ID: 992727974

View in Genome Browser
Species Human (GRCh38)
Location 5:79628778-79628800
Sequence ATATAGGGCTTATGAGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992727971_992727974 15 Left 992727971 5:79628740-79628762 CCTCAGAAACTTCATGTTCTGCA 0: 1
1: 0
2: 1
3: 29
4: 352
Right 992727974 5:79628778-79628800 ATATAGGGCTTATGAGAAATAGG 0: 1
1: 0
2: 1
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992727974 Original CRISPR ATATAGGGCTTATGAGAAAT AGG Intronic
902565192 1:17306791-17306813 CTGTAGGGCTTATGAGACCTTGG + Intergenic
903677984 1:25077374-25077396 ATACAGGGCTTGTGAGGAGTTGG + Intergenic
906983236 1:50654291-50654313 AAATAGGGCTAAAAAGAAATTGG - Intronic
908647533 1:66295035-66295057 ATTAATTGCTTATGAGAAATAGG + Intronic
909698926 1:78498905-78498927 ATACAGGACTTATGACAACTGGG + Intronic
910432606 1:87173921-87173943 ATATGAGGCTTTTGAGAAGTCGG + Intergenic
911004684 1:93207580-93207602 ATATATGGCATCTGAGAAACTGG - Intronic
911943725 1:104078720-104078742 ACATATGGCTCATGACAAATAGG - Intergenic
913591720 1:120335243-120335265 ATGTAAGGCTTAAGAGACATTGG - Intergenic
914599088 1:149182707-149182729 ATGTAAGGCTTAAGAGACATTGG + Intergenic
915780949 1:158549379-158549401 AAATAGAGCTGTTGAGAAATGGG - Intergenic
916391014 1:164330954-164330976 ATAAAGGCCTGAAGAGAAATGGG - Intergenic
917941112 1:179922553-179922575 AGATAGGGCTTAGGCGTAATGGG - Intronic
919481781 1:198099018-198099040 ATGTAGAGCTTGTGAGACATAGG + Intergenic
919591293 1:199506392-199506414 TTATAGGATTTATGAGAAAATGG + Intergenic
920794229 1:209123343-209123365 ATCTTGGGCAAATGAGAAATGGG - Intergenic
920908683 1:210194014-210194036 ATAGAGGGCTTATCAGTAATGGG - Intergenic
921663324 1:217835017-217835039 GTATATAGCTTAGGAGAAATAGG + Intronic
1063523258 10:6759981-6760003 AAACAGGGATTAAGAGAAATTGG - Intergenic
1063991804 10:11574164-11574186 ATACAAGGTTTTTGAGAAATTGG - Intronic
1065687016 10:28295868-28295890 AAAAAGGCCTTATTAGAAATAGG - Intronic
1067979040 10:51061896-51061918 ATATTGGAATTATCAGAAATGGG - Intronic
1069189802 10:65472487-65472509 ATATAAGGCTTAGGGGAAAGAGG - Intergenic
1069242955 10:66165244-66165266 ATATATGGCATATGAGCTATAGG - Intronic
1070422802 10:76253847-76253869 CTAGAGAGCTTATGAGACATAGG - Intronic
1071117218 10:82235562-82235584 ATATAGGCCTTAAGAGCAGTGGG - Intronic
1072298247 10:94033804-94033826 TTAAAGGACTTATGAAAAATTGG - Intronic
1086352468 11:85956034-85956056 AAATGTGACTTATGAGAAATAGG - Intergenic
1088430699 11:109755413-109755435 ATATTGGGCATAAGAGCAATGGG + Intergenic
1088528559 11:110784198-110784220 ACATAGGGATTATGGGAAAATGG + Intergenic
1090155419 11:124432548-124432570 TTATAGGACTGATGAGAAATTGG - Intergenic
1092551932 12:9512007-9512029 ATATAGGCCCTATGAAAAGTAGG + Intergenic
1092675343 12:10911652-10911674 ATATTGTGCCTATGAGAATTTGG + Intronic
1094520189 12:31178616-31178638 ATATAGGCCCTATGAAAAGTAGG - Intergenic
1097513322 12:60570830-60570852 ATATAGGTCTTATGAAAAATTGG - Intergenic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1103188845 12:118983250-118983272 ATACAGGTCTTTAGAGAAATAGG + Intronic
1104580973 12:130010434-130010456 AAATAGGGCTTTGCAGAAATGGG + Intergenic
1104705872 12:130947014-130947036 AGATAGGTCTAAGGAGAAATGGG - Intergenic
1108855069 13:54782749-54782771 GTATACGGCTTATGGGAACTGGG + Intergenic
1108988133 13:56620505-56620527 TTATAAGGCTTCTCAGAAATGGG + Intergenic
1110196424 13:72793724-72793746 ATGTGGGGCTTAAGAGAAAAAGG + Intronic
1112091489 13:96089377-96089399 AATTAGGGCTTATGAAATATAGG + Intergenic
1113095441 13:106658881-106658903 ATATAAGGTATATGAAAAATAGG - Intergenic
1117479022 14:56124926-56124948 ATGAAGGGCTTATAAGATATTGG + Intronic
1118753714 14:68823720-68823742 GAATGGGGCTTTTGAGAAATTGG + Intergenic
1124037842 15:26072767-26072789 ATATAAGGATAATGGGAAATAGG - Intergenic
1125248669 15:37673645-37673667 AAATATGCCTTAAGAGAAATAGG + Intergenic
1127542467 15:59954374-59954396 ATATATGGATTATAAGGAATTGG + Intergenic
1128595058 15:68937664-68937686 GTATAGGGGATATGGGAAATGGG + Intronic
1129811114 15:78510724-78510746 AAAGAGCGCTTCTGAGAAATTGG - Intronic
1132066330 15:98733864-98733886 ATATAAGACTTTTGAGAAAGGGG - Intronic
1133855428 16:9545060-9545082 ATTTAGGGCTGATGGGAATTTGG - Intergenic
1135656164 16:24252175-24252197 ATATGGGGCTTAGAAGATATTGG - Intergenic
1137248162 16:46722196-46722218 ATGTAGGGCTTATGATAGACAGG + Intronic
1138132353 16:54491504-54491526 GTTTGGGGCTTATGAGAAAATGG + Intergenic
1139076047 16:63449678-63449700 ATATAGGGGAGGTGAGAAATGGG - Intergenic
1140799638 16:78473904-78473926 ATTTAGGGATGATGAGAAAGTGG + Intronic
1143607096 17:7993515-7993537 ATATTTATCTTATGAGAAATGGG + Intergenic
1155624425 18:27818007-27818029 ATATAGGTTTTATGTGATATGGG - Intergenic
1155741587 18:29295964-29295986 GTATTCAGCTTATGAGAAATAGG - Intergenic
1155978086 18:32153456-32153478 TTATGGGGCCTTTGAGAAATTGG + Intronic
1156436054 18:37130928-37130950 ATACTGGGGTTATGACAAATAGG - Intronic
1157156294 18:45269673-45269695 ATATGTGGCTTGTGAGAGATTGG - Intronic
1157796342 18:50578998-50579020 ATACATGGCTTATGATAACTGGG + Intronic
1164716639 19:30395775-30395797 ATATAAGACTTATGATAACTAGG + Intronic
1167980748 19:53272976-53272998 ATTTAGGGCTTAGGAGAAGGAGG + Intergenic
1168119503 19:54243747-54243769 ATCTAGGGTTTATGAGACTTTGG + Intronic
925754223 2:7118563-7118585 ATACAGGGCAAATGGGAAATAGG + Intergenic
926660088 2:15455276-15455298 CCATAGGGCATATGAGAAAAAGG - Intronic
930505335 2:52276269-52276291 ATACCGGGCATATGAGAATTGGG - Intergenic
937536436 2:122894807-122894829 ATGTAGGGCTTGAGAGAGATTGG - Intergenic
939508813 2:143081550-143081572 AGATTGGGCTGAGGAGAAATTGG - Intergenic
940576722 2:155516556-155516578 ATAAAGGGTTTATTTGAAATTGG + Intergenic
942362418 2:175185916-175185938 AATTGGGGCATATGAGAAATTGG + Intergenic
943203991 2:184867197-184867219 ATATAAGGCATATTAGAAAGTGG - Intronic
943297796 2:186160588-186160610 ATAAAGAGATTATGTGAAATTGG + Intergenic
947240795 2:227992367-227992389 ACATAGGGGGTATGACAAATGGG + Intronic
1169036250 20:2454812-2454834 ATATAGGTCTTAGTAGAAAATGG + Intergenic
1169303391 20:4466392-4466414 AGTTAGGGCTTTTGAGGAATTGG - Intergenic
1169351133 20:4868860-4868882 ATCTAGGGCTTATGAACTATGGG - Intronic
1169646682 20:7818861-7818883 ATACAGAGCTTTTAAGAAATTGG + Intergenic
1170317393 20:15057496-15057518 ATATATGGCCTCTGAGAAGTTGG - Intronic
1170634915 20:18095756-18095778 ATATTGGGCTAATGAGAAGTAGG - Intergenic
1171947251 20:31389647-31389669 TTGTTGGGCTTATGTGAAATAGG - Intronic
1172589924 20:36110458-36110480 AGAGAGGGCTTCTGAGAAAGAGG + Intronic
1175600712 20:60270463-60270485 GTACAGGGCTTAGGAGAACTGGG + Intergenic
1175670462 20:60898506-60898528 ATATAATGCCTATAAGAAATAGG + Intergenic
1177065683 21:16431495-16431517 ACATTGAGCTTATAAGAAATAGG + Intergenic
1177110442 21:17021080-17021102 ATATAGGGCTTTTCATAATTAGG + Intergenic
1177671310 21:24232903-24232925 AAAGAGGGCTCATGAGAAAGAGG - Intergenic
1182569406 22:31225266-31225288 AAACAGGGCTTTTGAGGAATAGG + Intronic
949126258 3:448317-448339 ATATAGGGCTTAAGAGTATCTGG - Intergenic
949560169 3:5194000-5194022 AAATGGGGCTTATGTGAAAGAGG - Intronic
953497346 3:43399698-43399720 ATTTAGGGCATATGAGCAAGTGG + Intronic
955549987 3:60073526-60073548 ATAAAGGGCAGAAGAGAAATAGG - Intronic
956183165 3:66536195-66536217 ATATGAGGCTTATCAAAAATTGG + Intergenic
956569120 3:70674134-70674156 ATAAAGTGCTTATGGGAAAAAGG - Intergenic
957550651 3:81699420-81699442 ATATAAGGCTCATGAAAAATTGG - Intronic
957960678 3:87247291-87247313 ATATTGAGCTTATGACTAATGGG + Intronic
958457177 3:94346587-94346609 ATATAGGACATTTGAGAAAGTGG + Intergenic
958916177 3:100053097-100053119 ATATAGGGTTTAAGAGATAAAGG - Intronic
959400851 3:105900375-105900397 ATATAGGGGTAGTTAGAAATGGG + Intergenic
961342129 3:126233403-126233425 ATATTGGGCTTATTAGACAAAGG - Intergenic
961908925 3:130293795-130293817 ATACAGGGCCAATGAGACATAGG - Intergenic
962871357 3:139495820-139495842 ATATAAGGCTTATAATAAAGTGG + Intergenic
963870952 3:150412492-150412514 ATACAAGGCTAATTAGAAATGGG - Intronic
964195110 3:154054938-154054960 AAATAGGACTGATGGGAAATGGG + Intergenic
966156416 3:176921584-176921606 ATATAATGCATATGAAAAATGGG - Intergenic
967953574 3:194859724-194859746 CTATAGGAAATATGAGAAATGGG - Intergenic
968425639 4:521354-521376 ATATAGGTGTTATTAAAAATGGG + Intronic
969502428 4:7561219-7561241 ATACAGGGCTACTGAGACATGGG + Intronic
969976975 4:11113698-11113720 TTAAAGAGCTTTTGAGAAATTGG + Intergenic
970262364 4:14241306-14241328 ATATAGTGCTTATTATGAATAGG - Intergenic
972560167 4:40220072-40220094 ATAAAGGGCTTTTTACAAATTGG + Intronic
973996470 4:56464173-56464195 ATGTACAGATTATGAGAAATTGG - Intergenic
977769017 4:100835219-100835241 ATATAGGTGTTAGGAGAAAACGG + Intronic
981438457 4:144754381-144754403 ATATATGGCTTTTAAGTAATAGG - Intergenic
982422804 4:155217467-155217489 ATGTAAGGCTTTTGGGAAATAGG - Intergenic
984090091 4:175362636-175362658 ATTTGGAGCCTATGAGAAATAGG + Intergenic
984605779 4:181784698-181784720 ATATAGTCCTCATGAGAAATGGG - Intergenic
984731831 4:183075719-183075741 TTATAGGGCTTAGGGGAAAGAGG + Intergenic
988054618 5:26078035-26078057 ATATACAGGTTATGGGAAATAGG - Intergenic
988293352 5:29319750-29319772 AGATAGATATTATGAGAAATTGG - Intergenic
988870804 5:35386990-35387012 ATTTTGAGCTTATGTGAAATGGG - Intergenic
989505351 5:42220476-42220498 ATATATGACAAATGAGAAATTGG - Intergenic
992460943 5:76959690-76959712 ATTTAGGGCTTAAAGGAAATTGG - Intronic
992727974 5:79628778-79628800 ATATAGGGCTTATGAGAAATAGG + Intronic
993024632 5:82631137-82631159 ACATAAGGGTGATGAGAAATTGG - Intergenic
993085370 5:83357430-83357452 ATTAAGAGATTATGAGAAATCGG + Intergenic
993143423 5:84063552-84063574 GTATTGGGCTTATTAAAAATTGG + Intronic
994591018 5:101771820-101771842 AAATATTGCTTAGGAGAAATAGG - Intergenic
995933060 5:117474092-117474114 ATTTATGGCTTATCAGAAATAGG + Intergenic
996514406 5:124353886-124353908 AGATACGGAGTATGAGAAATTGG + Intergenic
1001062034 5:168499726-168499748 ATATATGTTTTATGAAAAATTGG - Intronic
1002505430 5:179676186-179676208 CTTTTGGGCTGATGAGAAATTGG - Intergenic
1004108634 6:12691203-12691225 ATATAGGGCTAAAGGCAAATGGG + Intergenic
1004971944 6:20920327-20920349 ATAAAGGTTTTATGAGAAATAGG + Intronic
1005704578 6:28438764-28438786 ACATGGGGATTATGAGAAATTGG + Intronic
1006866043 6:37209816-37209838 ATATGGGGCTTATTAGTGATGGG + Intergenic
1008170048 6:48193827-48193849 CCATAGGGCTTATGAGAAAAGGG + Intergenic
1009563787 6:65282603-65282625 TTACAGTGCTTATGAAAAATTGG - Intronic
1009742338 6:67762149-67762171 ATAGAGAGCTTAGAAGAAATGGG + Intergenic
1010357561 6:74951880-74951902 TAATAGGGCTTATTAAAAATGGG - Intergenic
1012805166 6:103884570-103884592 ATATAAGGCTTAGGAGAACAGGG + Intergenic
1014844871 6:126262652-126262674 ATTTAGGGCCTATGAGGACTGGG + Intergenic
1016771337 6:147855209-147855231 AAATAGGGCTTTTGAGATAAAGG + Intergenic
1016862460 6:148734543-148734565 ATATAGGGGTGCAGAGAAATGGG - Intergenic
1016927399 6:149364723-149364745 ATATAGGTCTTATGAAAATCTGG - Intronic
1017033538 6:150245705-150245727 ATAGAGTGCTTTTGAGTAATAGG + Intronic
1022169460 7:27810376-27810398 TTACAGGGCTATTGAGAAATAGG - Intronic
1022371656 7:29777220-29777242 TTATAGGGGTTAAGAGAAAGAGG + Intergenic
1028795419 7:94896431-94896453 CTATAGGGCTTATAAGAATTGGG - Intergenic
1030939169 7:115623751-115623773 ATATAGAGATTTTGAAAAATGGG + Intergenic
1031273925 7:119693691-119693713 AGAGAGAGATTATGAGAAATTGG + Intergenic
1032831381 7:135630559-135630581 ATATATGACTTATTTGAAATTGG + Intronic
1036681433 8:10877367-10877389 ATATAGGGGGGATGAGAAGTCGG - Intergenic
1039361118 8:36877847-36877869 TTAGAGGGCTTTTGAGAGATAGG - Intronic
1039614427 8:38943587-38943609 ACACAGGGCTTCTAAGAAATAGG + Intronic
1042408586 8:68435325-68435347 AAATAGGGTTTATTAAAAATGGG + Intronic
1043400466 8:79879513-79879535 AAATAGGGCATTTGAGAAACTGG + Intergenic
1043980564 8:86633567-86633589 ATATAGGGCTTCTAAGTTATAGG - Intronic
1045792718 8:106003782-106003804 AAATAGTGCTTACTAGAAATGGG + Intergenic
1046074082 8:109296386-109296408 AAATAGCGCTTCTGAAAAATGGG - Exonic
1046265046 8:111819813-111819835 AAATAGGGCTTATTTAAAATAGG - Intergenic
1046569551 8:115946291-115946313 ATATAGAGCATCTGAGAAAGTGG - Intergenic
1047227342 8:122968023-122968045 ATTTAGGGCTGATGAGAAGGCGG + Intronic
1050178141 9:2890941-2890963 ATAAAGAGATTATGAGAAACTGG + Intergenic
1050889605 9:10807359-10807381 TTCTAGGGCATATCAGAAATAGG - Intergenic
1051342116 9:16121285-16121307 AGATGGGGCTTATGTGAAGTGGG + Intergenic
1051404142 9:16716078-16716100 ATTTTGGGCTTCAGAGAAATAGG - Intronic
1051669028 9:19492156-19492178 ATCTAGGGATTAAGAGAAATAGG - Intergenic
1052189606 9:25643703-25643725 ATATAGGACCTATAAGACATTGG - Intergenic
1052341970 9:27372630-27372652 AGATAGGGCTTATGGGTTATGGG - Intronic
1052582324 9:30373924-30373946 ATATCTGGCCTATGAGAAAAGGG - Intergenic
1057959011 9:99437117-99437139 AGATAGAGCTACTGAGAAATAGG - Intergenic
1059576488 9:115494435-115494457 ATCTTGGGCTTATGAGAAACTGG - Intergenic
1186728424 X:12382265-12382287 ACATAGGGGTTAGGAAAAATGGG + Intronic
1189510175 X:41654358-41654380 TTAGAGGGCTAATAAGAAATGGG + Intronic
1190514734 X:51211941-51211963 AGATAGGGATTACGAGAAAATGG - Intergenic
1191952133 X:66604138-66604160 ATCTAGGTCTAATGAGAAAATGG - Intronic
1192618666 X:72654743-72654765 CTACAGGGCTTATGAGAAAATGG - Intronic
1195606942 X:106816415-106816437 AAATAGTGACTATGAGAAATTGG - Intronic
1196929919 X:120671351-120671373 ATATAGGGCCCATGAGAATAAGG - Intergenic
1199205262 X:145141158-145141180 ATATAGTGTTTATCAGAGATGGG - Intergenic
1200386748 X:155899759-155899781 ATCTAGAGCTAATGACAAATTGG - Intronic