-142919586 TTATTTTTAAAGGGATGTATTGG - Intronic
1033806049 7:144955265-144955287 CCAGTTTATTAGGTATGGATGGG + Intergenic
1034206330 7:149318981-149319003 CTATTGTTCTAGGTATGCATAGG + Intergenic
1034331375 7:150286157-150286179 CTGTTTTAATAGTTAAGGATGGG - Intronic
1034666668 7:152823703-152823725 CTGTTTTAATAGTTAAGGATGGG + Intronic
1034739809 7:153463297-153463319 CTAATATAGTATGTATGTATGGG + Intergenic
1036049144 8:5176294-5176316 TTATTCTAATAGGTAGGTAGTGG + Intergenic
1036510326 8:9394077-9394099 CTTTTTTAATAGGGATGGAAGGG - Intergenic
1037250173 8:16883688-16883710 CTATTTTAATAGGTGTGTAGTGG - Intergenic
1037255952 8:16953893-16953915 CCATTCTGATAGGTATGTATTGG - Intergenic
1037341090 8:17845937-17845959 CTACTTTAATTGCTATGTTTTGG + Intergenic
1037354684 8:18005452-18005474 CTCATTTTATAGATATGTATTGG + Intronic
1037515450 8:19626856-19626878 CCATTCTAATAGGTGTGTAGTGG - Intronic
1037529742 8:19761036-19761058 ATATTTGAATAGGTATTTTTAGG + Intergenic
1038050940 8:23810702-23810724 CTATTCTAATGGGTGTGTAGTGG + Intergenic
1039022240 8:33220464-33220486 CCATTTGAATAGGTGTGTAGTGG - Intergenic
1039095735 8:33882843-33882865 GCATTTTAGTAGGTATGTAATGG - Intergenic
1039570842 8:38585361-38585383 ATATTTTAATAGGCATCTAATGG - Intergenic
1039643234 8:39247390-39247412 CCATTCTAATAGGTGTGTAGTGG + Intronic
1039730830 8:40275213-40275235 CCATTCTAATAGGTATGCAGTGG + Intergenic
1039810773 8:41046251-41046273 CCATTCTAATAGGTACGTAGTGG + Intergenic
1040002140 8:42586302-42586324 CCATTCTAATAGGTGTGTAGTGG + Intergenic
1040662871 8:49596117-49596139 CTATTCTAATTGGTGTGTAGTGG - Intergenic
1040754506 8:50755792-50755814 CCATTCTAATAGGTGTGTAGTGG + Intronic
1040793591 8:51263981-51264003 CCATTTTAATGGGTTTGTAGTGG + Intergenic
1040812316 8:51468306-51468328 CTATTTTGTTAGGTATATAAAGG + Intronic
1041500920 8:58537555-58537577 CTGTGTTAATAGGTACCTATTGG + Intergenic
1041879291 8:62729323-62729345 CCATTCTAATAGGTATGTAGTGG - Intronic
1041892213 8:62881938-62881960 CCATTCTAATAGGTGTGTAATGG + Intronic
1042142454 8:65693014-65693036 AGATTTTAAAAGGTATGTGTAGG - Intronic
1042441666 8:68834824-68834846 CCATTCTAATAGGTGTGTAGTGG - Intergenic
1042571885 8:70174370-70174392 ATATTTTAACCTGTATGTATAGG + Intronic
1042636694 8:70884074-70884096 CTATTCTAATAGGGGTGTAGTGG + Intergenic
1042780727 8:72488238-72488260 CCATTTTGATAGGTGTGTAGTGG - Intergenic
1042811517 8:72830598-72830620 CCATTTTAATATCTATGGATTGG + Intronic
1042898980 8:73702843-73702865 CCATTCTAATAGGTATGTGGTGG - Intronic
1043106124 8:76113094-76113116 CCATTTTAATAGGCATGCAGTGG - Intergenic
1043136668 8:76535760-76535782 TTATTTTAATGGTTATGTCTTGG - Intergenic
1043611613 8:82070143-82070165 CTATTCTAATAGGTATATAGTGG + Intergenic
1043693052 8:83181357-83181379 CCATTCTAATGGGTATGTAGTGG + Intergenic
1043886899 8:85611292-85611314 CTTTTTAAATAGGTATGAAGTGG + Intergenic
1044055321 8:87562439-87562461 CTATTCTAATAAGTATCTAGTGG + Intronic
1044204235 8:89473563-89473585 GTATTTAAATAGGTATGTTTCGG + Intergenic
1044500846 8:92954029-92954051 ATATTTTGATAATTATGTATTGG - Intronic
1044740021 8:95316644-95316666 CAATTTTAATTGTTAGGTATGGG - Intergenic
1044957583 8:97497654-97497676 CTATTCTAATAGATATGTAGTGG - Intergenic
1044983601 8:97739440-97739462 CTATTTTTCTAGGTTTGTTTTGG + Intergenic
1045154733 8:99454816-99454838 CCATTCTGATAGGTATGTAGTGG + Intronic
1045359704 8:101421687-101421709 TTCTTTTAATAGTTATGTATTGG + Intergenic
1045832806 8:106484621-106484643 CCATTCTAATAGGTGTGTAGTGG - Intronic
1045885633 8:107094587-107094609 CTATTCTAATAGGTATGTAGTGG + Intergenic
1046391198 8:113574967-113574989 CCATTCTAATAGGTATGTAGTGG + Intergenic
1046472065 8:114688805-114688827 ATATTTTAATAAGTATTTAAGGG + Intergenic
1046501879 8:115088116-115088138 CTATTTTAATAGGCATGTAGTGG + Intergenic
1047050668 8:121108402-121108424 CCATTCTAATAGGTGTGTATTGG - Intergenic
1047126531 8:121968180-121968202 CTCTTCTAATAGGTATGCATTGG - Intergenic
1047485196 8:125324128-125324150 CTATCCTAATAGGTGTGTAGTGG - Intronic
1047504881 8:125471432-125471454 ACATTTTAGTAGGTATGTATTGG - Intergenic
1047672845 8:127167171-127167193 CCATTCTAATAGGTGTGTACTGG + Intergenic
1048067725 8:130987760-130987782 ATATTTTAAAAGATATGAATGGG + Intronic
1048719420 8:137306303-137306325 CAATTCTAATAAGTATGTAGAGG - Intergenic
1049072438 8:140367025-140367047 CCATTCTAATAGGTGTGTAGTGG - Intronic
1050110032 9:2205839-2205861 CCATTCTAGTAGGTATGTAGTGG - Intergenic
1050168357 9:2789954-2789976 CTATTTTAGTAGGTCTGGTTTGG - Intronic
1050965577 9:11797284-11797306 TGATTCTAATAGGTATGTAATGG - Intergenic
1050977440 9:11958642-11958664 CTATTCTAATATGTATATATAGG + Intergenic
1051031473 9:12685205-12685227 TTATATTAAAAGGTATGTTTAGG - Intergenic
1051034808 9:12731573-12731595 CCATTCTAATAGGTGTGTAGTGG - Intergenic
1051063093 9:13068218-13068240 CTATTCTAATAGGTTTGTGGTGG - Intergenic
1051071833 9:13178658-13178680 CTATCTTAATAGGCATTTACAGG + Intronic
1051307171 9:15723850-15723872 CTATTTTTTAAAGTATGTATGGG + Intronic
1051643172 9:19242611-19242633 CTATTCTAATAGGTGTGGATTGG + Intronic
1051746785 9:20302421-20302443 TCATTCTAATAGGTATGTAATGG + Intergenic
1051988900 9:23126592-23126614 CCATTTTAATAGGTGTGTAGTGG + Intergenic
1052261872 9:26526129-26526151 CTATTTTATTGGAAATGTATGGG - Intergenic
1052393735 9:27912213-27912235 CCATTCTAATAGGTGTGTAGTGG + Intergenic
1052456173 9:28700839-28700861 CCATTCTAATAGGTATGTAGTGG + Intergenic
1052550865 9:29946932-29946954 CCATTTTAACAGGTGTGTAGTGG + Intergenic
1052559627 9:30068636-30068658 CCATTGTAATAGGTATGTCATGG - Intergenic
1052783809 9:32810087-32810109 CCATTCTAATAGGTGTGTAGAGG - Intergenic
1052871549 9:33512102-33512124 CTATATTAATAGCTATGTCATGG + Intergenic
1053239443 9:36484864-36484886 CTATCTAAAAATGTATGTATTGG + Intronic
1053541813 9:38981325-38981347 CCATTCTAATAGGTGTGTAGTGG + Intergenic
1053617706 9:39785817-39785839 CTTTTTTAATAGCTCTGTCTAGG + Intergenic
1053806157 9:41803955-41803977 CCATTCTAATAGGTGTGTAGTGG + Intergenic
1053875891 9:42545186-42545208 CTTTTTTAATAGCTCTGTGTAGG + Intergenic
1053880278 9:42587476-42587498 CTGTTTTAAAAATTATGTATAGG + Intergenic
1053896768 9:42749454-42749476 CTTTTTTAATAGCTCTGTCTAGG - Intergenic
1054219304 9:62394946-62394968 CTGTTTTAAAAATTATGTATAGG + Intergenic
1054231410 9:62514227-62514249 CTGTTTTAAAAATTATGTATAGG - Intergenic
1054235808 9:62556536-62556558 CTTTTTTAATAGCTCTGTGTAGG - Intergenic
1054266454 9:62921615-62921637 CTTTTTTAATAGCTCTGTCTAGG - Intergenic
1054624326 9:67382585-67382607 CCATTCTAATAGGTGTGTAGTGG - Intergenic
1055094157 9:72393387-72393409 CTATTTTGAGAGGTGTGTAGTGG - Intergenic
1055474492 9:76648124-76648146 CCATTCTAATAGGTATGTAGTGG - Intronic
1055498184 9:76876568-76876590 CAAGTGTAATAGGTATGTCTAGG - Intronic
1055719369 9:79154462-79154484 GTATTTACATATGTATGTATGGG - Intergenic
1056309477 9:85324424-85324446 CCATTCTAATAGGTGTGTAGTGG - Intergenic
1056318214 9:85411932-85411954 CTATTATAATAGGTGTGTAGTGG - Intergenic
1056448853 9:86695181-86695203 CTATTTAAAAATATATGTATAGG - Intergenic
1056739196 9:89238132-89238154 ATATTCTAATAGGTATGTAGTGG - Intergenic
1056857653 9:90148160-90148182 CTATTTTAATATGTGTATAGTGG + Intergenic
1057455766 9:95208691-95208713 CCATTTTAATAGGTGTATAGTGG - Intronic
1057949020 9:99355099-99355121 CCATTTTAGTGGGTATGTAGTGG - Intergenic
1058006150 9:99917297-99917319 TTATTTTAATAGATATGTTATGG + Intronic
1058039661 9:100290048-100290070 CCATTCTAATAGGTGTGTAGTGG + Intronic
1058494566 9:105542292-105542314 CCATTTTAATAGGTGTGTAGTGG + Intronic
1058543191 9:106033406-106033428 CTATATTAATTGATATTTATGGG + Intergenic
1058791765 9:108453772-108453794 CCATTCTAATAGGTGTGTAGTGG + Intergenic
1058871855 9:109208910-109208932 CTTCTTTAGTAGGTATTTATTGG - Intronic
1059520999 9:114942047-114942069 CTAATTTAGTAGGTCTGTAGGGG + Intergenic
1059667216 9:116459704-116459726 CTATTTTAGTGGGTATGAAGTGG - Intronic
1060162623 9:121379723-121379745 CCATTCTAATATGTATGTAGTGG - Intergenic
1060334434 9:122708316-122708338 CCATTTTAATAGCTGTGTAGTGG - Intergenic
1060633191 9:125178339-125178361 CCATTCTAATAGGTATATAGTGG + Intronic
1060682095 9:125575655-125575677 CTGTTTTAATAGGTGTGTAGTGG - Intronic
1203491529 Un_GL000224v1:110254-110276 CCATTCTACTAGGTATGTAGCGG + Intergenic
1203504153 Un_KI270741v1:52125-52147 CCATTCTACTAGGTATGTAGCGG + Intergenic
1185704205 X:2254420-2254442 CTGTTTTAATGAGTAAGTATGGG + Intronic
1186163015 X:6797987-6798009 CTACTTTAATGATTATGTATAGG + Intergenic
1186683823 X:11903290-11903312 CTATTTTAATATTTATGCTTAGG + Intergenic
1187800883 X:23061469-23061491 TTATTTTAATAAACATGTATTGG - Intergenic
1188083206 X:25871068-25871090 CTATTATAATAGGTGTGTGGTGG + Intergenic
1188149920 X:26660440-26660462 CCATTCTAATAGGTATGTACTGG - Intergenic
1188154202 X:26721522-26721544 CCATTTTAATATGTGTGTAATGG + Intergenic
1188444357 X:30241149-30241171 CCATTCTTATAGGTATGTAGTGG + Intergenic
1188471341 X:30543426-30543448 CCATTCTAATAGGTATGTAGTGG - Intergenic
1188641072 X:32505463-32505485 CCATTCTAATAGGTGTGTAGTGG - Intronic
1189403485 X:40694650-40694672 CCATTCTGATAGGTATGTAGTGG - Intronic
1189442701 X:41051500-41051522 TCATTTTAATAGGTGTGTAGTGG - Intergenic
1189542546 X:42007229-42007251 CTATTTTAATTGGGATGTTAGGG - Intergenic
1189574187 X:42333010-42333032 CCATTTTAATAGGGATGTAATGG + Intergenic
1189762513 X:44336421-44336443 CCATTTTAATAGGTGTATAGTGG - Intronic
1189762610 X:44337844-44337866 CCATTTTAATAGGTATACAGTGG + Intronic
1189804323 X:44720173-44720195 CTATTCTAATAGGTACATAGTGG + Intergenic
1189937587 X:46086045-46086067 CTATTTCAATAGGTATATAGTGG - Intergenic
1189945497 X:46173191-46173213 TCATTTTAATAGGTATGTAATGG + Intergenic
1190001317 X:46690274-46690296 CTATTGTAATAGGTGTGTAGTGG + Intronic
1190240006 X:48650617-48650639 CCATTCTAATAGGTGTGTAGTGG + Intergenic
1190402357 X:50050402-50050424 CCATTCTAATAGGTATGTAGTGG + Intronic
1190471532 X:50785065-50785087 CCAGTCTAATAGATATGTATTGG - Intronic
1190547815 X:51547458-51547480 ACATTGTAATAGGTATGTAGTGG + Intergenic
1190627749 X:52352937-52352959 TTTATTTAATATGTATGTATGGG - Intergenic
1190803106 X:53810997-53811019 CCCTTATAATAGGTATGTAGTGG - Intergenic
1190957605 X:55210760-55210782 TTATTCTACTAGGTGTGTATTGG + Intronic
1190957694 X:55211528-55211550 TTATTCTACTAGGTGTGTATTGG + Intronic
1191193744 X:57696215-57696237 TAATTTTAATAGGTGTGTAGTGG - Intergenic
1192131052 X:68550583-68550605 CTATTCTAATAAGTGTGTAGTGG + Intergenic
1192386118 X:70672536-70672558 CTATTCTAAGAATTATGTATTGG + Intronic
1192588071 X:72336215-72336237 CCATTCTAATAGATATGTAATGG + Intronic
1192674293 X:73179191-73179213 CCATTTTAATAGGTACATAGTGG - Intergenic
1192801632 X:74470510-74470532 TTATTCTAATAGGTGTGTAGTGG + Intronic
1193107968 X:77700287-77700309 CTATTCTAATAGGCATGCAGGGG - Intronic
1193118293 X:77796752-77796774 CCATTCTAATAGGTATGCAGTGG - Intergenic
1193499069 X:82250568-82250590 TTATTTTAATAAGTAAGTAGTGG + Intergenic
1193533077 X:82679744-82679766 ATATTTTAATAGGTTTGTAATGG + Intergenic
1193864206 X:86709844-86709866 TTATTTCAACAGGTGTGTATGGG - Intronic
1194064528 X:89245071-89245093 CTATTTTAATAAGTGTATAGTGG + Intergenic
1194221279 X:91194889-91194911 CAATTCTAATAGGTATGTAGTGG - Intergenic
1194439888 X:93919373-93919395 CCATTCTAATAGGTGTGTAGCGG - Intergenic
1194539297 X:95151154-95151176 CTTTTTTATTAGGTATTTTTAGG - Intergenic
1194661434 X:96632347-96632369 CCATTCTAATAGGTGTGTAGTGG - Intergenic
1194864050 X:99043336-99043358 CCATTTTAATAGGACTGTAGTGG + Intergenic
1194955112 X:100169576-100169598 CTATTTTAATGGGTGTGTAGTGG - Intergenic
1194999344 X:100626992-100627014 ATATTTTAACAGGTTTGTTTGGG + Intergenic
1195641999 X:107185760-107185782 AATTTTTAATTGGTATGTATAGG - Intronic
1196000376 X:110777541-110777563 CTATAATAATAGGTGTGTAGTGG + Intronic
1197015853 X:121625374-121625396 CCATCCTAATAGGTATGTAGTGG - Intergenic
1197071360 X:122301844-122301866 CCATCCTAATAGGTGTGTATTGG + Intergenic
1197125188 X:122937721-122937743 CCATTCTAGTAGGTGTGTATTGG - Intergenic
1197539480 X:127739422-127739444 CTATTTTAATAGGTGTGTAGTGG - Intergenic
1198410894 X:136366722-136366744 CTATTCTAATAGGTGTGTAGTGG + Intronic
1198958933 X:142163120-142163142 CCATTCTAATAAGCATGTATTGG + Intergenic
1199498772 X:148485926-148485948 CTATTTGAATAGATGTGTAGTGG - Intergenic
1199735432 X:150682013-150682035 CCATTCTAATAGGTGTGTAGTGG - Intergenic
1199817936 X:151415972-151415994 CCATTCTAATAGGTGTGTAGTGG + Intergenic
1199889654 X:152064248-152064270 ACATTCTAATAGGTATGTAGGGG + Intergenic
1199891776 X:152090816-152090838 CCATTTTAATAGGTTTGTAGAGG + Intergenic
1200557787 Y:4658643-4658665 CAATTCTAATAGGTATGTAGTGG - Intergenic
1200718700 Y:6579153-6579175 CTATTTTAATAAGTGTATAGTGG + Intergenic
1201322250 Y:12712617-12712639 ATCTTTTAATAGGTATATTTAGG + Intronic
1202039696 Y:20668793-20668815 CTGTTTTAAGAGGTATGCAATGG - Intergenic