ID: 992738995

View in Genome Browser
Species Human (GRCh38)
Location 5:79754265-79754287
Sequence GTATCTGCTTAGTTTAGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992738995 Original CRISPR GTATCTGCTTAGTTTAGGTA GGG (reversed) Intronic
903339661 1:22645733-22645755 GTATTTGCTCAGTTGAGATACGG - Intronic
907813371 1:57894377-57894399 GTATGTGCTCATTTTAGGTAGGG + Intronic
908030927 1:59998623-59998645 CTATCTGCATAGTTTAGGACTGG + Intronic
910609412 1:89125582-89125604 GTATCTGCTTAATAAAGTTAGGG - Intronic
911613447 1:99982414-99982436 GTATCTCATTAGTTTGGGGATGG + Intronic
911784682 1:101931622-101931644 GCATCTGCTCAGTATAGCTATGG - Intronic
918692596 1:187500498-187500520 TTATCTCCTTTGTTTAGATAAGG + Intergenic
919267158 1:195284392-195284414 GAAGCTGTTTAGTTTAGTTAAGG + Intergenic
1072300895 10:94061042-94061064 GTACCTGCTTAGTCTCAGTACGG - Intronic
1072346247 10:94509654-94509676 GTATCTGCCAGGTCTAGGTATGG - Intronic
1081970914 11:47198123-47198145 GTCTCTTCCTGGTTTAGGTAAGG + Intergenic
1087353526 11:97063813-97063835 CTCTCTTCTTAGTTTAGCTAGGG - Intergenic
1088822770 11:113470636-113470658 GTATCAGCTTAGTGTAGTTTGGG - Intronic
1092980089 12:13786153-13786175 GTACCTGCTTAGTTTAGTCGAGG - Intronic
1095146238 12:38730946-38730968 GTGTCTTCTCAGTTTAGGTGAGG + Intronic
1100259188 12:92915861-92915883 GTATATGCTTAGTTTTCTTATGG + Intronic
1103325599 12:120117684-120117706 GTTTCAGGTCAGTTTAGGTAGGG - Intergenic
1105947753 13:25203801-25203823 TTATCTGGTTACTTTAAGTAAGG - Intergenic
1123785828 15:23672094-23672116 GTCTCTTCTTAATTCAGGTATGG + Intergenic
1126053655 15:44710166-44710188 GCATTTTCTTAGTTTAGGCATGG + Intronic
1128036654 15:64532889-64532911 TAATCTCCTTATTTTAGGTACGG + Intronic
1130862863 15:87906729-87906751 GTGTGTGTGTAGTTTAGGTAGGG - Intronic
1132003408 15:98203084-98203106 GTATCTTCCTTGTGTAGGTACGG - Intergenic
1138343517 16:56306328-56306350 GAATCTGCAGAGTTTAGGCAGGG + Intronic
1140922306 16:79550700-79550722 GAATTTGCCTAGTTTGGGTATGG + Intergenic
1150767654 17:68014893-68014915 TAATGTGCTTTGTTTAGGTAGGG + Intergenic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1155435214 18:25805595-25805617 GTATGTGTTTACTTTACGTAAGG + Intergenic
1159396962 18:67871835-67871857 GTCTCAGCTGAATTTAGGTAAGG - Intergenic
929050538 2:37832908-37832930 GTAGCTGCTTTGTTTGGGGAAGG - Intergenic
939210567 2:139170105-139170127 GTATCTGATGTGTTCAGGTAAGG - Intergenic
939735356 2:145837397-145837419 ATATCTACTTAATTTAGCTAAGG - Intergenic
941329189 2:164156758-164156780 CTATATGCTTTGTTTATGTATGG + Intergenic
945576046 2:211530537-211530559 GTTTTTGCTTAGGTTAGCTATGG - Intronic
1169015251 20:2287357-2287379 GTATCTGCATAGATTATGTGTGG + Intergenic
1170213088 20:13864642-13864664 GTATCTGTTTTGTTTTGGTTTGG + Intronic
1173913080 20:46684713-46684735 GTACCTGCTTTGTTGGGGTATGG - Exonic
1174947369 20:55002941-55002963 GTATCTACATAGTTTAGCAATGG - Intergenic
1177892811 21:26826748-26826770 TGAACTGCTTGGTTTAGGTAGGG - Intergenic
1178845527 21:36171208-36171230 GTATCTGTATAGCTTACGTAAGG + Intronic
949561476 3:5206630-5206652 GTATGTGCTATGTTTAAGTAAGG + Intronic
949976082 3:9461366-9461388 GTTACTGAGTAGTTTAGGTAAGG + Intronic
958086401 3:88813686-88813708 GTATCTGGTTAGTATGAGTAAGG - Intergenic
963878797 3:150504644-150504666 GCATCTGCTCAGTTCAGGAAAGG - Intergenic
967642096 3:191877247-191877269 CTAACTGCTTAGTTTAAATAAGG - Intergenic
971063784 4:23003879-23003901 GTATCTGGTTAGTTTAATCAGGG - Intergenic
973726486 4:53782127-53782149 CTCTTTACTTAGTTTAGGTAAGG - Intronic
976539518 4:86257282-86257304 GTACCAGCTTAGGTTAGGTTGGG + Intronic
978959317 4:114656843-114656865 ATATCTACTTACTGTAGGTACGG + Intronic
979118553 4:116861101-116861123 TTATCTGCCTAGTTTCAGTAAGG + Intergenic
982885464 4:160774726-160774748 GTTTTTCCTTTGTTTAGGTAGGG + Intergenic
983929457 4:173436998-173437020 GTTTCTGGTTATTTTGGGTATGG - Intergenic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
993190333 5:84672309-84672331 GGAGCTGCTTAGTTTATGGATGG + Intergenic
995356782 5:111246748-111246770 GTCTCTGGTTTGTTTAGGTGTGG - Intronic
995497638 5:112764336-112764358 TTATTTTCATAGTTTAGGTAGGG + Intronic
996533455 5:124550780-124550802 ATTTCTCCCTAGTTTAGGTAAGG + Intergenic
1008945197 6:57089811-57089833 GTATTTGTTTGGTTTTGGTATGG - Intronic
1015110059 6:129582528-129582550 GTATCTACTAAGTCAAGGTAGGG + Intronic
1016173704 6:141051772-141051794 GTCTCTGCCTAGTTTATGTTTGG - Intergenic
1018150661 6:160934428-160934450 GTATGTGCATAGTGTATGTACGG - Intergenic
1022813552 7:33892492-33892514 ATCTCTGCTTAGATTATGTATGG + Intergenic
1025072480 7:55912552-55912574 GATTCTGCTTTGTGTAGGTATGG - Intronic
1027771327 7:82410292-82410314 ATATCTGCTTAGGTTGTGTAGGG + Intronic
1031920982 7:127600383-127600405 GTATCTGGGAATTTTAGGTAAGG + Exonic
1031984117 7:128151468-128151490 GTATTTTCTTAGTTTAAGGATGG + Intergenic
1039351578 8:36769614-36769636 CTATCTCCTTGGTTTGGGTAGGG - Intergenic
1046717458 8:117583457-117583479 GTATGTGCTTTGGTTTGGTAAGG + Intergenic
1060959697 9:127671320-127671342 GCATCTGCCTAGTCTGGGTAGGG - Intronic
1061084701 9:128392212-128392234 GGATTTGTTTTGTTTAGGTAGGG + Intergenic
1186250290 X:7658681-7658703 TTATCTGCTTAGTTTAAAAATGG + Intergenic
1186370230 X:8938928-8938950 GTAACTGCATGTTTTAGGTATGG + Intergenic
1190011973 X:46793152-46793174 GTATCTGATTAGAATAAGTAGGG - Intergenic
1194691863 X:96995900-96995922 CTATCTGCTTTGATTAGGTTTGG - Intronic
1197344421 X:125315706-125315728 ATATCTTCTTAGTTTAGCAATGG - Intergenic
1199062765 X:143378075-143378097 GTGTCCGCTAAGTTTAAGTATGG + Intergenic
1201305369 Y:12545481-12545503 GTAGCTGCTTAGCTGAGGCAAGG + Intergenic