ID: 992704954

View in Genome Browser
Species Human (GRCh38)
Location 5:79381054-79381076
Sequence GCACCAGTGTTAGCAGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 4, 2: 15, 3: 45, 4: 185}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992704954_992704962 26 Left 992704954 5:79381054-79381076 CCTGGAACTGCTAACACTGGTGC 0: 1
1: 4
2: 15
3: 45
4: 185
Right 992704962 5:79381103-79381125 GACAGGCATACTTGGCCCACTGG 0: 1
1: 0
2: 0
3: 7
4: 84
992704954_992704955 -5 Left 992704954 5:79381054-79381076 CCTGGAACTGCTAACACTGGTGC 0: 1
1: 4
2: 15
3: 45
4: 185
Right 992704955 5:79381072-79381094 GGTGCAAGCAAACACAGCCCTGG 0: 1
1: 0
2: 1
3: 9
4: 163
992704954_992704960 18 Left 992704954 5:79381054-79381076 CCTGGAACTGCTAACACTGGTGC 0: 1
1: 4
2: 15
3: 45
4: 185
Right 992704960 5:79381095-79381117 AGCCTAAGGACAGGCATACTTGG 0: 1
1: 0
2: 5
3: 15
4: 137
992704954_992704957 9 Left 992704954 5:79381054-79381076 CCTGGAACTGCTAACACTGGTGC 0: 1
1: 4
2: 15
3: 45
4: 185
Right 992704957 5:79381086-79381108 CAGCCCTGGAGCCTAAGGACAGG No data
992704954_992704956 4 Left 992704954 5:79381054-79381076 CCTGGAACTGCTAACACTGGTGC 0: 1
1: 4
2: 15
3: 45
4: 185
Right 992704956 5:79381081-79381103 AAACACAGCCCTGGAGCCTAAGG 0: 1
1: 0
2: 2
3: 12
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992704954 Original CRISPR GCACCAGTGTTAGCAGTTCC AGG (reversed) Intronic
900196740 1:1380522-1380544 GCACCACTGTGAGCTGTCCCAGG + Intergenic
902099813 1:13977676-13977698 GCAACATTGTTATAAGTTCCAGG - Intergenic
903830177 1:26169914-26169936 GCACACGTGTGAGCACTTCCGGG - Exonic
905741775 1:40377397-40377419 GCACGAGTCTTACCAGTTTCTGG + Intronic
906573263 1:46862703-46862725 GCACCAGTGTTGGCTGCTCCAGG - Intergenic
906598613 1:47104391-47104413 GCACCAGTGTTAGCTACTCCAGG + Intronic
908496043 1:64695969-64695991 TCACCAGTGTCAGCAGCTTCAGG + Intergenic
909183308 1:72451124-72451146 AAACCAGTGGTAGCAGGTCCAGG - Intergenic
909268827 1:73597447-73597469 GTACGTTTGTTAGCAGTTCCCGG - Intergenic
909827486 1:80143606-80143628 GCTCCAGTGTTAGGAGGACCAGG - Intergenic
910750007 1:90619031-90619053 GTACGTTTGTTAGCAGTTCCCGG + Intergenic
911435728 1:97855283-97855305 TCACCTGTCATAGCAGTTCCAGG - Intronic
913057383 1:115175057-115175079 GCCCCAAAGTTAGCAGGTCCTGG - Intergenic
913435407 1:118842519-118842541 GCATCAGTGTAAGCAGTGCTGGG + Intergenic
913646589 1:120861366-120861388 GCAGGAGTATTAGCAGTACCAGG + Intergenic
914080059 1:144401506-144401528 GCAGGAGTATTAGCAGTACCAGG - Intergenic
914174965 1:145270041-145270063 GCAGGAGTATTAGCAGTACCAGG - Intergenic
914529690 1:148511520-148511542 GCAGGAGTATTAGCAGTACCAGG - Intergenic
915320152 1:155051920-155051942 GCACCAGGGTGAGGAGTGCCTGG - Intronic
915784833 1:158598032-158598054 ACACCTGTGTTAGCAGGTACTGG - Intergenic
917323774 1:173811131-173811153 TCCCCAGTGTTCGCAGTTGCAGG - Exonic
917534504 1:175864505-175864527 CCACCAGAGTTGGCAGCTCCTGG + Intergenic
918363079 1:183778959-183778981 GCACCAGTTGTACCAGTGCCAGG - Intronic
919012396 1:191982773-191982795 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
919463615 1:197907544-197907566 TCATCAGTGTTAGCAATCCCAGG + Intergenic
919590310 1:199493865-199493887 GCACCAGTGTTAGTGGGTCCTGG - Intergenic
922893277 1:229078244-229078266 GGACCAGTGGTGGCAGATCCAGG + Intergenic
923568907 1:235097361-235097383 GCACCAGTTAGACCAGTTCCTGG - Intergenic
924910057 1:248500470-248500492 GCACCAGTCGTGGCAGTCCCAGG - Intergenic
924914047 1:248547585-248547607 GCACCAGTCGTGGCAGTCCCAGG + Intergenic
1062853081 10:760152-760174 GCACTGGTGGTAGCAGGTCCTGG - Intergenic
1063548850 10:7009108-7009130 GTACATTTGTTAGCAGTTCCTGG - Intergenic
1064805272 10:19123056-19123078 GCTCCAGAGAAAGCAGTTCCAGG + Intronic
1067821527 10:49535330-49535352 TCAGCAGAGTGAGCAGTTCCAGG + Intronic
1068137402 10:52964662-52964684 GCAACAGGGTGGGCAGTTCCAGG + Intergenic
1068157572 10:53222021-53222043 GCAGCAGGGTGAGCAGCTCCAGG + Intergenic
1068657711 10:59591899-59591921 GCACAGGTGTTAGCGGGTCCAGG - Intergenic
1071666641 10:87564638-87564660 GCACCAGTGTCAGCAAGTCCAGG - Intergenic
1072042342 10:91620204-91620226 GTACATTTGTTAGCAGTTCCTGG + Intergenic
1073668134 10:105556467-105556489 GCACCAGTTCTAGCAGATCAGGG + Intergenic
1074031964 10:109697674-109697696 ACACCAGTATTAGCAGGACCAGG - Intergenic
1074444514 10:113508801-113508823 GTACATTTGTTAGCAGTTCCTGG - Intergenic
1075861169 10:125678462-125678484 GCACCTGTTTTGGCAGTTCTTGG + Intronic
1076750216 10:132538513-132538535 GAACCCCTGTTAACAGTTCCTGG + Intronic
1077450901 11:2644989-2645011 GTACCAGTGTTAGCAAGTCCAGG + Intronic
1078345247 11:10541894-10541916 GCAGCAGTGTCAGCTGTACCTGG - Intergenic
1082732492 11:56817194-56817216 GTACATCTGTTAGCAGTTCCTGG - Intergenic
1084858496 11:72003654-72003676 GCCCCAGGGTTATCAGTTGCTGG + Intronic
1085376974 11:76072853-76072875 GCAGCAGTGTAATCAGTCCCTGG + Intronic
1085493487 11:76945645-76945667 GCACCAGTGTTAGTGGGTACTGG + Intronic
1085542815 11:77288353-77288375 GCACTGGTGTTAGCAGGTCGAGG - Intronic
1085978745 11:81694660-81694682 GCACCAGTGTTATTGGATCCAGG - Intergenic
1087353333 11:97060764-97060786 GCAGCAGTGTTGACAGTTACTGG - Intergenic
1090225831 11:125071777-125071799 GCACCTGTGGTATCTGTTCCTGG + Intronic
1091432819 12:451306-451328 CCACCAGTGTTAGTGTTTCCAGG + Intergenic
1093546682 12:20356955-20356977 CCAGCAGAATTAGCAGTTCCAGG + Intergenic
1095712729 12:45307724-45307746 GCACCAGTGTTTACAGGTCACGG + Intronic
1095832640 12:46604089-46604111 GCAGCAGTGTCAGCAGTTGTAGG - Intergenic
1097079252 12:56417765-56417787 GCACCAGAGTTGGGAGCTCCAGG - Exonic
1097846860 12:64375500-64375522 GTACACTTGTTAGCAGTTCCTGG - Intronic
1098634023 12:72758278-72758300 GCACCAGTGTTAGCATGTCCAGG - Intergenic
1100776507 12:97980025-97980047 GCACTGGTGTTGGCAGGTCCAGG - Intergenic
1101566159 12:105907595-105907617 CCACCAGTATAAGCAGCTCCGGG - Intergenic
1108030554 13:46224983-46225005 GCACCTGTGTTGGCAGTTACTGG + Intronic
1108308793 13:49165609-49165631 GTACCAGTGTTAGCAAATCCAGG + Intronic
1109155614 13:58906024-58906046 GCACCAATGTTAGCACTTCTGGG + Intergenic
1110933993 13:81260800-81260822 GCATTAGTATTAGCAGTACCTGG + Intergenic
1111176713 13:84605707-84605729 GCACCAGGGTTAGCAGGTCCAGG + Intergenic
1111420522 13:88005136-88005158 GCACCTGAGGTGGCAGTTCCAGG + Intergenic
1112080121 13:95959817-95959839 GCACCAGTGTTAGCAGGTGCAGG - Intronic
1112821722 13:103345705-103345727 GCACCAGCGTTAGCAGGTCCAGG + Intergenic
1113536950 13:111075891-111075913 GCACTATTGTTAGCAGGTCCAGG + Intergenic
1114156951 14:20115219-20115241 GCACAAGTGTTTTCAGGTCCTGG + Intergenic
1116935794 14:50738731-50738753 GCATCCGTGATAGCAGTTTCTGG + Intronic
1118294840 14:64559364-64559386 GTAGCAGTGGCAGCAGTTCCTGG - Intronic
1124809476 15:32920687-32920709 GCACCTGTGTTTTCAGTTTCTGG + Intronic
1124838275 15:33216757-33216779 GCACCATTTTTAGAAGATCCAGG - Intergenic
1126661570 15:51038422-51038444 GCACTGGCGTTAGCAGGTCCAGG + Intergenic
1127410216 15:58697766-58697788 GCACTGGTGTTAGCAGGTCCAGG - Intronic
1129070593 15:72946878-72946900 GCATTGGTGTTAGCAGGTCCAGG - Intergenic
1129091498 15:73156395-73156417 GCACCCATGTTGGTAGTTCCAGG + Intronic
1129377631 15:75144173-75144195 GCAGCAGGGTGAGCAGCTCCAGG + Intergenic
1130166088 15:81460753-81460775 GCTCCAGTGTTAGTGGGTCCTGG + Intergenic
1130398661 15:83529250-83529272 GCACCAGTGTTAGCAGATCCAGG + Intronic
1131693799 15:94854736-94854758 ACACTAGGGTTAGTAGTTCCTGG - Intergenic
1132263934 15:100449464-100449486 GCACTAGTGTTAGCAGCTCCAGG - Intronic
1132913002 16:2325334-2325356 GCAGCAGCCTTAGCAGTACCAGG - Intronic
1135317118 16:21457897-21457919 GCAGGTGTGTTAACAGTTCCAGG + Intergenic
1135370040 16:21890138-21890160 GCAGGTGTGTTAACAGTTCCAGG + Intergenic
1135398723 16:22150828-22150850 GCACCTGTCTGAGCAGTTCAAGG - Exonic
1135441773 16:22480984-22481006 GCAGGTGTGTTAACAGTTCCAGG - Intronic
1135540351 16:23325086-23325108 GCACCAGAGCTTGCATTTCCTGG - Intronic
1137283029 16:46994036-46994058 GCACCTGTGTTACCAGTTGAGGG - Intergenic
1138591700 16:58002738-58002760 CCACCAGTGTTAGAGGTTTCTGG - Intronic
1138738718 16:59281446-59281468 TCACCAGTGTTATCAGGTCCAGG - Intergenic
1138915314 16:61456111-61456133 GCATCAGTGTTAGTGGGTCCAGG - Intergenic
1138993187 16:62417372-62417394 GCACCAGAGGTAGCAGGTCCAGG + Intergenic
1141021142 16:80497702-80497724 GCTCCATTTTTATCAGTTCCAGG - Intergenic
1141962402 16:87417873-87417895 ACAGCAGTGTTGGCAGTTCAGGG - Intronic
1143277808 17:5726247-5726269 GCCCGTTTGTTAGCAGTTCCTGG - Intergenic
1144263442 17:13545592-13545614 ACACCAGTGTTTGCTGATCCTGG + Intronic
1144390085 17:14785047-14785069 GCAGCAGGGTTGGCAGCTCCAGG - Intergenic
1148351380 17:46944196-46944218 GTGCCAGTGTTAGCTGTTTCAGG + Intronic
1150453767 17:65290828-65290850 GCGCCAGTGTCAGAACTTCCTGG - Intergenic
1151549831 17:74815900-74815922 GCACAAGTGTCAGTACTTCCGGG + Intronic
1152553915 17:81043587-81043609 GCTCCAGTGTGAGCAGTGACAGG - Intronic
1154012701 18:10589274-10589296 GCCCCAGTGCTGGCCGTTCCTGG - Intergenic
1155817683 18:30334647-30334669 GCACCAGTGTTACCAGTGATGGG + Intergenic
1156653290 18:39252549-39252571 GCACTGGTGTTAGCAAGTCCAGG - Intergenic
1157205159 18:45691799-45691821 GCACCAGTGGTGGCAGTGGCAGG - Intergenic
1158735714 18:60076048-60076070 GCACCAGTGTTTACAGGTTCAGG - Intergenic
1160737752 19:671905-671927 ACCCCAGTGTTAGAGGTTCCAGG - Intergenic
1161781923 19:6298562-6298584 GCAGCAGGGTGAGCAGCTCCAGG - Intergenic
1163376139 19:16931638-16931660 GTACCAGTGTTAGTGGGTCCAGG - Intronic
1166903594 19:46087064-46087086 GCATCAGTGTTAGCAGGTCCAGG + Intergenic
1167347274 19:48954621-48954643 GCACCATTTTTAGAAGTTTCGGG - Intergenic
1168563892 19:57406497-57406519 GTACCTGTGTTGGCAGTTCTAGG + Intronic
1168713796 19:58515905-58515927 GCCCCAGTCTCAGGAGTTCCTGG + Intronic
927096929 2:19754484-19754506 ACACCAGAGTGGGCAGTTCCTGG - Intergenic
928258890 2:29749252-29749274 CCACCAATGTTAGCATTTCCTGG - Intronic
930161086 2:48156448-48156470 GCACCAGTGATGGCAGTGACTGG - Intergenic
930539111 2:52681634-52681656 GCACCAATGTTAGCAGGTCCAGG - Intergenic
931551420 2:63450545-63450567 GCACTGGTGTTAGCAGTACCAGG - Intronic
932089791 2:68796739-68796761 GCACCTGTACTGGCAGTTCCAGG + Intronic
933801032 2:85960676-85960698 GCAGCAGGGTGGGCAGTTCCAGG + Intergenic
933821351 2:86115109-86115131 GAACCATTCTTAGCAGTTCTAGG + Intronic
934680744 2:96282213-96282235 GCATGAGTGTTAGCACTTTCTGG - Intronic
935624130 2:105155053-105155075 GCACCAGTTCCACCAGTTCCAGG - Intergenic
936766732 2:115859258-115859280 GCACCAGTGGTGGTAGTTTCAGG + Intergenic
936785849 2:116094001-116094023 GCACTGGTGTTAGCAGGTCCAGG + Intergenic
937465587 2:122130801-122130823 GTACCAGTGTTAGTTGGTCCAGG + Intergenic
938507370 2:131900481-131900503 GCACCTGTGTTACCAGCTACTGG + Intergenic
940176670 2:150885134-150885156 GCACCAGTTTCTGCAGTTCAAGG + Intergenic
940362592 2:152812756-152812778 ACACCAGAGTTAGCGGGTCCTGG + Intergenic
943714404 2:191134394-191134416 GCACCAGTGTTAGCAAGTCCAGG - Intronic
944048656 2:195440875-195440897 GCACTGGTGTTAGCAGGTCCAGG - Intergenic
944260114 2:197667875-197667897 GCACTGGTGTTAGCAGGTCCAGG + Intronic
945483706 2:210370245-210370267 GCACCAGTGTCAGTGGGTCCAGG + Intergenic
945971152 2:216233580-216233602 GCACCAGTGTGAGCAGGTTCAGG + Intergenic
1169412503 20:5383408-5383430 GCACTGGTGTTAGCATGTCCAGG - Intergenic
1170093439 20:12617730-12617752 GCACCAGTGTTAGCAAGTCCAGG - Intergenic
1173322485 20:42001010-42001032 GCACCTGTGTTGGCAGTTACTGG + Intergenic
1174524228 20:51158421-51158443 TGACCAAGGTTAGCAGTTCCGGG + Intergenic
1175063938 20:56269410-56269432 GCACAAGTGTAAGCACTTGCTGG - Intergenic
1176347381 21:5762057-5762079 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
1176354195 21:5882641-5882663 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
1176359393 21:5982526-5982548 GCACCAGTGTTAGTAGGTCCAGG + Intergenic
1176497446 21:7562398-7562420 GCAGCAGTGTTAACAGGTCCAGG + Intergenic
1176541702 21:8160127-8160149 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
1176560653 21:8343172-8343194 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
1177038456 21:16074719-16074741 ACACCAGTCTTAGCTGTCCCGGG - Intergenic
1179764125 21:43556024-43556046 GCACCAGTGTTAGTAGGTCCAGG - Intronic
1179922111 21:44512976-44512998 GCACCAGATTTAGCAAATCCAGG + Intronic
1203246641 22_KI270733v1_random:76546-76568 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
949711757 3:6878905-6878927 GGACCAGTGATAGCAGCACCTGG - Intronic
954725107 3:52601693-52601715 GCACTGGTGTTAGCAGGTCCAGG + Intronic
958640026 3:96794382-96794404 GCACTAGTGTTAGCAGGTCCAGG + Intergenic
960551291 3:118978493-118978515 GTACCAGTGTTAGCGGGTCCAGG - Intronic
961518013 3:127450549-127450571 GAGCCAGTGTCAGCAGTCCCAGG - Intergenic
962592612 3:136906524-136906546 GCACCAGTGTTAGCAGGTTCAGG + Intronic
968050684 3:195652984-195653006 TCACAAGCGTTAGCAGTGCCTGG + Intergenic
968096638 3:195935874-195935896 TCACAAGCGTTAGCAGTGCCTGG - Intergenic
968709503 4:2102617-2102639 GCACCTGTATTGGCGGTTCCAGG - Intronic
968932141 4:3586797-3586819 GCAGCAGTGATGGCAGCTCCAGG - Intronic
970285746 4:14512526-14512548 GTACATTTGTTAGCAGTTCCTGG - Intergenic
971732841 4:30407390-30407412 TCACCAGTGTTAGTAGTTTCAGG - Intergenic
973959322 4:56093901-56093923 GCACCAGGGCTGGCAGTTTCTGG + Intergenic
974178345 4:58354027-58354049 GCAGCAGTGTGAGCATTGCCGGG - Intergenic
976178854 4:82380645-82380667 GCAGCAGGGTGAGCAGCTCCAGG + Intergenic
980740942 4:136949263-136949285 GCACCTATGTTGGCATTTCCAGG + Intergenic
982190908 4:152854893-152854915 GCACCAGTGTTAATGGGTCCAGG + Intronic
983949826 4:173627165-173627187 GCACTGATGTTAGCAGGTCCAGG + Intergenic
985514624 5:335133-335155 GCACCTGTGTTGGCAGTACCAGG + Intronic
985876494 5:2602593-2602615 GCAGCTGTGCTAGCAGTTCCTGG - Intergenic
986553069 5:8980506-8980528 GCACCACAGTCAGAAGTTCCTGG - Intergenic
987009653 5:13749029-13749051 CCAGCAGTGTTAGCAGATTCAGG + Intronic
987075455 5:14378082-14378104 GGACCAGTGTCAGCAGTACGTGG + Exonic
988065107 5:26222471-26222493 CAACCATTCTTAGCAGTTCCTGG - Intergenic
989231085 5:39086819-39086841 GCACCAGAGTCAGCAGGTCCAGG - Intergenic
989338692 5:40349310-40349332 GCACCTGTGTTGGCAGTTACTGG - Intergenic
989498080 5:42132273-42132295 GCACCCATGATAGCAGGTCCAGG - Intergenic
989666928 5:43865281-43865303 GCCCCAGTTTTAACAATTCCAGG + Intergenic
990752981 5:59038830-59038852 GCACCAGTGACAGCAGAACCGGG + Intronic
992704954 5:79381054-79381076 GCACCAGTGTTAGCAGTTCCAGG - Intronic
994688145 5:102982429-102982451 GTATCAGTGGTAGCAGGTCCAGG - Intronic
995915297 5:117238479-117238501 GCAACATTTTAAGCAGTTCCAGG + Intergenic
997782009 5:136668098-136668120 GCACTGGTGTTAGCAGGTCCAGG - Intergenic
999696592 5:154192476-154192498 GCATCAGAGTCAGGAGTTCCAGG + Intronic
999964344 5:156792537-156792559 GTACCTTCGTTAGCAGTTCCTGG - Intergenic
1002579572 5:180199594-180199616 ACACCACTGTTACCAGTTCAGGG - Intronic
1003088636 6:3082177-3082199 GCCCCTGTGTCAGCAGCTCCTGG - Intronic
1004414245 6:15410402-15410424 GCACCTGAGTTTGCAGTCCCTGG - Intronic
1004563283 6:16771643-16771665 ACTCCAGTGGTAGCAGTCCCAGG - Intergenic
1008875505 6:56321648-56321670 GTACCTTTGTTAGCAGTTTCTGG - Intronic
1011522924 6:88229161-88229183 GCACAAGCCTTAGCAGCTCCAGG + Intergenic
1013572117 6:111439317-111439339 GTACATTTGTTAGCAGTTCCTGG - Intronic
1014864998 6:126518334-126518356 GTACGTTTGTTAGCAGTTCCTGG + Intergenic
1016247129 6:141995422-141995444 GCACCAGTGTTAGAGGGTGCAGG - Intergenic
1016425816 6:143934882-143934904 GCACTGGTGTTAGCAGGTCCAGG + Intronic
1021765563 7:23944470-23944492 GCACCTGTGTTTACAGTTGCTGG - Intergenic
1022985703 7:35651287-35651309 GCACCAGTGTGAGATGGTCCAGG - Intronic
1023232698 7:38051164-38051186 GCACCAGTGTTGGCAGGTCTAGG + Intergenic
1023980434 7:45066703-45066725 GCACCCGTGGTAGCACTTCCTGG + Intronic
1026275256 7:68870724-68870746 GCCCCAGTGTGATAAGTTCCTGG - Intergenic
1027885859 7:83904109-83904131 GCACCTGGGTTGGCAGTGCCTGG - Intergenic
1028477250 7:91265516-91265538 GCTCAAGTGTGAGAAGTTCCCGG + Exonic
1029496550 7:100897986-100898008 TCACCAGGGTTATCATTTCCTGG + Intergenic
1030345848 7:108432084-108432106 CCACTTGTGTTAGCAGTTGCTGG + Intronic
1032901923 7:136320354-136320376 GCACCAGTGTTAGCAGATCCAGG + Intergenic
1035136097 7:156704147-156704169 GCGCCTGTGTTGGCAGTTCCAGG - Intronic
1036601002 8:10260020-10260042 GCATCAGAGGGAGCAGTTCCGGG + Intronic
1036826044 8:11977061-11977083 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
1036837993 8:12091564-12091586 GCACCAGTGGTTGAAGTTTCAGG + Intergenic
1036859783 8:12337811-12337833 GCACCAGTGGTTGAAGTTTCAGG + Intergenic
1038219310 8:25592522-25592544 GTACCAGTGATAGCAGATCCAGG - Intergenic
1039924095 8:41913474-41913496 GTACGTTTGTTAGCAGTTCCTGG + Intergenic
1040360474 8:46659474-46659496 ATACCATTGTTAGCAGATCCAGG - Intergenic
1041539543 8:58967462-58967484 GGAACAGTGTCAGCTGTTCCTGG - Intronic
1043116151 8:76255661-76255683 GCACCAGTGTTATTGGTTCTAGG - Intergenic
1045337980 8:101225267-101225289 TCACCACTGTTAACAGATCCTGG - Intergenic
1046431513 8:114134676-114134698 GCACCAGTGTTAGAAAGTCTAGG + Intergenic
1047257881 8:123229533-123229555 GCACCTGTGCTGGCAGTTACAGG + Intronic
1048331538 8:133473999-133474021 GCACCACTGTGTGCAGGTCCTGG - Intronic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1050242942 9:3658014-3658036 TCACCAGTGTCAGCAGGTCCAGG + Intergenic
1054457994 9:65445131-65445153 GCAGCAGTGATGGCAGCTCCAGG + Intergenic
1055662693 9:78520612-78520634 GCAACAGTGTTAGCAGGTTCAGG - Intergenic
1056038824 9:82638037-82638059 GCACCTGTGTTGGCAGTTATGGG - Intergenic
1056479137 9:86983243-86983265 GCACCTGAGTTTGCAATTCCTGG + Intergenic
1058937468 9:109782138-109782160 ACCCCAGTGTTAGCAGCTACTGG - Intronic
1059099450 9:111455580-111455602 GAACCACTCTTAGCAGTTCTGGG - Intronic
1059563147 9:115354822-115354844 GTACGTTTGTTAGCAGTTCCTGG - Intronic
1059601871 9:115787512-115787534 GAACCAGGGTTAGCAATTCAGGG + Intergenic
1203462975 Un_GL000220v1:59608-59630 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
1188351076 X:29131543-29131565 GCACCACAGTTAGCACTTCTGGG + Intronic
1188739694 X:33763545-33763567 GCACCATTGCTAGCAGATCCAGG + Intergenic
1188757850 X:33986908-33986930 GCACCAGTGTTAGTGGATCCAGG + Intergenic
1189725033 X:43959707-43959729 GCACCAGTGTTGGCTATGCCTGG - Intronic
1190925027 X:54895040-54895062 GCCCTGGTGTTAGCAGGTCCAGG - Intergenic
1191611737 X:63122532-63122554 GCAGCAGTGTTATCAGGTCTAGG - Intergenic
1193112524 X:77743818-77743840 GTAACTGTGTTGGCAGTTCCAGG - Intronic
1196574906 X:117305717-117305739 GCACTAGTGTTAGTGGGTCCAGG - Intergenic
1197309192 X:124883504-124883526 GCACCAGTCTTAGTGGGTCCAGG + Intronic
1197521026 X:127495905-127495927 GCACTGGTGTCAGCAGGTCCTGG - Intergenic
1197548861 X:127862479-127862501 GCACCATTGTTAGCAGGTCCAGG - Intergenic
1197643412 X:128992366-128992388 GAATCAGTGTTAGAAGGTCCAGG + Intergenic
1198299113 X:135317408-135317430 GCACCATTGTTAGCAGGTCCAGG + Intronic
1198623056 X:138534802-138534824 GCACCTGTATTAGCAGTTACTGG - Intergenic
1198787463 X:140304308-140304330 GCACCTGTGTTGGCAGTTATAGG - Intergenic
1198844218 X:140892718-140892740 GCACATTCGTTAGCAGTTCCTGG - Intergenic