ID: 992730396

View in Genome Browser
Species Human (GRCh38)
Location 5:79660870-79660892
Sequence ATGTCCCACTGGAAGATCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 4, 2: 28, 3: 52, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992730396_992730402 26 Left 992730396 5:79660870-79660892 CCAAAGATCTTCCAGTGGGACAT 0: 1
1: 4
2: 28
3: 52
4: 169
Right 992730402 5:79660919-79660941 TGATGATCCCGATACTGTGTGGG 0: 1
1: 1
2: 42
3: 313
4: 593
992730396_992730401 25 Left 992730396 5:79660870-79660892 CCAAAGATCTTCCAGTGGGACAT 0: 1
1: 4
2: 28
3: 52
4: 169
Right 992730401 5:79660918-79660940 GTGATGATCCCGATACTGTGTGG 0: 1
1: 0
2: 0
3: 1
4: 51
992730396_992730400 -10 Left 992730396 5:79660870-79660892 CCAAAGATCTTCCAGTGGGACAT 0: 1
1: 4
2: 28
3: 52
4: 169
Right 992730400 5:79660883-79660905 AGTGGGACATGATGTGGAGGTGG 0: 3
1: 214
2: 417
3: 430
4: 657

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992730396 Original CRISPR ATGTCCCACTGGAAGATCTT TGG (reversed) Intronic
900114864 1:1024114-1024136 ATGTCCCACCGGAAGCTCCTGGG - Intronic
900395909 1:2453154-2453176 CTGCCCCACTGGAAGATCGGGGG - Intronic
901267737 1:7924762-7924784 TTGTCCCACTGGAAGATCTTTGG - Intronic
903416218 1:23185036-23185058 TTGTCCCACTGAAGAATCTTGGG + Intergenic
903966570 1:27094316-27094338 ATTACCCACTGGAAGAGTTTTGG + Intergenic
903974757 1:27142125-27142147 AGGGCCCACTGGAAGAACTGAGG + Intronic
905265954 1:36754569-36754591 AAGTCCCACTGGACCAGCTTGGG + Intergenic
907056282 1:51371356-51371378 TTGTCCCCCTGGAAGGTCTTTGG - Intronic
907624852 1:56020032-56020054 TTGTCCCACTAGAAGGTCTTCGG + Intergenic
907805099 1:57810924-57810946 ATTTCCTTCTGGAAGATCTAGGG + Intronic
910900968 1:92120328-92120350 ATGTCCCACTGGAAGGTCTTCGG + Intronic
915026738 1:152837658-152837680 ATGCCCAACTGGAAGAGATTAGG + Intergenic
916865105 1:168848301-168848323 ATCTCCCAAAGGAAGATCATTGG + Intergenic
917169925 1:172160547-172160569 TTGTCTTACTGGAAGGTCTTCGG + Intronic
918031478 1:180816971-180816993 TTCTCCCACTGGAAGGTCTTCGG - Intronic
918726219 1:187927687-187927709 ATATCTCACTGGAATATGTTTGG + Intergenic
920324463 1:205151810-205151832 CTGTCCCACTGGAAGGTTTTCGG + Intronic
923546290 1:234925898-234925920 ATGTCTCAGTGGAAGAACTATGG + Intergenic
924435317 1:244034822-244034844 ATCTTTCACTGGAAGGTCTTCGG - Intergenic
1066567892 10:36739625-36739647 CTGTCCCGCTGGAAGCTCTTTGG + Intergenic
1067913419 10:50370834-50370856 TTGTCCCACCAGAAGGTCTTCGG + Intronic
1069705445 10:70456538-70456560 CTTCCCCACTGGAAGATCTAAGG + Intergenic
1070000563 10:72373493-72373515 TTTTACCACTGCAAGATCTTAGG - Intronic
1071539079 10:86463390-86463412 TTGTCCCATTGGAAGGTTTTAGG - Intronic
1071978694 10:90981347-90981369 TTGTCCCACTGGAAGGTCTTTGG - Intergenic
1072604458 10:96968032-96968054 ATGTTCCACAGGAAGTTTTTTGG + Intronic
1073906713 10:108289748-108289770 TTGTCCCATTGGAAGCTCTTCGG + Intergenic
1074447169 10:113530092-113530114 ATGTCCCCTTGGAAGCTCTCAGG - Intergenic
1074793397 10:116915268-116915290 AGGACCCACTGTCAGATCTTAGG - Intronic
1075438244 10:122460715-122460737 ATTTCCCACTGGAGAATCTTTGG - Intergenic
1075770051 10:124926511-124926533 TTGTCCCACTGGAAGGTCTTCGG + Intergenic
1077299412 11:1840224-1840246 ATGTCCCAGTGCAAGGTCTGGGG + Intronic
1078749703 11:14149181-14149203 TTGTCCCACTGGAAGGTCCTCGG - Intronic
1080263461 11:30375479-30375501 AGGGCCCACTGGAACAGCTTTGG + Intergenic
1080589992 11:33714827-33714849 TTGTCCCACTGGAAGGTCTTAGG + Intronic
1083069760 11:59965378-59965400 TTTTTCCACTGGGAGATCTTGGG - Intergenic
1083167048 11:60896332-60896354 TTTTCCCACCGGAAGGTCTTCGG - Intronic
1085142495 11:74159421-74159443 TTGTTCCACTGGAAGGTCTTAGG - Intronic
1087183201 11:95159443-95159465 TGGTCCCATTGGAAGATGTTTGG - Intergenic
1087757806 11:102073481-102073503 ATGTACCACTGGAGGACCTGAGG - Intronic
1087941634 11:104103990-104104012 TTGTTGCACTGGAAGGTCTTTGG - Intronic
1088269629 11:108020331-108020353 TTGTCCCACTGGAAAGTCTTCGG - Intronic
1091628805 12:2142629-2142651 TTGTGCCACTGGAAGGTCTTCGG - Intronic
1092665636 12:10793438-10793460 TTGTCCCACTGCAAGGTCTTTGG + Intergenic
1092777991 12:11960836-11960858 CTTTCCAACTGTAAGATCTTAGG - Intergenic
1093102474 12:15044664-15044686 ATTTCCCACTAAAAGAGCTTTGG + Intergenic
1093182172 12:15979260-15979282 TTGTGCCACAGGAAGAGCTTGGG + Intronic
1095863429 12:46945372-46945394 TTGCCTCACTGGAAGGTCTTTGG - Intergenic
1096057923 12:48670430-48670452 TTGTCCCAGTGGAAGGTCTTCGG - Intronic
1097702252 12:62832039-62832061 TGGTCCCACTGGAAGACATTAGG - Intronic
1098800272 12:74948791-74948813 GTGTCCCACTGGAAGGTCTTCGG + Intergenic
1101056320 12:100918915-100918937 TTATTCCACTGGAAGGTCTTAGG - Intronic
1106059394 13:26272423-26272445 TTGTCCCCCTGGAAGGTCTGAGG + Intronic
1106073807 13:26440238-26440260 ATTGCCCAGTGGAAGATCGTTGG + Intergenic
1108567510 13:51715482-51715504 TCGTCCCACTGGAAGGTCTTCGG + Intronic
1109104738 13:58236814-58236836 TTGTCCCACTGGAAGGTCTTCGG + Intergenic
1110358114 13:74592265-74592287 ATATGCAACTTGAAGATCTTTGG + Intergenic
1112201128 13:97276019-97276041 ATGTCCCACTTAAAGATGGTAGG - Exonic
1112288885 13:98127483-98127505 TTGTCCCACTGGAAGGTTTTTGG - Intergenic
1112706536 13:102075769-102075791 TTGTCCCACTGGAAAGTTTTCGG - Intronic
1113444960 13:110358317-110358339 TTGTCCCACCAGAAGGTCTTCGG + Intronic
1114768169 14:25398370-25398392 ATATCCCTCTGGAAGACTTTTGG - Intergenic
1114856867 14:26457820-26457842 TTGTCCTACTGAAAGATCTTTGG - Intronic
1115112651 14:29842073-29842095 TTGTCCCACTGGAATGTATTTGG + Intronic
1115877819 14:37880453-37880475 AGGGCCCAGTGGAAGATGTTTGG + Intronic
1116051099 14:39804318-39804340 ATGTGCCACTCAAGGATCTTAGG + Intergenic
1116064694 14:39968342-39968364 ATGTCCCACAGGTAGACCTCAGG - Intergenic
1116700898 14:48240398-48240420 TTGTCCCACTGGAAGGTCTTCGG + Intergenic
1119012561 14:71010205-71010227 CTGTGCCACTGTAAGATCTTCGG - Intronic
1119746807 14:77050568-77050590 ATGTCCTAATGGAACTTCTTGGG + Intergenic
1120504998 14:85344702-85344724 ATGTCACTCTTGAAGATATTTGG + Intergenic
1122450147 14:101799252-101799274 TTGTCCCACTGGAAAAACATGGG - Intronic
1124588272 15:31031009-31031031 ATGCCCTACTGGATGATCTATGG - Exonic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1127288199 15:57548716-57548738 ATGTCCCACAGCAAGCTTTTGGG + Exonic
1130156254 15:81352706-81352728 TTGTCCCACTGGAAGGTCTTCGG - Intronic
1130527697 15:84721473-84721495 AAGTCTCCCTGGAAGATTTTTGG + Intergenic
1131601989 15:93859043-93859065 TTGTCCCATTGGAAAGTCTTCGG + Intergenic
1135537710 16:23307047-23307069 CTGACCCACTGCAAGATTTTGGG - Intronic
1138035609 16:53603049-53603071 GTGTCCCAAAGGTAGATCTTGGG + Intronic
1138377412 16:56575059-56575081 ATTTCTCACTGGAAGCTTTTGGG + Intergenic
1138722951 16:59103203-59103225 ATATCTCAGTAGAAGATCTTTGG + Intergenic
1140574727 16:76153618-76153640 AAGTCACACTGCAATATCTTAGG - Intergenic
1145735385 17:27226371-27226393 TTGTCCCACTGGGAGATCTTCGG - Intergenic
1145786905 17:27599972-27599994 TTGTCCCACCGGAAGGTCTTCGG + Intronic
1145820888 17:27834386-27834408 TTGTCCCACTGGAAGGTCTTTGG + Intronic
1146108147 17:30062159-30062181 ATGGCCAACTAGAAGCTCTTAGG + Intronic
1146524261 17:33552701-33552723 AAATCCCACTGGTTGATCTTTGG - Intronic
1149261262 17:54882340-54882362 TTGTCCCACAGGAAGGTTTTTGG - Intergenic
1150867834 17:68872672-68872694 TTGTCCCACTGGAAGGTCTTCGG - Intronic
1150954820 17:69845822-69845844 ATGTTCCACTGGAAAATTGTTGG - Intergenic
1151035440 17:70793390-70793412 ATTTTCCACTGGTAGTTCTTGGG - Intergenic
1155319192 18:24602162-24602184 ATCTTCCACTGGAAGAGGTTGGG - Intergenic
1156069480 18:33188717-33188739 ATTTCCTACTGGAAGTTCTAGGG - Intronic
1158632817 18:59131218-59131240 ATGTTCCACTGGGAAAGCTTAGG + Intergenic
1159085663 18:63788239-63788261 TTGTCCCACTGAAAGGTCTTCGG - Intronic
1159187224 18:64990784-64990806 TTGTCCCACTGGAAGGTCTTTGG - Intergenic
1159278301 18:66249763-66249785 AAGTCCCACTGGAAGAATTAAGG - Intergenic
1160258043 18:77264280-77264302 ATGTCCCAAGGGAAAATCTGTGG + Intronic
1162897274 19:13772468-13772490 TTTTCCCACTGTATGATCTTGGG + Exonic
1165699155 19:37924298-37924320 TTGTCCCACTGGAAGGTCTTCGG + Intronic
925600225 2:5600961-5600983 TTGTCCCACTGGAAGGTCTTCGG + Intergenic
925632637 2:5911088-5911110 ATGGCCCAGTGGAAAATCTTAGG + Intergenic
926652383 2:15360777-15360799 TTGTCCCACTGGAAGGCCTTCGG + Intronic
927585775 2:24303275-24303297 TTGTCTCACTGGAAGGTGTTCGG - Intronic
929799683 2:45088943-45088965 ATTTGCCACAGGAAGATCATGGG - Intergenic
930535453 2:52640229-52640251 TTGTCCCACTGAAAGGTCTTCGG - Intergenic
932734629 2:74246082-74246104 ACATCCCACTGAAAGCTCTTAGG + Intronic
935391124 2:102553748-102553770 AAGTCCCACTGGATCATCTGGGG - Intergenic
935644411 2:105322055-105322077 TTGTCCCACTGGAAGGTCTTCGG - Intronic
936000558 2:108824477-108824499 TTGTTCCACTGGAAGGTCTTCGG + Intronic
938813545 2:134876537-134876559 TTGTCCCACTGGAAGGTCTTCGG + Intronic
940202855 2:151170343-151170365 TTGTCCCACTGGAAGGTCTTCGG + Intergenic
942738501 2:179145025-179145047 ATATCATACTGGAAGAACTTAGG + Intronic
943727690 2:191268795-191268817 GTGTCCTGCTGGCAGATCTTTGG + Intronic
945681482 2:212919127-212919149 CTGTCCCACTGTAAAATCTTTGG + Intergenic
946014008 2:216589257-216589279 ATGGGCCACTGGAAGATTTCTGG + Intergenic
947531355 2:230910544-230910566 CGGTCCCCCAGGAAGATCTTTGG - Exonic
1173464159 20:43268078-43268100 ATGTTGCACTGGTAGATTTTGGG - Intergenic
1173713919 20:45184679-45184701 TTGCCACACTGGAAGGTCTTCGG + Intergenic
1173879760 20:46403283-46403305 ATTTCCCAGTGGAAGAACTTTGG + Intronic
1174469512 20:50745961-50745983 ATGCCCCACTTGAAGATCAGAGG - Intronic
1175301287 20:57944810-57944832 TTGTCCCACTGGAAGGTCTTCGG + Intergenic
1175436698 20:58957289-58957311 TTGTCTCACTGGAAGGTCTTTGG + Intergenic
1184593080 22:45498785-45498807 GAGGCCCACTGGAAGATCATAGG - Intergenic
1184803764 22:46778566-46778588 TTGCCCCAGTGGAAGGTCTTCGG + Intronic
1184976124 22:48063748-48063770 ATGTCCCCGTGGCAGATCTCAGG - Intergenic
949255749 3:2043929-2043951 TTGTCCTACTGGAAGGTCTTCGG + Intergenic
950973349 3:17212614-17212636 TTGTCCCCCTGGAGGGTCTTTGG - Intronic
952461333 3:33529679-33529701 TTGTCCCACTAAAAGATCTTCGG + Intronic
952975377 3:38689997-38690019 TCGTCCCACTGGAAGGTCTTAGG - Intergenic
953223382 3:40995147-40995169 TTGTTCCACTGGTAGGTCTTCGG + Intergenic
953579242 3:44138451-44138473 ATGTCCCATTGGGAAGTCTTTGG + Intergenic
953738123 3:45513618-45513640 ATGTGCCACTAGAACATGTTGGG - Intronic
953793075 3:45963046-45963068 ATGTCCCACTGGACCATCCTTGG - Intronic
954772715 3:52987095-52987117 CTGTCCCACTGGAAGATCTTCGG + Intronic
955086222 3:55705555-55705577 ATGTCACACTGTAACATCTCTGG + Intronic
957918363 3:86715642-86715664 TTGCCTCACTGGAAGATATTTGG + Intergenic
959771761 3:110107329-110107351 ATGACCTAATGGAAGACCTTGGG - Intergenic
960498731 3:118409050-118409072 ATGTCCCACTAAAATATCTACGG + Intergenic
960560974 3:119083972-119083994 TTGTCTCACTGGAAGGTCCTTGG - Intronic
961023884 3:123534719-123534741 GTGTCCCACTTTAAGGTCTTCGG - Intronic
961245638 3:125450582-125450604 TAGTCACACTGGCAGATCTTAGG + Intronic
961968612 3:130933994-130934016 ATGTCCAACTGGAAGAATTTGGG + Intronic
965797478 3:172456175-172456197 AAGTCCCACTGAAATATCTATGG - Intergenic
966161464 3:176973270-176973292 TTGTCCCATTGGAAGGTCTTCGG + Intergenic
967872723 3:194245622-194245644 ATGTCCCATGGGAAGATTTGGGG + Intergenic
970157472 4:13155464-13155486 TTGTCCCGCTAGAAGGTCTTTGG - Intergenic
971850548 4:31980841-31980863 ATTTCTCACTGGAACATCTGGGG - Intergenic
972414333 4:38823938-38823960 ATCTGCCACTGGAAGATGCTGGG - Exonic
974831774 4:67198422-67198444 CTATCCCACTGCATGATCTTGGG + Intergenic
974858007 4:67483660-67483682 TTGTCCCACTGTAAGGTCTTTGG - Intronic
975686740 4:76923345-76923367 TCATCCCACTGGAAGGTCTTTGG - Intergenic
977676346 4:99752195-99752217 CTGTCCCACTGGAAGGTCTTTGG + Intergenic
978624837 4:110673306-110673328 TTGTGCCGCTGGAAGTTCTTTGG - Intergenic
981790370 4:148529585-148529607 TTGTCCCACTGTAAGGTCTATGG - Intergenic
981974010 4:150701182-150701204 TTGTCTCACTGGAGGGTCTTTGG + Intronic
984225765 4:177033030-177033052 ATGTGACATTGGATGATCTTGGG + Intergenic
986400861 5:7378472-7378494 ATGTTCCACTGGAGGATCCGTGG + Intergenic
987438997 5:17932702-17932724 ATGTCCCACTGGAGAAACTGAGG + Intergenic
988791642 5:34613789-34613811 TTGCCCCACTGGAAGGTCTTCGG - Intergenic
989090921 5:37730058-37730080 AAGTTCCACTTGAAAATCTTTGG + Intronic
989107189 5:37874280-37874302 ATAACCCACTGGAATATATTAGG - Intergenic
989175299 5:38518841-38518863 TTGTCCCACTGGAAGGTCTTCGG - Intronic
989785944 5:45329703-45329725 ATGTCCCACTGTAGAACCTTAGG + Intronic
990057239 5:51598479-51598501 TTGTTGCACTGGAAGGTCTTAGG - Intergenic
990520585 5:56575531-56575553 TTGTCCCACTGGAAGGCCTTTGG - Intronic
990667496 5:58090190-58090212 TTGTCCCACTGGAAGGTCCTCGG - Intergenic
991065419 5:62419539-62419561 TTGTCTCACTGGAAGGTCTTCGG + Intronic
991326375 5:65437645-65437667 ATATCAGACTGGAACATCTTTGG - Intronic
992256544 5:74927097-74927119 ATTTCCCACTGGCACATCTCTGG + Intergenic
992730396 5:79660870-79660892 ATGTCCCACTGGAAGATCTTTGG - Intronic
994269886 5:97764275-97764297 ATGTCCCCCTGGGGGATATTTGG + Intergenic
994680274 5:102878118-102878140 ATATCCCTCTGTAAGATATTTGG + Intronic
995208793 5:109513177-109513199 ATGTTCCACAGGAAGATAATTGG - Intergenic
995492354 5:112706683-112706705 AGGAGCCACTGGAAGATCTGGGG - Intergenic
996406690 5:123112168-123112190 GTGGCCCACTGGAAGGTGTTTGG + Intronic
998694305 5:144621504-144621526 ATGCCCCATTGGAAGATTGTGGG - Intergenic
1001556338 5:172640106-172640128 CTGTACCATTGGAAGATCTTGGG + Intergenic
1002868271 6:1143281-1143303 TTGTCCCACTAGATGGTCTTTGG - Intergenic
1002895115 6:1374491-1374513 ATGTCCCAATGGCATTTCTTAGG + Intergenic
1003380254 6:5618540-5618562 ATGTCTCCCTGAAACATCTTGGG - Intronic
1004123322 6:12847681-12847703 CTGTGCCACTGAAACATCTTGGG - Intronic
1004803812 6:19180183-19180205 ATGCACAACTGGAAAATCTTTGG - Intergenic
1006754688 6:36405069-36405091 TTGTCCCATGGGAAGGTCTTTGG - Intronic
1008067561 6:47066031-47066053 ACGTCCCACTGGAAGGTCTTAGG - Intergenic
1011110142 6:83828651-83828673 AGGTCACACTGGAAGATCCAGGG - Intergenic
1011401161 6:86963088-86963110 TTGTCCCACAGGAAGGTCTTTGG - Intronic
1012307870 6:97681754-97681776 ATGTATCACAGGAAGATATTTGG - Intergenic
1012919661 6:105208469-105208491 TTATCCCACTGGAAGGTCTTTGG + Intergenic
1013266941 6:108508962-108508984 AAGTCCCTCTGGAAGCTCCTGGG - Intronic
1014347022 6:120284004-120284026 TTGTCCCACTGGAAGGTCTTTGG + Intergenic
1014806936 6:125840072-125840094 CTGTCCCACTGGAAGTTCTCAGG - Intronic
1014942218 6:127456108-127456130 ATTTGCCACTGGAACTTCTTAGG + Intronic
1015680959 6:135807943-135807965 TTGTCCCACTGGAAGAATATGGG + Intergenic
1015840198 6:137468465-137468487 TTGTCCCACTGGAAGGTCCTCGG - Intergenic
1015942686 6:138467594-138467616 TTGTCCTACTGGAAGTTCCTCGG - Intronic
1019764861 7:2843210-2843232 ATTTCCCACTGGAAGATTTGTGG - Intronic
1021165331 7:17332438-17332460 TTGTCCCACTGGAAGGTCTGCGG - Intronic
1023656404 7:42426066-42426088 TTTTCCCACTGGAAGATCTTCGG + Intergenic
1026453416 7:70549864-70549886 GTAACCCACTGGAAGATCTCTGG + Intronic
1028636587 7:92996301-92996323 TTGTCCCACTGGAAAGTCTCAGG + Intergenic
1029616159 7:101659172-101659194 ATTTCTCACTCGAAGATCTGAGG + Intergenic
1029980345 7:104872711-104872733 TGGTCCCACTGGAAGGTCCTTGG + Intronic
1030707655 7:112711259-112711281 TTGTCCCACTGGAAGGTCTTCGG - Intergenic
1031413654 7:121469796-121469818 TTGAGCCACTGGAAGGTCTTCGG + Intergenic
1031916963 7:127572663-127572685 TTTTCCCACTAGAAGGTCTTTGG - Intergenic
1032995344 7:137439863-137439885 ATGCCCCACTGGAACATCTGAGG - Intronic
1034030686 7:147759810-147759832 ATGGCCCAGTGGAAAATGTTAGG - Intronic
1035899409 8:3441953-3441975 TTGTCCCACTGGAAAGTCTTCGG - Intronic
1035952260 8:4035505-4035527 TTGTCCCACCAGAAGGTCTTCGG - Intronic
1040835660 8:51728462-51728484 TTGTCCCAGTAGAACATCTTTGG - Intronic
1040938240 8:52804050-52804072 ATGTTTCACTGCAAGTTCTTCGG - Intergenic
1041148548 8:54906754-54906776 TTGTCCCAGTGGAAGGTTTTCGG - Intergenic
1042100639 8:65271988-65272010 TTCTCCCACTGGGAGATGTTAGG - Intergenic
1042164074 8:65928465-65928487 TTGTCCCACTGGAAAGTCTTTGG + Intergenic
1043211841 8:77529511-77529533 TTATGCCACTGGAAGGTCTTTGG + Intergenic
1044538061 8:93380337-93380359 TTGTCCCAGTGGAAGGTCTTCGG - Intergenic
1045072544 8:98523984-98524006 ATTTCTTACTGTAAGATCTTTGG + Intronic
1046054400 8:109061650-109061672 ATGACCAACTGGAAGATGTGGGG - Intergenic
1046199580 8:110906671-110906693 ATGTCTTACTGGAAGTTCTATGG + Intergenic
1047136622 8:122086021-122086043 CTGTCCCACTGGAAGGTCTTTGG - Intergenic
1048085804 8:131178209-131178231 TTGTCCCACTGGAAGATCTGTGG + Intergenic
1048252401 8:132877519-132877541 ATCTCCCACAGGCAGTTCTTTGG - Intronic
1049539013 8:143198128-143198150 ATGCCACAGTGGAAGAGCTTTGG - Intergenic
1050234613 9:3564618-3564640 TTGTCCCACTGGAAGATCTTTGG + Intergenic
1050848608 9:10256289-10256311 TTGTCCCACTGGAAGGTCTTCGG + Intronic
1053587909 9:39479590-39479612 ATGTTCCTCTGGAAGATATGGGG + Intergenic
1054578393 9:66885652-66885674 ATGTTCCTCTGGAAGATATGGGG - Intronic
1055753375 9:79531368-79531390 TTGTCCCATTGCATGATCTTGGG + Intergenic
1058511741 9:105726503-105726525 TTGTCCCACTTGAAGGTCTTAGG + Intronic
1059508496 9:114821733-114821755 CTGTCCCATTGGAAGGTCTATGG + Intergenic
1060754314 9:126201351-126201373 ATGACCCACTAGAAGAGCTAAGG + Intergenic
1061862787 9:133476471-133476493 ATGACTCACTGCAAGACCTTGGG + Intronic
1061866132 9:133492652-133492674 ATGTTCCACTGGAAGGCCTGAGG + Intergenic
1062258188 9:135641132-135641154 CTGTCCCTGTGGAACATCTTTGG - Intergenic
1186436095 X:9544248-9544270 GTGTCCTAGTGGAAGAGCTTGGG + Intronic
1188574202 X:31626376-31626398 ATGTACCACTGTAATATATTTGG - Intronic
1188838588 X:34988115-34988137 TTGTCCAATTGGAAGCTCTTGGG + Intergenic
1189003400 X:36969368-36969390 AAGTCCCACAGGTAAATCTTGGG + Intergenic
1191626708 X:63278016-63278038 ATGTCTAACTGGAATATTTTGGG - Intergenic
1192094429 X:68195748-68195770 ATCTCCCACTGAAATATCTGTGG - Intronic
1192162291 X:68797490-68797512 ATGTCATCCTGGAAGATCTCTGG + Intergenic
1192586004 X:72318635-72318657 ATGGGCCACTGTAAGAACTTTGG - Intergenic
1193145661 X:78073052-78073074 TTGTCCCACTGGAAGGTCTTTGG + Intronic
1194588075 X:95762155-95762177 TTGTCCCACTGGAAGGCCTTTGG + Intergenic
1195143298 X:101986349-101986371 GTTTCCCACTGTAGGATCTTAGG - Intergenic
1195444825 X:104940489-104940511 ATGCCCCACTAGAAGATACTTGG + Intronic
1195781697 X:108473408-108473430 TTGTCCCACTGGAAGGTCTTTGG - Intronic
1196322983 X:114365424-114365446 AGGCCCCACTGGAACATTTTGGG - Intergenic
1198153798 X:133937149-133937171 ATGACTCACTGGATGACCTTGGG - Intronic
1199267645 X:145847128-145847150 AAGCCCCACTGCAAGATATTGGG - Intergenic
1199270386 X:145875500-145875522 CTGTCTCACTGGAAGGTCTTCGG - Intergenic
1200303358 X:155000879-155000901 GTGTCTCACTGGATGATATTTGG - Intronic