ID: 992709707

View in Genome Browser
Species Human (GRCh38)
Location 5:79439142-79439164
Sequence GCGGATTCCTTTAAAAAAAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992709697_992709707 22 Left 992709697 5:79439097-79439119 CCGTTGATACTTTCCGGTGTTAA 0: 1
1: 0
2: 1
3: 1
4: 66
Right 992709707 5:79439142-79439164 GCGGATTCCTTTAAAAAAAGGGG 0: 1
1: 0
2: 0
3: 6
4: 129
992709696_992709707 23 Left 992709696 5:79439096-79439118 CCCGTTGATACTTTCCGGTGTTA 0: 1
1: 0
2: 0
3: 3
4: 46
Right 992709707 5:79439142-79439164 GCGGATTCCTTTAAAAAAAGGGG 0: 1
1: 0
2: 0
3: 6
4: 129
992709699_992709707 9 Left 992709699 5:79439110-79439132 CCGGTGTTAAAGGAGACTGAAGA 0: 1
1: 0
2: 1
3: 21
4: 237
Right 992709707 5:79439142-79439164 GCGGATTCCTTTAAAAAAAGGGG 0: 1
1: 0
2: 0
3: 6
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992709707 Original CRISPR GCGGATTCCTTTAAAAAAAG GGG Exonic
902237927 1:15069493-15069515 GAAGATTCTTTTAAAAAAGGAGG - Intronic
906439121 1:45825407-45825429 TCGCATCCTTTTAAAAAAAGAGG - Intronic
907003631 1:50888339-50888361 GGGGATTCAATTAAGAAAAGAGG - Intronic
907005265 1:50906843-50906865 GGGGATTCAATTAAGAAAAGAGG - Intronic
909060011 1:70869036-70869058 GCTCATTTATTTAAAAAAAGAGG - Intronic
910481587 1:87663911-87663933 TTGGTTTTCTTTAAAAAAAGAGG + Intergenic
911715495 1:101127856-101127878 ACGGATTCCTTTAGAAGCAGTGG - Intergenic
912906483 1:113713497-113713519 GCGTATTCCTTAAAAGAAAGTGG - Intronic
913494985 1:119420250-119420272 CAAGATTCCTTTAAAAAATGTGG - Intronic
916238889 1:162619122-162619144 GCAGTTTTCTTGAAAAAAAGAGG - Intergenic
917231564 1:172843374-172843396 CAGGATTCCTTTAACAAATGTGG + Intergenic
1063537411 10:6897884-6897906 GTGGAATCCTTTATAAATAGTGG - Intergenic
1063654827 10:7977829-7977851 AGGGCTTCCTTAAAAAAAAGTGG - Intronic
1065417363 10:25502860-25502882 GCTGGTTCCTTTACAAAAAAAGG + Intronic
1068804204 10:61176331-61176353 GATGAATCCTTGAAAAAAAGTGG + Intergenic
1076072672 10:127504038-127504060 GTGGATGCCTTTATAAGAAGAGG - Intergenic
1077779055 11:5304964-5304986 GAGAATTGCTTTAAAAAAACTGG + Intronic
1079853215 11:25565152-25565174 CCAGATTCCTTGAAAAAAATTGG - Intergenic
1081056126 11:38412881-38412903 GAGGCATCCTTTAAAAAAACTGG + Intergenic
1081587007 11:44392820-44392842 GCGTATTCAATTAGAAAAAGAGG - Intergenic
1083523619 11:63340113-63340135 GCGTATTCAATTAGAAAAAGAGG - Intronic
1085492050 11:76929425-76929447 GCGTATTCAATTAATAAAAGAGG - Intronic
1095846710 12:46753905-46753927 GCAGATTTATGTAAAAAAAGAGG + Intergenic
1101394137 12:104329305-104329327 GTGGTTTCCTTAAAAAAAAAAGG + Intronic
1112058957 13:95717826-95717848 GGGTATTTTTTTAAAAAAAGAGG - Intronic
1115943959 14:38638990-38639012 GGGTATTCAATTAAAAAAAGAGG + Intergenic
1119686534 14:76637157-76637179 CTGGATTCCTTTTTAAAAAGAGG - Intergenic
1120527623 14:85595581-85595603 ATGGATTCCTTTCAAAAATGTGG + Intronic
1121796019 14:96735913-96735935 GTGGTTTCCTTTAAAAAGGGGGG + Intergenic
1123103690 14:105825110-105825132 ACTGCTTACTTTAAAAAAAGAGG - Intergenic
1124711924 15:32020495-32020517 GCGGATATCTTTAAAGGAAGAGG + Intergenic
1125421216 15:39506609-39506631 GTGGATTCCAGTAAGAAAAGTGG + Intergenic
1126914458 15:53450171-53450193 GCAGATTCCTAGAAAACAAGTGG - Intergenic
1127808968 15:62546730-62546752 GCGGAGTCCTTTAGAGCAAGGGG + Intronic
1130857319 15:87852193-87852215 AAGGATTCGTTTAAAAAAAAAGG - Intergenic
1131233658 15:90678113-90678135 GAGGTATCCTTTATAAAAAGTGG + Intergenic
1134541569 16:15071244-15071266 GCGAATCCCTATAAAAAGAGAGG + Exonic
1135359557 16:21800830-21800852 GCGAATCCCTATAAAAAGAGAGG + Intergenic
1135437024 16:22435805-22435827 GCGAATCCCTATAAAAAGAGAGG + Intronic
1136263239 16:29096116-29096138 GCGAATCCCTATAAAAAGAGAGG - Intergenic
1142234794 16:88916937-88916959 ACGGATTCTTTTAGAAAAAGAGG + Intronic
1144271783 17:13624701-13624723 GCTGATAGCCTTAAAAAAAGAGG + Intergenic
1145404798 17:22578739-22578761 GGGGAGTCATTTCAAAAAAGAGG + Intergenic
1146083608 17:29806407-29806429 GAGCATTCCTTTAACACAAGAGG - Intronic
1146226613 17:31072232-31072254 GAGGAATGCTTTAAAAAAAAAGG + Intergenic
1151394987 17:73817161-73817183 GGGAATTGCTTTAAAAAAAAAGG - Intergenic
1155391697 18:25345122-25345144 ACAGACTCCTTTAAAAATAGAGG + Intronic
1158255533 18:55543965-55543987 GGTGATTCTTTTAAAAAATGTGG - Intronic
1158326670 18:56320422-56320444 GGGGAGTCATTTAAAAAAAAAGG - Intergenic
1159464458 18:68763198-68763220 GATGATTCATTTAAAAAAACAGG - Intronic
1162052840 19:8045289-8045311 GTGGATGCCTTTAAAGAGAGTGG - Intronic
1162272520 19:9628048-9628070 GCGGATTCCTTTGACAAACAAGG - Intronic
1167838963 19:52098214-52098236 GCTGATTTCTTTATAAGAAGAGG + Intergenic
1168019836 19:53601238-53601260 GTGGCTTCCTGGAAAAAAAGAGG - Intronic
926952362 2:18256495-18256517 CTGGAATCATTTAAAAAAAGAGG - Intronic
928002608 2:27537989-27538011 GTGGAAACCTTTTAAAAAAGAGG + Intronic
928638972 2:33277657-33277679 GGGGAGTGCTTTAAAAAAATGGG + Intronic
929548085 2:42869608-42869630 GAGTATTACTTTAAAAAGAGTGG + Intergenic
935759969 2:106311333-106311355 GCGGAGTAATTTAAAAAATGGGG - Intergenic
935959222 2:108408120-108408142 GAGGCTTCATGTAAAAAAAGTGG - Intergenic
936706829 2:115085426-115085448 GCCCATTCCTATAATAAAAGTGG + Intronic
938973990 2:136458249-136458271 GGTAATTCATTTAAAAAAAGAGG + Intergenic
939040673 2:137185617-137185639 GTGGATTGCATTAAAAAATGCGG - Intronic
939111280 2:138010784-138010806 TTGGATTTCTTTAAAAAATGTGG + Intronic
943151348 2:184117005-184117027 AAGGATTTCTTTAAAAACAGAGG - Intergenic
944723070 2:202443047-202443069 GCTGGTTCCTTTATAAGAAGAGG + Intronic
945715737 2:213355828-213355850 GGGGATTCGATTAGAAAAAGAGG - Intronic
945895799 2:215480191-215480213 GCACATTCCTTTGTAAAAAGTGG + Intergenic
1171462374 20:25305667-25305689 TTTGATTTCTTTAAAAAAAGAGG - Intronic
1175060241 20:56235437-56235459 GAGGTTTCATTTAAAGAAAGTGG + Intergenic
1177205917 21:18011286-18011308 ACTTATTCCTTTAAAAAAATGGG - Intronic
949872112 3:8597532-8597554 TCTGATTCCCTGAAAAAAAGAGG - Intergenic
956580249 3:70803780-70803802 GAGCATTCATTTAAAAACAGAGG + Intergenic
957710617 3:83853834-83853856 GCAGATTGTTTTAAAAATAGAGG + Intergenic
958939687 3:100297175-100297197 GCAGAATGCTTTAAAAAAAAAGG - Intronic
959627088 3:108464837-108464859 GCAGATTTCTTTAAAAACACCGG + Intronic
960033265 3:113077181-113077203 CCGGAGCCCTTTAAAAGAAGAGG + Intergenic
963677599 3:148332392-148332414 AAGGATTTCTTTAAAAAGAGTGG + Intergenic
964006628 3:151836934-151836956 GCCAATTTCTTTAAAACAAGAGG + Intergenic
966198322 3:177335664-177335686 GCTGAATCCTTTTAAAAGAGTGG + Intergenic
966778181 3:183561217-183561239 GGGGATTCTTTTTAAAAGAGCGG + Intergenic
967666514 3:192179295-192179317 GCTGATTCCTCTAAAAATAAAGG + Intronic
967678138 3:192325286-192325308 TCACATTCCTTTAAAAAAATTGG - Intronic
970480757 4:16471313-16471335 GCTGATGTCTTTAAAAGAAGAGG - Intergenic
971428847 4:26542468-26542490 ACAGATTGCCTTAAAAAAAGAGG - Intergenic
971998796 4:34001627-34001649 GGGGAGTCATTTCAAAAAAGAGG - Intergenic
973100253 4:46258788-46258810 GGGGATTCCTTGAGAAAAATAGG + Intronic
975179281 4:71325232-71325254 TTGGATTCCATTAAAAAAAAAGG + Intronic
981163681 4:141531123-141531145 GTGGAATCTTTGAAAAAAAGGGG + Intergenic
988920986 5:35942456-35942478 GCCAATTCCTTGAAAAAAAAAGG + Intergenic
989522916 5:42422478-42422500 TCTGATTCCTTTGAAAATAGGGG + Intergenic
992709707 5:79439142-79439164 GCGGATTCCTTTAAAAAAAGGGG + Exonic
992974718 5:82103004-82103026 GGAGATTAGTTTAAAAAAAGGGG + Intronic
993586701 5:89739702-89739724 GCGGCTTCACTTAAAGAAAGTGG - Intergenic
993956784 5:94243973-94243995 GTGGATTCCTGAAAAAAGAGAGG - Intronic
994406401 5:99351492-99351514 ATGGATTCCTTTAATAAAAGTGG + Intergenic
996531829 5:124534858-124534880 GCAGATTCATATAAAAAAATCGG + Intergenic
997120658 5:131169609-131169631 GCAGATTTATTTAAGAAAAGAGG + Intronic
998362798 5:141604414-141604436 GATCACTCCTTTAAAAAAAGGGG + Intronic
999268111 5:150280151-150280173 GAGGCTTCCTTTAGAGAAAGTGG - Intronic
1009400144 6:63245021-63245043 GAGGATTACTTGAAAACAAGCGG + Intergenic
1010072848 6:71764256-71764278 GCTGATTCCTCTTAAGAAAGTGG - Intergenic
1012496595 6:99840298-99840320 CCAAATTCCTTCAAAAAAAGAGG - Intergenic
1015408633 6:132866448-132866470 GAGGATTTTTTTAAAAAAAATGG + Intergenic
1016283035 6:142440922-142440944 GAGCATTCCTTCAACAAAAGTGG + Intronic
1017695778 6:157014355-157014377 GCGGATTTCATTAAAAATATTGG - Intronic
1020325542 7:6971943-6971965 GGGTATTCAATTAAAAAAAGAGG - Intergenic
1021138656 7:16996181-16996203 GTGGATTGGATTAAAAAAAGTGG - Intergenic
1021959139 7:25854867-25854889 GAGGATTAATTTAAAGAAAGGGG + Intergenic
1024951454 7:54865001-54865023 GTGGTTTCCTTTAAACAAAGAGG + Intergenic
1025842554 7:65164113-65164135 GCAGATTTGTTTAAAAAAAATGG - Intergenic
1025880491 7:65531855-65531877 GCAGATTTGTTTAAAAAAAATGG + Intergenic
1025892946 7:65670749-65670771 GCAGATTTGTTTAAAAAAAATGG - Intergenic
1029968752 7:104768410-104768432 GCTGATTCCATTAATAAAAATGG - Intronic
1031178485 7:118383589-118383611 GGTAATTCATTTAAAAAAAGAGG - Intergenic
1033584605 7:142764806-142764828 TGGGACTCCTTAAAAAAAAGTGG + Intergenic
1035558424 8:585733-585755 GCGTATTCAATTAAGAAAAGAGG - Intergenic
1036088753 8:5641679-5641701 ACGCATTCCTTTAATAAAAGAGG + Intergenic
1036148787 8:6279245-6279267 GTGGATTCCTATTAAAAAATGGG - Intergenic
1038724657 8:30069818-30069840 GCGGATTCCTGTAACATGAGTGG - Exonic
1041876750 8:62697095-62697117 GCGTAATCCTTTAAAAACATAGG + Intronic
1042014700 8:64295588-64295610 GTTGATTGATTTAAAAAAAGTGG - Intergenic
1043709608 8:83399318-83399340 TAGAATTCCTTTAAAAAAAGGGG + Intergenic
1046095885 8:109559806-109559828 GCTGATTCCTAAAAAAAAAAAGG + Intronic
1049530228 8:143150874-143150896 TTGGATTCTTTTAAAAAAACAGG - Intergenic
1051330366 9:16019027-16019049 GTGGATTCATTTAAGAAAACAGG + Intronic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1055279898 9:74662333-74662355 TATGATTCCTTTAAAAAAGGAGG - Intronic
1055487423 9:76769823-76769845 CTGGATTACTTTCAAAAAAGCGG + Intronic
1055542240 9:77323092-77323114 TAAGATTCCTTTAACAAAAGTGG + Exonic
1058370647 9:104263180-104263202 GTGCATTCCTTAGAAAAAAGTGG + Intergenic
1059653956 9:116340186-116340208 GCTGCTTCATTCAAAAAAAGAGG - Intronic
1060158491 9:121337683-121337705 GCAGTTACCTTTGAAAAAAGGGG + Intergenic
1189118369 X:38367469-38367491 AAGGCTGCCTTTAAAAAAAGGGG - Intronic
1195496222 X:105537915-105537937 GGGTTTTCCTTTAATAAAAGGGG - Intronic
1202075128 Y:21029834-21029856 GGGGATTATTTTAATAAAAGGGG + Intergenic